EGCG-Derivative G28 Shows High Efficacy Inhibiting the Mammosphere-Forming Capacity of Sensitive and Resistant TNBC Models
Abstract
:1. Introduction
2. Results
2.1. FASN Expression in MDA-MB-231 Derived Chemoresistant Cell Lines
2.2. BCSC-Enriched Population in Sensitive and Resistant Cell Lines
2.3. Evaluation of EMT in Drug-Resistant TNBC Models
2.4. C75, EGCG and Its Derivatives G28, G56, and G37 Effect in BCSC-Enriched Populations
3. Discussion
4. Materials and Methods
4.1. Cell Culture and Development of Doxorubicin- and Paclitaxel-Resistant TNBC Cells
4.2. Western Blot Analysis of Cell Lysates
4.3. Cell Viability Assays
4.4. Mammosphere-Forming Assay
4.5. Quantitative Real-Time PCR Analysis
4.6. Aldefluor Assay
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Ferlay, J.; Colombet, M.; Soerjomataram, I.; Mathers, C.; Parkin, D.M.; Piñeros, M.; Znaor, A.; Bray, F. Estimating the global cancer incidence and mortality in 2018: GLOBOCAN sources and methods. Int. J. Cancer 2018. [Google Scholar] [CrossRef] [PubMed]
- Bianchini, G.; Balko, J.M.; Mayer, I.A.; Sanders, M.E.; Gianni, L. Triple-negative breast cancer: challenges and opportunities of a heterogeneous disease. Nat. Rev. Clin. Oncol. 2016, 13, 674–690. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dalmau, E.; Armengol-Alonso, A.; Muñoz, M.; Seguí-Palmer, M.Á. Current status of hormone therapy in patients with hormone receptor positive (HR+) advanced breast cancer. Breast 2014, 23, 710–720. [Google Scholar] [CrossRef] [PubMed]
- Nixon, N.A.; Hannouf, M.B.; Verma, S. A review of the value of human epidermal growth factor receptor 2 (HER2)-targeted therapies in breast cancer. Eur. J. Cancer 2018, 89, 72–81. [Google Scholar] [CrossRef] [PubMed]
- Griffiths, C.L.; Olin, J.L. Triple negative breast cancer: A brief review of its characteristics and treatment options. J. Pharm. Pract. 2012, 25, 319–323. [Google Scholar] [CrossRef] [PubMed]
- Anders, C.K.; Carey, L.A. Biology, Metastatic Patterns, and Treatment of Patients with Triple-Negative Breast Cancer. Clin. Breast Cancer 2009, 9, S73–S81. [Google Scholar] [CrossRef] [PubMed]
- Guarneri, V.; Dieci, M.V.; Conte, P. Relapsed Triple-Negative Breast Cancer: Challenges and Treatment Strategies. Drugs 2013, 73, 1257–1265. [Google Scholar] [CrossRef] [PubMed]
- Massihnia, D.; Galvano, A.; Fanale, D.; Perez, A.; Castiglia, M.; Incorvaia, L.; Listì, A.; Rizzo, S.; Cicero, G.; Bazan, V.; et al. Triple negative breast cancer: Shedding light onto the role of pi3k/akt/mtor pathway. Oncotarget 2016, 7, 60712–60722. [Google Scholar] [CrossRef] [PubMed]
- Prat, A.; Parker, J.S.; Karginova, O.; Fan, C.; Livasy, C.; Herschkowitz, J.I.; He, X.; Perou, C.M. Phenotypic and molecular characterization of the claudin-low intrinsic subtype of breast cancer. Breast Cancer Res. 2010, 12. [Google Scholar] [CrossRef]
- Palomeras, S.; Ruiz-Martínez, S.; Puig, T. Targeting Breast Cancer Stem Cells to Overcome Treatment Resistance. Molecules 2018, 23, 2193. [Google Scholar] [CrossRef]
- Mani, S.A.; Guo, W.; Liao, M.-J.; Eaton, E.N.; Ayyanan, A.; Zhou, A.Y.; Brooks, M.; Reinhard, F.; Zhang, C.C.; Shipitsin, M.; et al. The Epithelial-Mesenchymal Transition Generates Cells with Properties of Stem Cells. Cell 2008, 133, 704–715. [Google Scholar] [CrossRef] [Green Version]
- Kotiyal, S.; Bhattacharya, S. Breast cancer stem cells, EMT and therapeutic targets. Biochem. Biophys. Res. Commun. 2014, 453, 112–116. [Google Scholar] [CrossRef]
- Grzegrzolka, J.; Biala, M.; Wojtyra, P.; Kobierzycki, C.; Olbromski, M.; Gomulkiewicz, A.; Piotrowska, A.; Rys, J.; Podhorska-Okolow, M.; Dziegiel, P. Expression of EMT Markers SLUG and TWIST in Breast Cancer. Anticancer Res. 2015, 35, 3961–3968. [Google Scholar]
- Wang, T.; Fahrmann, J.F.; Lee, H.; Li, Y.J.; Tripathi, S.C.; Yue, C.; Zhang, C.; Lifshitz, V.; Song, J.; Yuan, Y.; et al. JAK/STAT3-Regulated Fatty Acid β-Oxidation Is Critical for Breast Cancer Stem Cell Self-Renewal and Chemoresistance. Cell Metab. 2017, 1–15. [Google Scholar] [CrossRef]
- Warburg, O. On the origin of cancer Cells. Science 1956, 123, 309–314. [Google Scholar] [CrossRef]
- Devic, S. Warburg Effect—A Consequence or the Cause of Carcinogenesis? J. Cancer 2016, 7, 817–822. [Google Scholar] [CrossRef]
- Hanahan, D.; Weinberg, R.A. Hallmarks of cancer: the next generation. Cell 2011, 144, 646–674. [Google Scholar] [CrossRef]
- Wakil, S.J. Fatty Acid Synthase, A Proficient Multifunctional Enzyme. Biochemestry 1989, 28, 4523–4530. [Google Scholar] [CrossRef]
- Zaytseva, Y.Y.; Harris, J.W.; Mitov, M.I.; Kim, J.T.; Butterfield, D.A.; Lee, E.Y.; Weiss, H.L.; Gao, T.; Evers, B.M. Increased expression of fatty acid synthase provides a survival advantage to colorectal cancer cells via upregulation of cellular respiration. Oncotarget 2015, 6, 18891–18904. [Google Scholar] [CrossRef] [Green Version]
- Witkiewicz, A.K.; Nguyen, K.H.; Dasgupta, A.; Kennedy, E.P.; Yeo, C.J.; Lisanti, M.P.; Brody, J.R. Co-expression of fatty acid synthase and caveolin-1 in pancreatic ductal adenocarcinoma: Implications for tumor progression and clinical outcome. Cell Cycle 2008, 7, 3021–3025. [Google Scholar] [CrossRef] [Green Version]
- Shah, U.S.; Dhir, R.; Gollin, S.M.; Chandran, U.R.; Lewis, D.; Acquafondata, M.; Pflug, B.R. Fatty acid synthase gene overexpression and copy number gain in prostate adenocarcinoma. Hum. Pathol. 2006, 37, 401–409. [Google Scholar] [CrossRef] [PubMed]
- Veigel, D.; Wagner, R.; Stübiger, G.; Wuczkowski, M.; Filipits, M.; Horvat, R.; Benhamú, B.; López-Rodríguez, M.L.; Leisser, A.; Valent, P.; et al. Fatty acid synthase is a metabolic marker of cell proliferation rather than malignancy in ovarian cancer and its precursor cells. Int. J. Cancer 2015, 136, 2078–2090. [Google Scholar] [CrossRef]
- Pizer, E.S.; Wood, F.D.; Heine, H.S.; Romantsev, F.E.; Pasternack, G.R.; Kuhajda, F.P. Inhibition of fatty acid synthesis delays disease progression in a xenograft model of ovarian cancer. Cancer Res. 1996, 56, 1189–1193. [Google Scholar] [PubMed]
- Li, J.N.; Gorospe, M.; Chrest, F.J.; Kumaravel, T.S.; Evans, M.K.; Han, W.F.; Pizer, E.S. Pharmacological inhibition of fatty acid synthase activity produces both cytostatic and cytotoxic effects modulated by p53. Cancer Res. 2001, 61, 1493–1499. [Google Scholar] [PubMed]
- Puig, T.; Porta, R.; Colomer, R. Fatty acid synthase: a new anti-tumor target. Med. Clin. (Barc). 2009, 132, 359–363. [Google Scholar] [CrossRef] [PubMed]
- Blancafort, A.; Giró-Perafita, A.; Oliveras, G.; Palomeras, S.; Turrado, C.; Campuzano, Ò.; Carrión-Salip, D.; Massaguer, A.; Brugada, R.; Palafox, M.; Gómez-Miragaya, J.; González-Suárez, E.; Puig, T. Dual fatty acid synthase and HER2 signaling blockade shows marked antitumor activity against breast cancer models resistant to anti-HER2 drugs. PLoS ONE 2015, 10, e0131241. [Google Scholar] [CrossRef] [PubMed]
- Bandyopadhyay, S.; Zhan, R.; Wang, Y.; Pai, S.K.; Hirota, S.; Hosobe, S.; Takano, Y.; Saito, K.; Furuta, E.; Iiizumi, M.; et al. Mechanism of apoptosis induced by the inhibition of fatty acid synthase in breast cancer cells. Cancer Res. 2006, 66, 5934–5940. [Google Scholar] [CrossRef] [PubMed]
- Puig, T.; Vázquez-Martín, A.; Relat, J.; Pétriz, J.; Menéndez, J.A.; Porta, R.; Casals, G.; Marrero, P.F.; Haro, D.; Brunet, J.; Colomer, R. Fatty acid metabolism in breast cancer cells: Differential inhibitory effects of epigallocatechin gallate (EGCG) and C75. Breast Cancer Res. Treat. 2008, 109, 471–479. [Google Scholar] [CrossRef]
- Seguin, F.; Carvalho, M.A.; Bastos, D.C.; Agostini, M.; Zecchin, K.G.; Alvarez-Flores, M.P.; Chudzinski-Tavassi, A.M.; Coletta, R.D.; Graner, E. The fatty acid synthase inhibitor orlistat reduces experimental metastases and angiogenesis in B16-F10 melanomas. Br. J. Cancer 2012, 107, 977–987. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Browne, C.D.; Hindmarsh, E.J.; Smith, J.W. Inhibition of endothelial cell proliferation and angiogenesis by orlistat, a fatty acid synthase inhibitor. FASEB J. 2006, 20, 2027–2035. [Google Scholar] [CrossRef] [PubMed]
- Meena, A.S.; Sharma, A.; Kumari, R.; Mohammad, N.; Singh, S.V.; Bhat, M.K. Inherent and acquired resistance to paclitaxel in hepatocellular carcinoma: molecular events involved. PLoS ONE 2013, 8, e61524. [Google Scholar] [CrossRef] [PubMed]
- Rysman, E.; Brusselmans, K.; Scheys, K.; Timmermans, L.; Derua, R.; Munck, S.; Van Veldhoven, P.P.; Waltregny, D.; Daniels, V.W.; Machiels, J.; et al. De novo lipogenesis protects cancer cells from free radicals and chemotherapeutics by promoting membrane lipid saturation. Cancer Res. 2010, 70, 8117–8126. [Google Scholar] [CrossRef] [PubMed]
- Menendez, J.A.; Vellon, L.; Colomer, R.; Lupu, R. Pharmacological and small interference RNA-mediated inhibition of breast cancer-associated fatty acid synthase (oncogenic antigen-519) synergistically enhances Taxol (paclitaxel)-induced cytotoxicity. Int. J. Cancer 2005, 115, 19–35. [Google Scholar] [CrossRef] [Green Version]
- Giró-Perafita, A.; Palomeras, S.; Lum, D.H.; Blancafort, A.; Viñas, G.; Oliveras, G.; Pérez-Bueno, F.; Sarrats, A.; Welm, A.L.; Puig, T. Preclinical Evaluation of Fatty Acid Synthase and EGFR Inhibition in Triple Negative Breast Cancer. Clin. Cancer Res. 2016, 22, 4687–4697. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Giró-Perafita, A.; Sarrats, A.; Pérez-Bueno, F.; Oliveras, G.; Buxó, M.; Brunet, J.; Viñas, G.; Puig Miquel, T. Fatty acid synthase expression and its association with clinico-histopathological features in triple-negative breast cancer. Oncotarget 2017, 8, 74391–74405. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Scheel, C.; Weinberg, R.A. Cancer stem cells and epithelial-mesenchymal transition: Concepts and molecular links. Semin. Cancer Biol. 2012, 22, 396–403. [Google Scholar] [CrossRef] [PubMed]
- Huber, M.A.; Kraut, N.; Beug, H. Molecular requirements for epithelial-mesenchymal transition during tumor progression. Curr. Opin. Cell Biol. 2005, 17, 548–558. [Google Scholar] [CrossRef] [PubMed]
- Marjanovic, N.D.; Weinberg, R.A.; Chaffer, C.L. Cell plasticity and heterogeneity in cancer. Clin. Chem. 2013, 59, 168–179. [Google Scholar] [CrossRef]
- Morel, A.-P.; Lièvre, M.; Thomas, C.; Hinkal, G.; Ansieau, S.; Puisieux, A. Generation of breast cancer stem cells through epithelial-mesenchymal transition. PLoS ONE 2008, 3. [Google Scholar] [CrossRef] [PubMed]
- Chen, D.; Wan, S.B.; Yang, H.; Yuan, J.; Chan, T.H.; Dou, Q.P. EGCG, green tea polyphenols and their synthetic analogs and prodrugs for human cancer prevention and treatment. Adv. Clin. Chem. 2011, 53, 155–177. [Google Scholar] [Green Version]
- Puig, T.; Relat, J.; Marrero, P.F.; Haro, D.; Brunet, J.; Colomer, R. Green tea catechin inhibits fatty acid synthase without stimulating carnitine palmitoyltransferase-1 or inducing weight loss in experimental animals. Anticancer Res. 2008, 28, 3671–3676. [Google Scholar] [PubMed]
- Fujiki, H.; Sueoka, E.; Rawangkan, A.; Suganuma, M. Human cancer stem cells are a target for cancer prevention using (−)-epigallocatechin gallate. J. Cancer Res. Clin. Oncol. 2017, 143, 1–12. [Google Scholar] [CrossRef]
- Oliveras, G.; Blancafort, A.; Urruticoechea, A.; Campuzano, O.; Gómez-Cabello, D.; Brugada, R.; López-Rodríguez, M.L.; Colomer, R.; Puig, T. Novel anti-fatty acid synthase compounds with anti-cancer activity in HER2+ breast cancer. Ann. N. Y. Acad. Sci. 2010, 1210, 86–92. [Google Scholar] [CrossRef] [PubMed]
- Turrado, C.; Puig, T.; García-Cárceles, J.; Artola, M.; Benhamú, B.; Ortega-Gutiérrez, S.; Relat, J.; Oliveras, G.; Blancafort, A.; Haro, D.; et al. New synthetic inhibitors of fatty acid synthase with anticancer activity. J. Med. Chem. 2012, 55, 5013–5023. [Google Scholar] [CrossRef] [PubMed]
- Crous-Masó, J.; Palomeras, S.; Relat, J.; Camó, C.; Martínez-Garza, Ú.; Planas, M.; Feliu, L.; Puig, T. (−)-Epigallocatechin 3-gallate synthetic analogues inhibit fatty acid synthase and show anticancer activity in triple negative breast cancer. Molecules 2018, 23, 1160. [Google Scholar] [CrossRef] [PubMed]
- Puig, T.; Aguilar, H.; Cufí, S.; Oliveras, G.; Turrado, C.; Ortega-Gutiérrez, S.; Benhamú, B.; López-Rodríguez, M.L.; Urruticoechea, A.; Colomer, R. A novel inhibitor of fatty acid synthase shows activity against HER2+ breast cancer xenografts and is active in anti-HER2 drug-resistant cell lines. Breast Cancer Res. 2011, 13, R131. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Wu, X.; Dong, Z.; Luo, Z.; Zhao, Z.; Xu, Y.; Zhang, J.-T. Fatty acid synthase causes drug resistance by inhibiting TNF-α and ceramide production. J. Lipid Res. 2013, 54, 776–785. [Google Scholar] [CrossRef] [PubMed]
- Zeng, L.; Wu, G.-Z.; Goh, K.J.; Lee, Y.M.; Ng, C.C.; You, A.B.; Wang, J.; Jia, D.; Hao, A.; Yu, Q.; et al. Saturated fatty acids modulate cell response to DNA damage: implication for their role in tumorigenesis. PLoS ONE 2008, 3, e2329. [Google Scholar] [CrossRef] [PubMed]
- Wu, X.; Qin, L.; Fako, V.; Zhang, J.-T. Molecular mechanisms of fatty acid synthase (FASN)-mediated resistance to anti-cancer treatments. Adv. Biol. Regul. 2014, 54, 214–221. [Google Scholar] [CrossRef] [PubMed]
- Talebi, A.; Dehairs, J.; Swinnen, J.V. De novo lipogenesis and membrane remodeling in cancer. Biomed. Res. India 2012, 23, 49–53. [Google Scholar]
- Bauerschlag, D.O.; Maass, N.; Leonhardt, P.; Verburg, F.A.; Pecks, U.; Zeppernick, F.; Morgenroth, A.; Mottaghy, F.M.; Tolba, R.; Meinhold-Heerlein, I.; et al. Fatty acid synthase overexpression: target for therapy and reversal of chemoresistance in ovarian cancer. J. Transl. Med. 2015, 13, 1–12. [Google Scholar] [CrossRef]
- Creighton, C.J.; Li, X.; Landis, M.; Dixon, J.M.; Neumeister, V.M.; Sjolund, A.; Rimm, D.L.; Wong, H.; Rodriguez, A.; Herschkowitz, J.I.; et al. Residual breast cancers after conventional therapy display mesenchymal as well as tumor-initiating features. Proc. Natl. Acad. Sci. USA 2009, 106, 13820–13825. [Google Scholar] [CrossRef] [Green Version]
- Vidal, S.J.; Rodriguez-Bravo, V.; Galsky, M.; Cordon-Cardo, C.; Domingo-Domenech, J. Targeting cancer stem cells to suppress acquired chemotherapy resistance. Oncogene 2013, 1–13. [Google Scholar] [CrossRef]
- Domingo-Domenech, J.; Vidal, S.J.; Rodriguez-Bravo, V.; Castillo-Martin, M.; Quinn, S.A.; Rodriguez-Barrueco, R.; Bonal, D.M.; Charytonowicz, E.; Gladoun, N.; de la Iglesia-Vicente, J.; et al. Suppression of Acquired Docetaxel Resistance in Prostate Cancer through Depletion of Notch- and Hedgehog-Dependent Tumor-Initiating Cells. Cancer Cell 2012, 22, 373–388. [Google Scholar] [CrossRef]
- Dean, M.; Fojo, T.; Bates, S. Tumour stem cells and drug resistance. Nat Rev Cancer 2005, 5, 275–284. [Google Scholar] [CrossRef]
- Thiery, J.P. Epithelial-mesenchymal transitions in tumour progression. Nat. Rev. Cancer 2002, 2, 442–454. [Google Scholar] [CrossRef]
- Prat, A.; Perou, C.M. Deconstructing the molecular portraits of breast cancer. Mol. Oncol. 2011, 5, 5–23. [Google Scholar] [CrossRef]
- Shaw, F.L.; Harrison, H.; Spence, K.; Ablett, M.P.; Simoes, B.M.; Farnie, G.; Clarke, R.B. A detailed mammosphere assay protocol for the quantification of breast stem cell activity. J. Mammary Gland Biol. Neoplasia 2012, 17, 111–117. [Google Scholar] [CrossRef]
- Prud’Homme, G.J.; Glinka, Y.; Toulina, A.; Ace, O.; Subramaniam, V.; Jothy, S. Breast cancer stem-like cells are inhibited by a non-toxic aryl hydrocarbon receptor agonist. PLoS ONE 2010, 5. [Google Scholar] [CrossRef]
- Grimshaw, M.J.; Cooper, L.; Papazisis, K.; Coleman, J.A.; Bohnenkamp, H.R.; Chiapero-Stanke, L.; Taylor-Papadimitriou, J.; Burchell, J.M. Mammosphere culture of metastatic breast cancer cells enriches for tumorigenic breast cancer cells. Breast Cancer Res. 2008, 10, R52. [Google Scholar] [CrossRef]
- Wang, R.; Lv, Q.; Meng, W.; Tan, Q.; Zhang, S.; Mo, X.; Yang, X. Comparison of mammosphere formation from breast cancer cell lines and primary breast tumors. J. Thorac. Dis. 2014, 6, 829–837. [Google Scholar] [CrossRef]
- Tanei, T.; Morimoto, K.; Shimazu, K.; Seung, J.K.; Tanji, Y.; Taguchi, T.; Tamaki, Y.; Noguchi, S. Association of breast cancer stem cells identified by aldehyde dehydrogenase 1 expression with resistance to sequential paclitaxel and epirubicin-based chemotherapy for breast cancers. Clin. Cancer Res. 2009, 15, 4234–4241. [Google Scholar] [CrossRef]
- Moody, S.E.; Perez, D.; Pan, T.C.; Sarkisian, C.J.; Portocarrero, C.P.; Sterner, C.J.; Notorfrancesco, K.L.; Cardiff, R.D.; Chodosh, L.A. The transcriptional repressor Snail promotes mammary tumor recurrence. Cancer Cell 2005, 8, 197–209. [Google Scholar] [CrossRef] [Green Version]
- Tran, H.D.; Luitel, K.; Kim, M.; Zhang, K.; Longmore, G.D.; Tran, D.D. Transient SNAIL1 expression is necessary for metastatic competence in breast cancer. Cancer Res. 2014, 74, 6330–6340. [Google Scholar] [CrossRef]
- Ye, X.; Tam, W.L.; Shibue, T.; Kaygusuz, Y.; Reinhardt, F.; Ng Eaton, E.; Weinberg, R.A. Distinct EMT programs control normal mammary stem cells and tumour-initiating cells. Nature 2015, 525, 256–260. [Google Scholar] [CrossRef] [Green Version]
- Phillips, S.; Kuperwasser, C. SLUG: Critical regulator of epithelial cell identity in breast development and cancer. Cell Adhes. Migr. 2014, 8, 578–587. [Google Scholar] [CrossRef] [Green Version]
- Zhuang, X.; Zhang, W.; Chen, Y.; Han, X.; Li, J.; Zhang, Y.Y.; Zhang, Y.Y.; Zhang, S.; Liu, B. Doxorubicin-enriched, ALDH(br) mouse breast cancer stem cells are treatable to oncolytic herpes simplex virus type 1. BMC Cancer 2012, 12, 549. [Google Scholar] [CrossRef]
- Kruger, J.A.; Kaplan, C.D.; Luo, Y.; Zhou, H.; Markowitz, D.; Xiang, R.; Reisfeld, R.A. Characterization of stem cell-like cancer cells in immune-competent mice. Blood 2006, 108, 3906–3912. [Google Scholar] [CrossRef] [Green Version]
- Bandyopadhyay, A.; Wang, L.; Agyin, J.; Tang, Y.; Lin, S.; Yeh, I.T.; De, K.; Sun, L.Z. Doxorubicin in combination with a small TGFβ inhibitor: A potential novel therapy for metastatic breast cancer in mouse models. PLoS ONE 2010, 5. [Google Scholar] [CrossRef]
- Tudoran, O.; Soritau, O.; Balacescu, L.; Visan, S.; Barbos, O.; Cojocneanu-Petric, R.; Balacescu, O.; Berindan-Neagoe, I. Regulation of stem cells-related signaling pathways in response to doxorubicin treatment in Hs578T triple-negative breast cancer cells. Mol. Cell. Biochem. 2015, 409, 163–176. [Google Scholar] [CrossRef]
- Silva Galbiatti-Dias, A.L.; Fernandes, G.M.M.; Castanhole-Nunes, M.M.U.; Hidalgo, L.F.; Nascimento Filho, C.H.V.; Kawasaki-Oyama, R.S.; Ferreira, L.A.M.; Biselli-Chicote, P.M.; Pavarino, É.C.; Goloni-Bertollo, E.M. Relationship between CD44(high)/CD133(high)/CD117(high) cancer stem cells phenotype and Cetuximab and Paclitaxel treatment response in head and neck cancer cell lines. Am. J. Cancer Res. 2018, 8, 1633–1641. [Google Scholar]
- Liu, H.; Liu, Y.; Zhang, J.-T. A new mechanism of drug resistance in breast cancer cells: fatty acid synthase overexpression-mediated palmitate overproduction. Mol. Cancer Ther. 2008, 7, 263–270. [Google Scholar] [CrossRef] [Green Version]
- Gonzalez-Guerrico, A.M.; Espinoza, I.; Schroeder, B.; Park, C.H.; KVP, C.M.; Khurana, A.; Corominas-Faja, B.; Cuyàs, E.; Alarcón, T.; Kleer, C.; et al. Suppression of endogenous lipogenesis induces reversion of the malignant phenotype and normalized differentiation in breast cancer. Oncotarget 2016, 7, 71151–71168. [Google Scholar] [CrossRef] [Green Version]
- Pandey, P.R.; Okuda, H.; Watabe, M.; Pai, S.K.; Liu, W.; Kobayashi, A.; Xing, F.; Fukuda, K.; Hirota, S.; Sugai, T.; et al. Resveratrol suppresses growth of cancer stem-like cells by inhibiting fatty acid synthase. Breast Cancer Res. Treat. 2011, 130, 387–398. [Google Scholar] [CrossRef]
- Yasumoto, Y.; Miyazaki, H.; Vaidyan, L.K.; Kagawa, Y.; Ebrahimi, M.; Yamamoto, Y.; Ogata, M.; Katsuyama, Y.; Sadahiro, H.; Suzuki, M.; et al. Inhibition of fatty acid synthase decreases expression of stemness markers in glioma stem cells. PLoS ONE 2016, 11, 1–14. [Google Scholar] [CrossRef]
Sample Availability: Samples of the compounds are not available from the authors. |
Antibody | Reference | Supplier | Dilution | Source |
---|---|---|---|---|
FASN | ADI-905-069-100 | EnzoLife Sciences | 1:1500 | rabbit |
PARP | 9542 | Cell Signaling Technology | 1:1000 | rabbit |
β-actin | Sc-47778 | Santa Cruz Inc. | 1:1000 | mouse |
FASN | Forward | CAGGCACACACGATGGAC |
Reverse | CGGAGTGAATCTGGGTTGAT | |
Snail | Forward | GCTGCAGGACTCTAATCCAGA |
Reverse | ATCTCCGGAGGTGGGATG | |
Vimentin | Forward | TGGTCTAACGGTTTCCCCTA |
Reverse | GACCTCGGAGCGAGAGTG | |
β-actin | Forward | ATTGGCAATGAGCGGTTC |
Reverse | CGTGGATGCCACAGGACT |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Giró-Perafita, A.; Rabionet, M.; Planas, M.; Feliu, L.; Ciurana, J.; Ruiz-Martínez, S.; Puig, T. EGCG-Derivative G28 Shows High Efficacy Inhibiting the Mammosphere-Forming Capacity of Sensitive and Resistant TNBC Models. Molecules 2019, 24, 1027. https://0-doi-org.brum.beds.ac.uk/10.3390/molecules24061027
Giró-Perafita A, Rabionet M, Planas M, Feliu L, Ciurana J, Ruiz-Martínez S, Puig T. EGCG-Derivative G28 Shows High Efficacy Inhibiting the Mammosphere-Forming Capacity of Sensitive and Resistant TNBC Models. Molecules. 2019; 24(6):1027. https://0-doi-org.brum.beds.ac.uk/10.3390/molecules24061027
Chicago/Turabian StyleGiró-Perafita, Ariadna, Marc Rabionet, Marta Planas, Lidia Feliu, Joaquim Ciurana, Santiago Ruiz-Martínez, and Teresa Puig. 2019. "EGCG-Derivative G28 Shows High Efficacy Inhibiting the Mammosphere-Forming Capacity of Sensitive and Resistant TNBC Models" Molecules 24, no. 6: 1027. https://0-doi-org.brum.beds.ac.uk/10.3390/molecules24061027