Next Article in Journal
PL-PatchSurfer: A Novel Molecular Local Surface-Based Method for Exploring Protein-Ligand Interactions
Next Article in Special Issue
Compositional and Proteomic Analyses of Genetically Modified Broccoli (Brassica oleracea var. italica) Harboring an Agrobacterial Gene
Previous Article in Journal
What Controls DNA Looping?
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Development and Application of Loop-Mediated Isothermal Amplification Assays for Rapid Visual Detection of cry2Ab and cry3A Genes in Genetically-Modified Crops

1
College of Plant Sciences, Jilin University, Changchun 130062, China
2
Agro-Biotechnology Research Institute, Jilin Academy of Agricultural Sciences, Changchun 130033, China
3
Plant and Soil Science Department, Texas Tech University, Lubbock, TX 79409, USA
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Int. J. Mol. Sci. 2014, 15(9), 15109-15121; https://0-doi-org.brum.beds.ac.uk/10.3390/ijms150915109
Submission received: 11 July 2014 / Revised: 15 August 2014 / Accepted: 18 August 2014 / Published: 27 August 2014
(This article belongs to the Special Issue Detection and Safety Assessment of Genetically Modified Organisms)

Abstract

:
The cry2Ab and cry3A genes are two of the most important insect-resistant exogenous genes and had been widely used in genetically-modified crops. To develop more effective alternatives for the quick identification of genetically-modified organisms (GMOs) containing these genes, a rapid and visual loop-mediated isothermal amplification (LAMP) method to detect the cry2Ab and cry3A genes is described in this study. The LAMP assay can be finished within 60 min at an isothermal condition of 63 °C. The derived LAMP products can be obtained by a real-time turbidimeter via monitoring the white turbidity or directly observed by the naked eye through adding SYBR Green I dye. The specificity of the LAMP assay was determined by analyzing thirteen insect-resistant genetically-modified (GM) crop events with different Bt genes. Furthermore, the sensitivity of the LAMP assay was evaluated by diluting the template genomic DNA. Results showed that the limit of detection of the established LAMP assays was approximately five copies of haploid genomic DNA, about five-fold greater than that of conventional PCR assays. All of the results indicated that this established rapid and visual LAMP assay was quick, accurate and cost effective, with high specificity and sensitivity. In addition, this method does not need specific expensive instruments or facilities, which can provide a simpler and quicker approach to detecting the cry2Ab and cry3A genes in GM crops, especially for on-site, large-scale test purposes in the field.

1. Introduction

From the records collected from approximately 30 countries from 1996 to 2013, the global cultivated area of genetically-modified (GM) crops increased 100-fold, from 1.7 million hectares in 1996 to 175.2 million hectares in 2013, indicating that the adoption rates of GM crops were unprecedented in modern agro-technology development history [1]. Insect-resistance, deployed in GM maize, soybean, cotton, rice and poplar, has consistently been one of the most important traits in GM crops. Numerous Bt (Bacillus thuringiensis) genes, such as cry1Ab, cry2Ab and cry3A, encoded insecticidal crystal proteins and were the most prevalent insect-resistant genes in GM crops [2]. Right now, cry2Ab and cry3A genes are commercially used in insect-resistant GM crops. For example, the transgenic maize, MON89034, MIR604, and transgenic cotton, MON15985, developed by Monsanto, are grown widely in the world. However, since the public concern with GM food safety and environment risk, a series of legislation has been issued for genetically-modified organism (GMO) regulation and labeling in more than 50 countries and areas [3]. For example, China has implemented a mandatory labeling regulation on 17 GM products of five kinds of GM crops since 2002. Therefore, it is highly important and necessary to develop some more accurate, quicker and higher efficiency methods for GMO detection.
Currently, a variety of molecular testing methods based on exogenous nucleic acid or newly expressed protein has been established and used for GMO detection [3]. The former includes polymerase chain reaction (PCR), real-time PCR, DNA fingerprinting and microarray [4,5,6,7], and the latter includes enzyme-linked immunosorbent assay (ELISA), lateral flow strip, liquid chromatography and western blot analysis [2,8,9,10]. Among all of the methods above, conventional and quantitative real-time PCR methods based on nucleic acid sequences are the most widely used methodologies for identifying or quantifying GM crops and their derivate products, because of the high specificity, sensitivity and reproducibility [11,12]. However, the PCR assay requires high-precision instruments and trained personnel for its implementation, which may partially limit its application for in situ testing [13].
Loop-mediated isothermal amplification (LAMP) is an outstanding nucleic acids amplification procedure developed by Notomi et al. in 2000 [14]. The LAMP assay employs four specially-designed primers (two inner primers and two outer primers), which can recognize six independent regions on the target DNA, showing extremely high specificity. The LAMP reaction can be carried out at a constant temperature between 60 and 65 °C by one type of enzyme with strand displacement activity within 60 min [15]. Thus, a simple isothermal instrument, such as a water bath, is adequate for LAMP amplification. Furthermore, the LAMP result can be easily monitored by using a turbidimeter or determined visually with the naked eye by adding a fluorescent dye, such as SYBR Green I, into the reaction mixture [16,17]. Compared to conventional PCR, the LAMP technique is easy and quick with higher specificity, sensitivity and effectivity. Thus, this new method has been widely used in clinical diagnosis [18,19,20,21], food safety inspection [22,23] and species identification [24,25]. Due to its competitive advantage, the LAMP method was used increasingly for GMO detection [26,27,28,29,30,31,32,33,34]. However, this method has never been used for cry2Ab and cry3A detection. The goal of this study is to employ the LAMP method on cry2Ab and cry3A gene detection in GM crops, which is simpler and quicker, especially for on-site, large-scale testing purposes in the field.

2. Results and Discussion

2.1. Extraction of Genomic DNA from Samples

Genomic DNA was successfully extracted from all samples by using the Plant Genome DNA Extraction Kit (Tiangen Biotech Co., Ltd., Beijing, China). The DNA purity and quantity were confirmed by using the ND1000 Spectrophotometer. To confirm if the extracted DNA were suitable for LAMP and PCR reaction, three endogenous reference genes, the zSSIIb gene for maize, the ACP gene for cotton and the SPS gene for rice, were selected as the internal controls and detected according to [35,36,37]. The observation of the prospective amplification fragments of the endogenous reference genes in all samples indicated that the extracted genomic DNA purity and quantity were adequate for LAMP and PCR analysis (Supplementary Figure S1).

2.2. Design of the Loop-Mediated Isothermal Amplification (LAMP) Primers for cry2Ab and cry3A Genes

The LAMP method relies on auto-cycling strand displacement DNA synthesis, which is carried out by a DNA polymerase with high strand displacement activity, such as Bst DNA polymerase, and a set of four specially-designed primers that recognize a total of six distinct regions on each of the target DNA sequences [14]. Nagamine et al. [38] demonstrated that the LAMP reaction could be accelerated by using loop primers. In this study, one or two additional loop primers were also used. The full lengths of cry2Ab and cry3A genes re 1902 bp (GenBank Accession No. AR260579) and 1803 bp (GenBank Accession No. AX712169), respectively. In this study, the LAMP primers of the cry2Ab gene, including two outer primers (2A-F3 and 2A-B3), two inner primers (2A-FIP and 2A-BIP) and two loop primers (2A-LF and 2A-LB), were designed according to the 196-bp-specific sequence of the cry2Ab gene from GM maize MON89034. The cry3A gene LAMP primers, including two outer primers (3A-F3 and 3A-B3), two inner primers (3A-FIP and 3A-BIP) and one loop primer (3A-LF), were targeted to a 176-bp-specific sequence of the cry3A gene from GM maize MIR604. Forward inner primers (FIP) contained the F1c (complementary to F1) and the F2 sequences. Backward inner primers (BIP) contained the B1c (complementary to B1) and the B2 sequences. The primers used in this study are listed in Table 1, and the schematic diagram of the LAMP primer design and detailed locations of LAMP primers in the target DNA sequences are shown in Figure 1.
Table 1. Oligonucleotide primers used in this study.
Table 1. Oligonucleotide primers used in this study.
Primers NameSequence (5'–3')TargetAmplicon Size (bp)Reference
2A-F3ACTGTTCCTCAACCGCTTGcry2Ab gene196This work
2A-B3GGAGTAGTCCCTGGTGTAGT
2A-FIPAGGAGAGGTGCAGGTTGGCACTCAGTTCCAGATGCAAGGC
2A-BIPGACGTGATCCTCAACGCTGACGTCTTCAGGTAGTCGCGGTAG
2A-LFCTGAGCAAAGAGTGGCAGCA
2A-LBGGGCATCTCTGCAGCCA
3A-F3AAGCCCCACCTGTTCGAcry3A gene176This work
3A-B3GGCTCGCTGCTCTTGTTG
3A-FIPAGTTGAAGCTGTCGTTGCCGTACCTGCACCGCATCCAGTTC
3A-BIPGGAGCGGCAACTACGTGAGCAGAAGGGGCTGGTGATGA
3A-LFGGGCTGGAAACGCGTGT
Figure 1. Primer design for loop-mediated isothermal amplification (LAMP) assays. (a) The schematic diagram showing the location of each primer; and (b) Partial coding sequences of the cry2Ab and cry3A genes used to design the primers. LAMP primers are indicated by arrows.
Figure 1. Primer design for loop-mediated isothermal amplification (LAMP) assays. (a) The schematic diagram showing the location of each primer; and (b) Partial coding sequences of the cry2Ab and cry3A genes used to design the primers. LAMP primers are indicated by arrows.
Ijms 15 15109 g001

2.3. Specificity of the LAMP Assays

To evaluate the specificity of this developed LAMP assay for the cry2Ab and cry3A genes, thirteen GM events and one non-GM mixture sample (including non-GM maize, cotton and rice) were collected and used. The selected GM events in this study contained ten of the most important insect-resistant genes (cry1Ab, cry1Ac, cry1F, cry1Ab/Ac, cry1A.105, cry2Ab, cry3A, cry3Bb, cry34Ab1 and cry35Ab1), which have had a commercialized application for a long time and which represented the foremost insect-resistant transgenic crops all over the world. The prospective LAMP and conventional PCR results of these GM crops are shown in Table 2. One hundred nanograms of corresponding template DNA were used in each LAMP and conventional PCR reaction mixture.
Table 2. The prospective results of LAMP and conventional PCR detecting the cry2Ab and cry3A genes in GM crops with different Bt genes α.
Table 2. The prospective results of LAMP and conventional PCR detecting the cry2Ab and cry3A genes in GM crops with different Bt genes α.
SpeciesGM CropsContained Bt Genescry2Abcry3A
LAMPPCRLAMPPCR
MaizeBt11cry1Ab
Bt176cry1Ab
MON810cry1Ab
TC1507cry1F
MON89034cry1A.105, cry2Ab++
MON863cry3Bb
MON88017cry3Bb
MIR604cry3A++
59122cry34Ab1, cry35Ab1
CottonMON531cry1Ac
MON15985cry1Ac, cry2Ab++
RiceTT51-1cry1Ab/Ac
KF-6cry1Ab
α+” indicates a positive result; “−” shows a negative result.
A Loopamp Realtime turbidimeter (LA-320C) was employed to detect the LAMP products in the cry2Ab and cry3A gene LAMP assays. The typical time threshold curve indicating turbidity values was obtained in the reaction mixtures using MON89034 maize and MON15985 cotton genomic DNA samples as templates, indicating that these reactions were LAMP-positive reactions, while no typical time threshold curve was observed in other GM and non-GM crops, indicating that these reactions were LAMP-negative reactions (Figure 2a). In addition, when adding SYBR Green I dye into the LAMP reaction mixture, a positive color of green was observed only in the LAMP reaction containing MON89034 maize or MON15985 cotton genomic DNA (Figure 2b). In fact, only MON89034 maize and MON15985 cotton contained the cry2Ab gene in all of these samples. Thus, this established LAMP assay had excellent specificity for the cry2Ab gene.
Conventional PCR was normally used in the qualitative detection of GM crops, due to the low cost, high specificity and simple procedures in previous studies [3]. As a comparison, all of the above samples were tested by conventional PCR using the outer primers (F3 and B3). A consistent result was obtained between the conventional PCR method and the LAMP assay (Figure 2c). In addition, in order to ensure the accuracy of PCR amplification products, the cry2Ab gene amplicon from MON89034 maize was purified and sequenced (Sangon Biotech Co., Ltd., Shanghai, China). The sequencing results revealed that this 196-bp amplicon was 100% consistent with the expected sequence (the data are not shown).
Similarly, in the LAMP and conventional PCR assays for detecting the cry3A gene, positive results were obtained only in the reaction mixture using MIR604 maize genomic DNA as a template (Figure 3). Actually, MIR604 maize was the only GM crop containing the cry3A gene among all of the samples above. These data demonstrated that this developed LAMP assay had a high specificity for reliably detecting the target transgenes.
Figure 2. Specificity of the LAMP assay and conventional PCR for detecting the cry2Ab gene. (a) The time threshold curves of the LAMP assay observed by using the LA-320C turbidimeter. (Right) CH1, GM maize MON89034; CH2, GM maize MON810; CH3, GM maize Bt11; CH4, GM maize Bt176; CH5, GM cotton MON531; CH6, GM cotton MON15985; CH7, GM rice KF-6; CH8, GM rice TT51-1; (Left) CH1, GM maize MON863; CH2, GM maize MON88017; CH3, GM maize MIR604; CH4, GM maize TC1507; CH5, GM maize 59122; CH6, non-GM crop mixture; (b) The LAMP assay results using SYBR Green I dye; and (c) The conventional PCR results. Lane M, DL2000 DNA marker (TaKaRa Biotechnology Co., Ltd., Dalian, China); Lanes 1–14, MON89034, MON810, Bt11, Bt176, MON531, MON15985, KF-6, TT51-1, MON863, MON88017, MIR604, TC1507, 59122, non-GM crop mixture.
Figure 2. Specificity of the LAMP assay and conventional PCR for detecting the cry2Ab gene. (a) The time threshold curves of the LAMP assay observed by using the LA-320C turbidimeter. (Right) CH1, GM maize MON89034; CH2, GM maize MON810; CH3, GM maize Bt11; CH4, GM maize Bt176; CH5, GM cotton MON531; CH6, GM cotton MON15985; CH7, GM rice KF-6; CH8, GM rice TT51-1; (Left) CH1, GM maize MON863; CH2, GM maize MON88017; CH3, GM maize MIR604; CH4, GM maize TC1507; CH5, GM maize 59122; CH6, non-GM crop mixture; (b) The LAMP assay results using SYBR Green I dye; and (c) The conventional PCR results. Lane M, DL2000 DNA marker (TaKaRa Biotechnology Co., Ltd., Dalian, China); Lanes 1–14, MON89034, MON810, Bt11, Bt176, MON531, MON15985, KF-6, TT51-1, MON863, MON88017, MIR604, TC1507, 59122, non-GM crop mixture.
Ijms 15 15109 g002
Figure 3. Specificity of the LAMP assay and conventional PCR of the cry3A gene. (a) The time threshold curves of the LAMP assay observed by using the LA-320C turbidimeter. (Right) CH1, GM maize MON89034; CH2, GM maize MON810; CH3, GM maize Bt11; CH4, GM maize Bt176; CH5, GM cotton MON531; CH6, GM cotton MON15985; CH7, GM rice KF-6; CH8, GM rice TT51-1; (Left) CH1, GM maize MON863; CH2, GM maize MON88017; CH3, GM maize MIR604; CH4, GM maize TC1507; CH5, GM maize 59122; CH6, non-GM crop mixture; CH7, no-template control (NTC); (b) The LAMP assay results using SYBR Green I dye; and (c) The conventional PCR results. Lane M, DL2000 DNA marker; Lanes 1–15, MON89034, MON810, Bt11, Bt176, MON531, MON15985, KF-6, TT51-1, MON863, MON88017, MIR604, TC1507, 59122, non-GM crop mixture, NTC.
Figure 3. Specificity of the LAMP assay and conventional PCR of the cry3A gene. (a) The time threshold curves of the LAMP assay observed by using the LA-320C turbidimeter. (Right) CH1, GM maize MON89034; CH2, GM maize MON810; CH3, GM maize Bt11; CH4, GM maize Bt176; CH5, GM cotton MON531; CH6, GM cotton MON15985; CH7, GM rice KF-6; CH8, GM rice TT51-1; (Left) CH1, GM maize MON863; CH2, GM maize MON88017; CH3, GM maize MIR604; CH4, GM maize TC1507; CH5, GM maize 59122; CH6, non-GM crop mixture; CH7, no-template control (NTC); (b) The LAMP assay results using SYBR Green I dye; and (c) The conventional PCR results. Lane M, DL2000 DNA marker; Lanes 1–15, MON89034, MON810, Bt11, Bt176, MON531, MON15985, KF-6, TT51-1, MON863, MON88017, MIR604, TC1507, 59122, non-GM crop mixture, NTC.
Ijms 15 15109 g003

2.4. Sensitivity of the LAMP Assays

The limit of detection (LOD) is the minimum concentration or amount of the analyte in a sample that can be detected reliably [32]. To test the LOD of the established LAMP assays, genomic DNA extracted from 100% GM maize MON89034 and MIR604 were serially diluted with 0.1× TE buffer to final concentrations of 104, 103, 102, 10, 5 and 1 copy/μL, according to the haploid genome size of maize [39]. Five microliter-diluted DNA samples were used as templates in each reaction. In the cry2Ab LAMP assay, the typical time threshold curve and color change from orange to green were observed in all of the dilutions (Figure 4a,b), indicating that the absolute LOD of cry2Ab LAMP assay was about as low as five copies of haploid maize genomic DNA. Meanwhile, the same LODs were obtained in the cry3A LAMP assay (Figure 4d,e).
As a comparison, conventional PCR was performed using the outer primers (F3 and B3) with the same diluted genomic DNA sample, and the LOD of conventional PCR for both the cry2Ab and cry3A genes was approximately 25 copies (Figure 4c,f). These results indicated that this established LAMP assay was more sensitive than the conventional PCR method, which was similar to the previous studies [26,27]. According to the original report of the LAMP assay, a few copies of DNA could be rapidly amplified to 109 in less than one hour [14]. The high sensitivity of LAMP could sometimes lead to false-positive amplification, due to cross-contamination, especially during agarose gel electrophoresis. Therefore, it would be more practical and feasible to perform the LAMP assay by closed-tube endpoint detection instead of gel electrophoresis.
Figure 4. Sensitivity of LAMP assays and conventional PCR for detecting the cry2Ab and cry3A genes. (a) The time threshold curves of cry2Ab LAMP assay observed by using the LA-320C turbidimeter. CH1-6, MON89034 genomic DNA samples with final concentrations of 104, 103, 102, 10, 5 and 1 copy/μL; CH7, NTC; (b) The cry2Ab LAMP assay results using SYBR Green I dye; (c) Conventional PCR results of the cry2Ab gene. Lane M, DL2000 DNA marker; Lanes 1–6, MON89034 genomic DNA samples with final concentrations of 104, 103, 102, 10, 5 and 1 copy/μL; Lane 7, NTC; (d) The time threshold curve of cry3A LAMP assays observed by using the LA-320C turbidimeter. CH1-6, MIR604 genomic DNA samples with final concentrations of 104, 103, 102, 10, 5 and 1 copy/μL; CH7, NTC; (e) The cry3A LAMP assay results using SYBR Green I dye; and (f) Conventional PCR results for the cry3A gene. Lane M, DL2000 DNA marker; Lanes 1–6, MIR604 genomic DNA samples with final concentrations of 104, 103, 102, 10, 5 and 1 copy/μL; Lane 7, NTC.
Figure 4. Sensitivity of LAMP assays and conventional PCR for detecting the cry2Ab and cry3A genes. (a) The time threshold curves of cry2Ab LAMP assay observed by using the LA-320C turbidimeter. CH1-6, MON89034 genomic DNA samples with final concentrations of 104, 103, 102, 10, 5 and 1 copy/μL; CH7, NTC; (b) The cry2Ab LAMP assay results using SYBR Green I dye; (c) Conventional PCR results of the cry2Ab gene. Lane M, DL2000 DNA marker; Lanes 1–6, MON89034 genomic DNA samples with final concentrations of 104, 103, 102, 10, 5 and 1 copy/μL; Lane 7, NTC; (d) The time threshold curve of cry3A LAMP assays observed by using the LA-320C turbidimeter. CH1-6, MIR604 genomic DNA samples with final concentrations of 104, 103, 102, 10, 5 and 1 copy/μL; CH7, NTC; (e) The cry3A LAMP assay results using SYBR Green I dye; and (f) Conventional PCR results for the cry3A gene. Lane M, DL2000 DNA marker; Lanes 1–6, MIR604 genomic DNA samples with final concentrations of 104, 103, 102, 10, 5 and 1 copy/μL; Lane 7, NTC.
Ijms 15 15109 g004

3. Experimental Section

3.1. Plant Material

Seed samples of thirteen insect-resistant GM crop events were used in this study. GM maize events MON89034, MON810, MON863 and MON88017 and GM cotton events MON531 and MON15985 were developed and kindly provided by Monsanto Company (St. Louis, MO, USA). GM maize events MIR604, Bt11 and Bt176 were developed and kindly provided by Syngenta Company (Basel, Switzerland). GM maize events TC1507 and 59122 were developed and kindly provided by Dow Agro Sciences LLC (Indianapolis, IN, USA) and Pioneer Hi-Bred International (Johnston, IA, USA). GM rice event TT51-1 was developed and kindly provided by Huazhong Agricultural University (Wuhan, China). GM rice event KF-6 was developed and kindly provided by the4 Institute of Genetics and Developmental Biology, Chinese Academy of Sciences (Beijing, China). Non-GM maize, soybean, cotton and rice were purchased from a local supermarket (Changchun, China).

3.2. DNA Isolation

Genomic DNA was isolated from seed powder using the Plant Genome DNA Extraction Kit (Tiangen Biotech Co., Ltd., Beijing, China) according to the manufacturer’s instructions and then quantified using the ND1000 Spectrophotometer (NanoDrop Technologies Inc., Wilmington, DE, USA). The genomic DNA was separated on 1% (w/v) agarose gel in 1× TAE stained with GenFinder dye (Biov Biotechnology Co., Xiamen, China). The final genomic DNA concentration was adjusted to 20 ng/μL by using 1× TE solution.

3.3. Primers Design

The cry2Ab gene-specific LAMP primers were designed based on the exogenous nucleotide sequence of GM maize line MON89034 [40], and the cry3A gene-specific LAMP primers were designed based on the exogenous nucleotide sequence of GM maize event MIR604 [41]. All of the LAMP primers were designed by using an online software Primer Explorer V4 [42] and synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). The scheme of the LAMP primers designed for target sequences are shown in Figure 1. All primers used in this work are described in Table 1.

3.4. LAMP Assay

The LAMP assay was carried out with the Loopamp® DNA Amplification kit (Eiken China Co., Ltd, Shanghai, China). The 25-μL volume reaction mixture contained 1× Reaction Mix (20 mM Tris–HCl (pH 8.8), 10 mM KCl, 10 mM (NH4)2SO4, 8 mM MgSO4, 0.1% Tween 20, 0.8 M betaine, 1.4 mM each dNTPs), 0.2 μM each outer primer (F3 and B3), 1.6 μM each inner primer (FIP and BIP), 0.8 μM each loop primer (LF and LB), 8 U Bst DNA polymerase (Eiken China Co., Ltd, Shanghai, China) and 5 μL template DNA. Each reaction was initially incubated at 63 °C for 60 min using a turbidimeter or a thermostatic water bath, followed by heating at 80 °C for 5 min to inactivate the polymerase and terminate the reaction. LAMP products were kept at 4 °C until analyzed. The LAMP assay was performed in triplicate for each sample, and ddH2O was used instead of the template DNA in the no template control (NTC).

3.5. Analysis of LAMP Products

The white turbidity caused by the existence of magnesium pyrophosphate, the LAMP amplification by-product of each reaction mixture, was simultaneously and continuously monitored by using a Loopamp Realtime turbidimeter, LA-320C (Eiken Chemical Co., Ltd., Tochigi, Japan). The LAMP-positive reaction mixture became turbid, while the negative reaction without amplified products still remained clear. In addition, 1 μL 1000× SYBR Green I dye (Invitrogen, Ltd., Carlsbad, CA, USA) was dropped at the center of the reaction tube cover before incubation and briefly centrifuged into LAMP products for visualization purposes by the naked eye. The samples that turned to a green color were regarded as positive, while those remaining orange were considered negative.

3.6. Conventional PCR Assay

Conventional PCR was also carried out to compare the specificity and sensitivity with the established LAMP methods. The outer primers (F3 and B3) of each LAMP assay were employed for the conventional PCR. The 25-μL volume reaction mixture contained 1× PCR buffer (10 mM Tris–HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2), 0.2 mM each dNTP, 0.2 μM each primer (F3 and B3), 1 U Taq DNA polymerase (TaKaRa Biotechnology Co., Ltd., Dalian, China) and 5 μL template DNA. Each reaction was initially denatured at 95 °C for 5 min; followed by 35 cycles of 94 °C for 30 s, 56 °C for 30 s and 72 °C for 30 s; and a final extension at 72 °C for 5 min using a C1000 Thermal cycler (Bio-Rad Laboratories, Hercules, CA, USA). PCR products were separated on 2% (w/v) agarose gel in 1× TAE stained with GenFinder dye (Biov Biotechnology Co., Xiamen, China) and photographed using a GelDoc XR+ Imager (Bio-Rad Laboratories, Hercules, CA, USA).

4. Conclusions

In this study, a visual and rapid LAMP assay was successfully developed for the detection of the cry2Ab and cry3A genes in GM crops. The results from turbidity monitoring and SYBR Green I staining indicated that the LAMP assays are highly specific for the target genes. Compared to the conventional PCR method, which requires at least 2–3 h of PCR reaction and product detection time, the LAMP method established in this study could be finished within one hour. In addition, the LAMP reaction results could be determined by the naked eye, whereas conventional PCR requires time-consuming electrophoretic analysis.
Furthermore, the limits of detection of established LAMP assays for identifying the cry2Ab and cry3A genes were as low as five copies, much less than the conventional PCR method (25 copies), indicating that the LAMP assay had a higher sensitivity than the conventional PCR approach.
In conclusion, this established LAMP assay is quick, accurate and cost effective, with high specificity and sensitivity. In addition, this method does not need specific expensive instruments or facilities, which can provide a simpler and quicker approach to detecting the cry2Ab and cry3A genes in GM crops, especially for on-site, large-scale testing purposes in the field.

Supplementary Files

Supplementary File 1

Acknowledgments

This research was supported by the National Transgenic Plant Special Fund (2014ZX08012-001) and the Jilin Agricultural Science and Technology Innovation Program (2013).

Author Contributions

F.L., as project leader, designed this study and wrote the manuscript. W.Y. performed the main laboratory work. L.L. provided data analysis. X.Q. provided discussion and revised the manuscript. C.L. performed some laboratory work. S.Z., as supervisor, provided direction. All authors contributed to discussions and read and approved the final manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Clive, J. Global Status of Commercialized Biotech/GM Crops: 2013; ISAAA Brief No. 46; International Service for the Acquisition Agri-biotech Applications (ISAAA): Ithaca, NY, USA, 2013. [Google Scholar]
  2. Kamle, S.; Ali, S. Genetically modified crops: Detection strategies and biosafety issues. Gene 2013, 522, 123–132. [Google Scholar] [CrossRef]
  3. Zhang, D.; Guo, J. The development and standardization of testing methods for genetically modified organisms and their derived products. J. Integr. Plant. Biol. 2011, 53, 539–551. [Google Scholar] [CrossRef]
  4. Debode, F.; Janssen, E.; Berben, G. Development of 10 new screening PCR assays for GMO detection targeting promoters (pFMV, pNOS, pSSuAra, pTA29, pUbi, pRice actin) and terminators (t35S, tE9, tOCs, tg7). Eur. Food Res. Technol. 2013, 236, 659–669. [Google Scholar] [CrossRef]
  5. Holst-Jensen, A.; Bertheau, Y.; de Loose, M.; Grohmann, L.; Hamels, S.; Hougs, L.; Morisset, D.; Pecoraro, S.; Pla, M.; van den Bulcke, M.; et al. Detecting un-authorized genetically modified organisms (GMOs) and derived materials. Biotechnol. Adv. 2012, 30, 1318–1335. [Google Scholar] [CrossRef]
  6. Broeders, S.R.; de Keersmaecker, S.C.; Roosens, N.H. How to deal with the upcoming challenges in GMO detection in food and feed. J. Biomed. Biotechnol. 2012, 2012, 402418. [Google Scholar]
  7. Shao, N.; Jiang, S.M.; Zhang, M.; Wang, J.; Guo, S.J.; Li, Y.; Jiang, H.W.; Liu, C.X.; Zhang, D.B.; Yang, L.T.; et al. MACRO: A combined microchip-PCR and microarray system for high-throughput monitoring of genetically modified organisms. Anal. Chem. 2014, 86, 1269–1276. [Google Scholar] [CrossRef]
  8. Wu, H.; Zhang, Y.; Zhu, C.; Xiao, X.; Zhou, X.; Xu, S.; Shen, W.; Huang, M. Presence of CP4-EPSPS component in roundup ready soybean-derived food products. Int. J. Mol. Sci. 2012, 13, 1919–1932. [Google Scholar] [CrossRef]
  9. Kamle, S.; Ojha, A.; Kumar, A. Development of an enzyme linked immunosorbant assay for the detection of Cry2Ab protein in transgenic plants. GM Crops 2011, 2, 118–125. [Google Scholar] [CrossRef]
  10. Zhang, Y.; Lai, C.; Su, R.; Zhang, M.; Xiong, Y.; Qing, H.; Deng, Y. Quantification of Cry1Ab in genetically modified maize leaves by liquid chromatography multiple reaction monitoring tandem mass spectrometry using 18O stable isotope dilution. Analyst 2012, 137, 2699–2705. [Google Scholar] [CrossRef]
  11. Xu, W.; Zhai, Z.; Huang, K.; Zhang, N.; Yuan, Y.; Shang, Y.; Luo, Y. A novel universal primer-multiplex-PCR method with sequencing gel electrophoresis analysis. PLoS One 2012, 7, e22900. [Google Scholar]
  12. Guo, J.; Chen, L.; Liu, X.; Gao, Y.; Zhang, D.; Yang, L. A multiplex degenerate PCR analytical approach targeting to eight genes for screening GMOs. Food Chem. 2012, 132, 1566–1573. [Google Scholar] [CrossRef]
  13. Holst-Jensen, A. Testing for genetically modified organisms (GMOs): Past, present and future perspectives. Biotechnol. Adv. 2009, 27, 1071–1082. [Google Scholar] [CrossRef]
  14. Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000, 28, e63. [Google Scholar] [CrossRef]
  15. Tomita, N.; Mori, Y.; Kanda, H.; Notomi, T. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nat. Protoc. 2008, 3, 877–882. [Google Scholar] [CrossRef]
  16. Xu, J.; Zheng, Q.; Yu, L.; Liu, R.; Zhao, X.; Wang, G.; Wang, Q.; Cao, J. Loop-mediated isothermal amplification (LAMP) method for detection of genetically modified maize T25. Food Sci. Nutr. 2013, 1, 432–438. [Google Scholar] [CrossRef]
  17. Guan, X.; Guo, J.; Shen, P.; Yang, L.; Zhang, D. Visual and rapid detection of two genetically modified soybean events using loop-mediated isothermal amplification method. Food Anal. Method 2010, 3, 313–320. [Google Scholar] [CrossRef]
  18. Adams, E.R.; Schoone, G.J.; Ageed, A.F.; Safi, S.E.; Schallig, H.D. Development of a reverse transcriptase loop-mediated isothermal amplification (LAMP) assay for the sensitive detection of Leishmania parasites in clinical samples. Am. J. Trop. Med. Hyg. 2010, 82, 591–596. [Google Scholar] [CrossRef]
  19. Wang, C.; Shen, X.; Lu, J.; Zhang, L. Development of a reverse transcription-loop-mediated isothermal amplification (RT-LAMP) system for rapid detection of HDV genotype 1. Lett. Appl. Microbiol. 2013, 56, 229–235. [Google Scholar] [CrossRef]
  20. Mori, Y.; Kanda, H.; Notomi, T. Loop-mediated isothermal amplification (LAMP): Recent progress in research and development. J. Infect. Chemother. 2013, 19, 404–411. [Google Scholar] [CrossRef]
  21. Parida, M.; Sannarangaiah, S.; Dash, P.K.; Rao, P.V.; Morita, K. Loop mediated isothermal amplification (LAMP): A new generation of innovative gene amplification technique; perspectives in clinical diagnosis of infectious diseases. Rev. Med. Virol. 2008, 18, 407–421. [Google Scholar] [CrossRef]
  22. Bahkali, A.; Moslem, M.; Amin, O.E.; Niessen, L. An optimized protocol for DNA extraction from wheat seeds and loop-mediated isothermal amplification (LAMP) to detect fusarium graminearum contamination of wheat grain. Int. J. Mol. Sci. 2011, 12, 3459–3472. [Google Scholar] [CrossRef]
  23. Ueda, S.; Kuwabara, Y. The rapid detection of Salmonella from food samples by loop-mediated isothermal amplification (LAMP). Biocontrol. Sci. 2009, 14, 73–76. [Google Scholar] [CrossRef]
  24. Vaagt, F.; Haase, I.; Fischer, M. Loop-mediated isothermal amplification (LAMP)-based method for rapid mushroom species identification. J. Agric. Food Chem. 2013, 61, 1833–1840. [Google Scholar] [CrossRef]
  25. Focke, F.; Haase, I.; Fischer, M. Loop-mediated isothermal amplification (LAMP): Methods for plant species identification in food. J. Agric. Food Chem. 2013, 61, 2943–2949. [Google Scholar] [CrossRef]
  26. Zhou, D.; Guo, J.; Xu, L.; Gao, S.; Lin, Q.; Wu, Q.; Wu, L.; Que, Y. Establishment and application of a loop-mediated isothermal amplification (LAMP) system for detection of cry1Ac transgenic sugarcane. Sci. Rep. 2014, 4, 4912. [Google Scholar]
  27. Huang, X.; Chen, L.; Xu, J.; Ji, H.F.; Zhu, S.; Chen, H. Rapid visual detection of phytase gene in genetically modified maize using loop-mediated isothermal amplification method. Food Chem. 2014, 156, 184–189. [Google Scholar] [CrossRef]
  28. Huang, S.; Xu, Y.; Yan, X.; Shang, Y.; Zhu, P.; Tian, W.; Xu, W. Development and application of a quantitative loop-mediated isothermal amplification method for detecting genetically modified Maize MON863. J. Sci. Food Agric. 2014. [Google Scholar] [CrossRef]
  29. Randhawa, G.J.; Singh, M.; Morisset, D.; Sood, P.; Zel, J. Loop-mediated isothermal amplification: Rapid visual and real-time methods for detection of genetically modified crops. J. Agric. Food Chem. 2013, 61, 11338–11346. [Google Scholar] [CrossRef]
  30. Li, Q.; Fang, J.; Liu, X.; Xi, X.; Li, M.; Gong, Y.; Zhang, M. Loop-mediated isothermal amplification (LAMP) method for rapid detection of cry1Ab gene in transgenic rice (Oryza sativa L.). Eur. Food Res. Technol. 2013, 236, 589–598. [Google Scholar] [CrossRef]
  31. Chen, X.; Wang, X.; Jin, N.; Zhou, Y.; Huang, S.; Miao, Q.; Zhu, Q.; Xu, J. Endpoint visual detection of three genetically modified rice events by loop-mediated isothermal amplification. Int. J. Mol. Sci. 2012, 13, 14421–14433. [Google Scholar] [CrossRef]
  32. Chen, L.; Guo, J.; Wang, Q.; Kai, G.; Yang, L. Development of the visual loop-mediated isothermal amplification assays for seven genetically modified maize events and their application in practical samples analysis. J. Agric. Food Chem. 2011, 59, 5914–5918. [Google Scholar] [CrossRef]
  33. Liu, M.; Luo, Y.; Tao, R.; He, R.; Jiang, K.; Wang, B.; Wang, L. Sensitive and rapid detection of genetic modified soybean (Roundup Ready) by loop-mediated isothermal amplification. Biosci. Biotechnol. Biochem. 2009, 73, 2365–2369. [Google Scholar] [CrossRef]
  34. Lee, D.; la Mura, M.; Allnutt, T.R.; Powell, W. Detection of genetically modified organisms (GMOs) using isothermal amplification of target DNA sequences. BMC Biotechnol. 2009, 9, 7. [Google Scholar] [CrossRef]
  35. Development Center of Science and Technology, M.o.A. Detection of Genetically Modified Plants and Derived Products—Target-Taxon-Specific Qualitative PCR Method for Maize; Announcement by the Ministry of Agriculture No. 1861-3-2012; China Agriculture Press: Beijing, China, 2012; pp. 1–9. [Google Scholar]
  36. Development Center of Science and Technology, M.o.A. Detection of Genetically Modified Plants and Derived Products—Target-Taxon-Specific Qualitative PCR Method for Cotton; Announcement by the Ministry of Agriculture No. 1943-1-2013; China Agriculture Press: Beijing, China, 2013; pp. 1–9. [Google Scholar]
  37. Development Center of Science and Technology, M.o.A. Detection of Genetically Modified Plants and Derived Products—Target-Taxon-Specific Qualitative PCR Method for Rice; Announcement by the Ministry of Agriculture No. 1861-1-2012; China Agriculture Press: Beijing, China, 2012; pp. 1–10. [Google Scholar]
  38. Nagamine, K.; Hase, T.; Notomi, T. Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol. Cell. Probes 2002, 16, 223–229. [Google Scholar] [CrossRef]
  39. Arumuganathan, K.; Earle, E.D. Nuclear DNA content of some important plant species. Plant. Mol. Biol. Rep. 1991, 9, 208–218. [Google Scholar] [CrossRef]
  40. GMO Detection method Database (GMDD). Available online: http://gmdd.shgmo.org/sequence/view/49 (accessed on 10 June 2013).
  41. GMO Detection method Database (GMDD). Available online: http://gmdd.shgmo.org/sequence/view/38 (accessed on 10 June 2013).
  42. Primer Explorer V4 Software. Operation Procedure for Designing Regular/Loop Primers. Available online: http://primerexplorer.jp/elamp4.0.0/index.html (accessed on 11 June 2013).

Share and Cite

MDPI and ACS Style

Li, F.; Yan, W.; Long, L.; Qi, X.; Li, C.; Zhang, S. Development and Application of Loop-Mediated Isothermal Amplification Assays for Rapid Visual Detection of cry2Ab and cry3A Genes in Genetically-Modified Crops. Int. J. Mol. Sci. 2014, 15, 15109-15121. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms150915109

AMA Style

Li F, Yan W, Long L, Qi X, Li C, Zhang S. Development and Application of Loop-Mediated Isothermal Amplification Assays for Rapid Visual Detection of cry2Ab and cry3A Genes in Genetically-Modified Crops. International Journal of Molecular Sciences. 2014; 15(9):15109-15121. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms150915109

Chicago/Turabian Style

Li, Feiwu, Wei Yan, Likun Long, Xing Qi, Congcong Li, and Shihong Zhang. 2014. "Development and Application of Loop-Mediated Isothermal Amplification Assays for Rapid Visual Detection of cry2Ab and cry3A Genes in Genetically-Modified Crops" International Journal of Molecular Sciences 15, no. 9: 15109-15121. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms150915109

Article Metrics

Back to TopTop