Plasma-Derived Fibronectin Stimulates Chondrogenic Differentiation of Human Subchondral Cortico-Spongious Progenitor Cells in Late-Stage Osteoarthritis
Abstract
:1. Introduction
2. Result
2.1. Morphology and Cell-Surface Antigens of SPCs in Late Stage OA Knee
2.2. Osteogenic or Adipogenic Differentiation Potential of SPCs
2.3. Chondrogenic Differentiation of SPCs
2.4. The Effect of Fn on SPCs’ Chondrogenic Differentiation
2.5. Chondrogenic Differentiation Gene Expression of SPCs Stimulated by Fn
2.6. Proliferation and Migration of SPCs Stimulated by Fn
3. Discussion
4. Experimental Section
4.1. Isolation and Cultivation of SPCs
4.2. Flow Cytometric Analysis
4.3. Osteogenic and Adipogenic Differentiation of SPCs
4.4. Chondrogenic Differentiation of SPCs
4.5. Histology and Immunohistochemistry
4.6. Quantitative RT-RCR
Gene | Forward Prime | Reverse Primer | Tm (°C) | Product Size (bp) |
---|---|---|---|---|
Collagen 1a1 | CGATGGCTGCACGAGTCACAC | CAGGTTGGGATGGAGGGAGTTTAC | 62 | 180 |
Collagen 2a1 | CCGGGCAGAGGGCAATAGCAGGTT | CAATGATGGGGAGGCGTGAG | 58 | 128 |
Aggrecan | CCCAAGAATCAAGTGGAGCCG | ACACGATGCCTTTCACCACGA | 64 | 254 |
SOX-9 | AGCGAACGCACATCAAGAC | CTGTAGGCGATCTGTTGGGG | 58 | 85 |
GAPDH | ATTTGGTCGTATTGGGCG | TGGAAGATGGTGATGGGATT | 57 | 204 |
4.7. Proliferation and Migration Assay
4.8. Statistical Analysis
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Moyer, R.F.; Hunter, D.J. Osteoarthritis in 2014: Changing how we define and treat patients with OA. Nat. Rev. Rheumatol. 2014, 11, 65–66. [Google Scholar] [CrossRef] [PubMed]
- Luyten, F.P.; Vanlauwe, J. Tissue engineering approaches for osteoarthritis. Bone 2012, 51, 289–296. [Google Scholar] [CrossRef] [PubMed]
- Buda, R.; Vannini, F.; Cavallo, M.; Brunella, G.; Annarita, C.; Sandro, G. Osteochondral lesions of the knee: A new one-step repair technique with bone-marrow-derived cells. J. Bone Jt. Surg. 2010, 92, 2–11. [Google Scholar] [CrossRef] [PubMed]
- Gobbi, A.; Karnatzikos, G.; Scotti, C.; Vivek, M.; Laura, M.; Brunella, G. One-step cartilage repair with bone marrow aspirate concentrated cells and collagen matrix in full-thickness knee cartilage lesions results at 2-year follow-up. Cartilage 2011, 2, 286–299. [Google Scholar] [CrossRef] [PubMed]
- Wakitani, S.; Okabe, T.; Horibe, S.; Tomoki, M.; Masanobu, S.; Tsuyoshi, K.; Masashi, N.; Keiji, T.; Hiroyuki, K.; Kota, U.; et al. Safety of autologous bone marrow-derived mesenchymal stem cell transplantation for cartilage repair in 41 patients with 45 joints followed for up to 11 years and 5 months. J. Tissue Eng. Regen. Med. 2011, 5, 146–150. [Google Scholar] [CrossRef] [PubMed]
- Kulawig, R.; Krüger, J.P.; Klein, O.; Konthur, Z.; Schütte, H.; Klose, J.; Kaps, C.; Endres, M. Identification of fibronectin as a major factor in human serum to recruit subchondral mesenchymal progenitor cells. Int. J. Biochem. Cell. Biol. 2013, 45, 1410–1418. [Google Scholar] [CrossRef] [PubMed]
- Endres, M.; Andreas, K.; Kalwitz, G.; Freymann, U.; Neumann, K.; Ringe, J.; Sittinger, M.; Häupl, T.; Kaps, C. Chemokine profile of synovial fluid from normal, osteoarthritis and rheumatoid arthritis patients: CCL25, CXCL10 and XCL1 recruit human subchondral mesenchymal progenitor cells. Osteoarthr. Cartil. 2010, 18, 1458–1466. [Google Scholar] [CrossRef] [PubMed]
- Zhen, G.; Wen, C.; Jia, X.; Li, Y.; Crane, J.L.; Mears, S.C.; Askin, F.B.; Frassica, F.J.; Chang, W.; Yao, J. Inhibition of TGF-β signaling in mesenchymal stem cells of subchondral bone attenuates osteoarthritis. Nat. Med. 2013, 19, 704–712. [Google Scholar]
- Gomoll, A.H.; Farr, J.; Gillogly, S.D.; Kercher, J.; Minas, T. Surgical management of articular cartilage defects of the knee. J. Bone Jt. Surg. 2010, 92, 2470–2490. [Google Scholar]
- Williams, R.J., 3rd; Harnly, H.W. Microfracture: Indications, technique, and results. Instr. Course Lect. 2006, 56, 419–428. [Google Scholar]
- Bae, D.K.; Yoon, K.H.; Song, S.J. Cartilage healing after microfracture in osteoarthritic knees. Arthroscopy 2006, 22, 367–374. [Google Scholar] [CrossRef] [PubMed]
- Caplan, A.I. Bone development and repair. Bioessays 1987, 6, 171–175. [Google Scholar] [CrossRef] [PubMed]
- Scharstuhl, A.; Schewe, B.; Benz, K.; Gaissmaier, C.; Bühring, H.J.; Stoop, R. Chondrogenic potential of human adult mesenchymal stem cells is independent of age or osteoarthritis etiology. Stem Cells 2007, 25, 3244–3251. [Google Scholar] [CrossRef] [PubMed]
- Singh, P.; Schwarzbauer, J.E. Fibronectin and stem cell differentiation-lessons from chondrogenesis. J. Cell. Sci. 2012, 125, 3703–3712. [Google Scholar] [CrossRef] [PubMed]
- Brittberg, M.; Lindahl, A.; Nilsson, A.; Ohlsson, C.; Isaksson, O.; Peterson, L. Treatment of deep cartilage defects in the knee with autologous chondrocyte transplantation. N. Engl. J. Med. 1994, 331, 889–895. [Google Scholar] [CrossRef] [PubMed]
- Schmitt, B.; Ringe, J.; Häupl, T.; Notter, M.; Manz, R.; Burmester, G.R.; Sittinger, M.; Kaps, C. BMP2 initiates chondrogenic lineage development of adult human mesenchymal stem cells in high-density culture. Differentiation 2003, 71, 567–577. [Google Scholar] [CrossRef] [PubMed]
- Kretzschmar, M.; Liu, F.; Hata, A.; Doody, J.; Massague, J. The TGF-β family mediator Smad1 is phosphorylated directly and activated functionally by the BMP receptor kinase. Genes Dev. 1997, 11, 984–995. [Google Scholar] [CrossRef] [PubMed]
- Luyten, F.P.; Yu, Y.M.; Yanagishita, M.; Vukicevic, S.; Hammonds, R.G.; Reddi, A.H. Natural bovine osteogenin and recombinant human bone morphogenetic protein-2B are equipotent in the maintenance of proteoglycans in bovine articular cartilage explant cultures. J. Biol. Chem. 1992, 267, 3691–3695. [Google Scholar] [PubMed]
- Hynes, R.O. Fibronectins; Springer-Verlag: New York, NY, USA, 1990; p. 546. [Google Scholar]
- Kalkreuth, R.H.; Krüger, J.P.; Lau, S.; Niemeyer, P.; Endres, M.; Kreuz, P.C.; Kaps, C. Fibronectin stimulates migration and proliferation, but not chondrogenic differentiation of human subchondral progenitor cells. Regen. Med. 2014, 9, 759–773. [Google Scholar] [CrossRef] [PubMed]
- Swalla, B.J.; Solursh, M. Inhibition of limb chondrogenesis by fibronectin. Differentiation 1984, 26, 42–48. [Google Scholar] [CrossRef] [PubMed]
- Murphy, J.M.; Dixon, K.; Beck, S.; Fabian, D.; Feldman, A.; Barry, F. Reduced chondrogenic and adipogenic activity of mesenchymal stem cells from patients with advanced osteoarthritis. Arthritis Rheum. 2002, 46, 704–713. [Google Scholar] [CrossRef] [PubMed]
- Augello, A.; de Bari, C. The regulation of differentiation in mesenchymal stem cells. Hum. Gene Ther. 2010, 21, 1226–1238. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Beier, F.; Loeser, R.F. Biology and pathology of Rho GTPase, PI-3 kinase-Akt, and MAP kinase signaling pathways in chondrocytes. J. Cell. Biochem. 2010, 110, 573–580. [Google Scholar] [CrossRef] [PubMed]
- Neumann, K.; Dehne, T.; Endres, M.; Erggelet, C.; Kaps, C.; Ringe, J.; Sittinger, M. Chondrogenic differentiation capacity of human mesenchymal progenitor cells derived from subchondral cortico-spongious bone. J. Orthop. Res. 2008, 26, 1449–1456. [Google Scholar] [CrossRef] [PubMed]
- Solchaga, L.A.; Penick, K.J.; Welter, J.F. Mesenchymal Stem Cell Assays and Applications; Humana Press: New York, NY, USA, 2011; pp. 253–278. [Google Scholar]
© 2015 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jiang, C.; Ma, P.; Ma, B.; Wu, Z.; Qiu, G.; Su, X.; Xia, Z.; Ye, Z.; Wang, Y. Plasma-Derived Fibronectin Stimulates Chondrogenic Differentiation of Human Subchondral Cortico-Spongious Progenitor Cells in Late-Stage Osteoarthritis. Int. J. Mol. Sci. 2015, 16, 19477-19489. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms160819477
Jiang C, Ma P, Ma B, Wu Z, Qiu G, Su X, Xia Z, Ye Z, Wang Y. Plasma-Derived Fibronectin Stimulates Chondrogenic Differentiation of Human Subchondral Cortico-Spongious Progenitor Cells in Late-Stage Osteoarthritis. International Journal of Molecular Sciences. 2015; 16(8):19477-19489. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms160819477
Chicago/Turabian StyleJiang, Chao, Pei Ma, Bupeng Ma, Zhihong Wu, Guixing Qiu, Xinlin Su, Zenan Xia, Zixing Ye, and Yipeng Wang. 2015. "Plasma-Derived Fibronectin Stimulates Chondrogenic Differentiation of Human Subchondral Cortico-Spongious Progenitor Cells in Late-Stage Osteoarthritis" International Journal of Molecular Sciences 16, no. 8: 19477-19489. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms160819477