Hypoxia-Induced Epithelial-To-Mesenchymal Transition Mediates Fibroblast Abnormalities via ERK Activation in Cutaneous Wound Healing
Abstract
:1. Introduction
2. Results
2.1. p-ERK and HIF-1α Levels Are Elevated in Keloid Tissue and Fibroblasts
2.2. Hypoxia Activates TGF-β Signaling and Induces EMT in HDFs
2.3. The ERK/MAPK Pathway Is Involved in Hypoxia-Induced EMT
2.4. Phenotypic EMT Markers Are Expressed in HDFs under Hypoxia
2.5. Hypoxia Induces a Phenotypic Switch of Fibroblasts to Myofibroblasts
2.6. ERK Inhibition Reduces Hypoxia-Induced ECM Deposition
3. Discussion
4. Materials and Methods
4.1. Cell Culture and Keloid-Derived Fibroblasts
4.2. Real-Time PCR Analysis
4.3. Western Blotting Analysis
4.4. Cell Viability Analysis
4.5. Immunohistochemistry
4.6. Antibodies and Reagents
4.7. Confocal Imaging
4.8. Statistical Analysis
Author Contributions
Funding
Conflicts of Interest
Abbreviations
AFAP | Actin filament associated protein 1 |
CTGF | Connective tissue growth factor |
ECM | Extracellular matrix |
EMT | Epithelial-mesenchymal transition |
ERK | Extracellular signal-regulated kinase |
HDF | Human dermal fibroblast |
HIF-1α | Hypoxia-inducible factor-1α |
KF | Keloid fibroblast |
MAPK | Mitogen-activated protein kinase |
MMP | Matrix metalloproteinase |
PBS | Phosphate-buffered saline |
PI3K | Phosphatidylinositol-4,5-bisphosphate 3-kinase |
TGF-β | Transforming growth factor-β |
TIMP | Tissue inhibitor of metalloproteinases |
References
- Gauglitz, G.G.; Korting, H.C.; Pavicic, T.; Ruzicka, T.; Jeschke, M.G. Hypertrophic Scarring and Keloids: Pathomechanisms and Current and Emerging Treatment Strategies. Mol. Med. 2011, 17, 113–125. [Google Scholar] [CrossRef] [PubMed]
- Huang, C.; Akaishi, S.; Hyakusoku, H.; Ogawa, R. Are keloid and hypertrophic scar different forms of the same disorder? A fibroproliferative skin disorder hypothesis based on keloid findings. Int. Wound J. 2014, 11, 517–522. [Google Scholar] [CrossRef]
- Huang, C.; Akaishi, S.; Ogawa, R. Mechanosignaling pathways in cutaneous scarring. Arch. Dermatol. Res. 2012, 304, 589–597. [Google Scholar] [CrossRef] [PubMed]
- Song, N.; Wu, X.; Gao, Z.; Zhou, G.; Zhang, W.J.; Liu, W. Enhanced expression of membrane transporter and drug resistance in keloid fibroblasts. Hum. Pathol. 2012, 43, 2024–2032. [Google Scholar] [CrossRef]
- Qu, M.; Song, N.; Chai, G.; Wu, X.; Liu, W. Pathological niche environment transforms dermal stem cells to keloid stem cells: A hypothesis of keloid formation and development. Med. Hypotheses 2013, 81, 807–812. [Google Scholar] [CrossRef]
- Lee, W.J.; Park, J.H.; Shin, J.U.; Noh, H.; Lew, D.H.; Yang, W.I.; Yun, C.O.; Lee, K.H.; Lee, J.H. Endothelial-to-mesenchymal transition induced by Wnt 3a in keloid pathogenesis. Wound Repair Regen. 2015, 23, 435–442. [Google Scholar] [CrossRef] [PubMed]
- Vincent, A.S.; Phan, T.T.; Mukhopadhyay, A.; Lim, H.Y.; Halliwell, B.; Wong, K.P. Human skin keloid fibroblasts display bioenergetics of cancer cells. J. Investig. Dermatol. 2008, 128, 702–709. [Google Scholar] [CrossRef]
- Lee, H.J.; Jang, Y.J. Recent Understandings of Biology, Prophylaxis and Treatment Strategies for Hypertrophic Scars and Keloids. Int. J. Mol. Sci. 2018, 19, 711. [Google Scholar] [CrossRef]
- Yan, L.; Cao, R.; Wang, L.Z.; Liu, Y.B.; Pan, B.; Yin, Y.H.; Lv, X.Y.; Zhuang, Q.; Sun, X.J.; Xiao, R. Epithelial-mesenchymal transition in keloid tissues and TGF-beta 1-induced hair follicle outer root sheath keratinocytes. Wound Repair Regen. 2015, 23, 601–610. [Google Scholar] [CrossRef]
- Jumper, N.; Hodgkinson, T.; Paus, R.; Bayat, A. Site-specific gene expression profiling as a novel strategy for unravelling keloid disease pathobiology. PLoS ONE 2017, 12, e0172955. [Google Scholar] [CrossRef]
- Higgins, D.F.; Kimura, K.; Iwano, M.; Haase, V.H. Hypoxia-inducible factor signaling in the development of tissue fibrosis. Cell Cycle 2008, 7, 1128–1132. [Google Scholar] [CrossRef]
- Sun, S.R.; Ning, X.X.; Zhai, Y.; Du, R.; Lu, Y.Y.; He, L.J.; Li, R.; Wu, W.N.; Sun, W.J.; Wang, H.M. Egr-1 Mediates Chronic Hypoxia-Induced Renal Interstitial Fibrosis via the PKC/ERK Pathway. Am. J. Nephrol. 2014, 39, 436–448. [Google Scholar] [CrossRef]
- Zhang, Q.Z.; Wu, Y.D.; Chau, C.H.; Ann, D.K.; Bertolami, C.N.; Le, A.D. Crosstalk of hypoxia-mediated signaling pathways in upregulating plasminogen activator inhibitor-1 expression in keloid fibroblasts. J. Cell Physiol. 2004, 199, 89–97. [Google Scholar] [CrossRef] [PubMed]
- Ma, X.Y.; Chen, J.; Xu, B.; Long, X.; Qin, H.; Zhao, R.C.; Wang, X.J. Keloid-derived keratinocytes acquire a fibroblast-like appearance and an enhanced invasive capacity in a hypoxic microenvironment in vitro. Int. J. Mol. Med. 2015, 35, 1246–1256. [Google Scholar] [CrossRef]
- Chang, L.F.; Karin, M. Mammalian MAP kinase signalling cascades. Nature 2001, 410, 37–40. [Google Scholar] [CrossRef] [PubMed]
- Leivonen, S.K.; Hakkinen, L.; Liu, D.; Kahari, V.M. Smad3 and ERK1/2 coordinately mediate transforming growth factor-beta-induced expression of connective tissue growth factor in human fibroblasts. J. Investig. Dermatol. 2005, 125, A66. [Google Scholar]
- Hu, Y.B.; Peng, J.W.; Feng, D.Y.; Chu, L.; Li, X.A.; Jin, Z.Y.; Lin, Z.; Zeng, Q.F. Role of extracellular signal-regulated kinase, p38 kinase, and activator protein-1 in transforming growth factor-beta 1-induced alpha smooth muscle actin expression in human fetal lung fibroblasts in vitro. Lung 2006, 184, 33–42. [Google Scholar] [CrossRef]
- Das, M.; Bouchey, D.M.; Moore, M.J.; Hopkins, D.C.; Nemenoff, R.A.; Stenmark, K.R. Hypoxia-induced proliferative response of vascular adventitial fibroblasts is dependent on G protein-mediated activation of mitogen-activated protein kinases. J. Biol. Chem. 2001, 276, 15631–15640. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.L.; Zhang, H.B.; Sun, L.; Gao, Y.Q.; Jin, H.F.; Liang, S.H.; Wang, Y.X.; Dong, M.Q.; Shi, Y.Q.; Li, Z.C.; et al. ERK/MAPK activation involves hypoxia-induced MGr1-Ag/37LRP expression and contributes to apoptosis resistance in gastric cancer. Int. J. Cancer 2010, 127, 820–829. [Google Scholar] [CrossRef]
- Hong, K.H.; Yoo, S.A.; Kang, S.S.; Choi, J.J.; Kim, W.U.; Cho, C.S. Hypoxia induces expression of connective tissue growth factor in scleroderma skin fibroblasts. Clin. Exp. Immunol. 2006, 146, 362–370. [Google Scholar] [CrossRef]
- Minet, E.; Arnould, T.; Michel, G.; Roland, I.; Mottet, D.; Raes, M.; Remacle, J.; Michiels, C. ERK activation upon hypoxia: Involvement in HIF-1 activation. FEBS Lett. 2000, 468, 53–58. [Google Scholar] [CrossRef]
- Lundgren, K.; Nordenskjold, B.; Landberg, G. Hypoxia, Snail and incomplete epithelial-mesenchymal transition in breast cancer. Br. J. Cancer 2009, 101, 1769–1781. [Google Scholar] [CrossRef]
- Tomasek, J.J.; Gabbiani, G.; Hinz, B.; Chaponnier, C.; Brown, R.A. Myofibroblasts and mechano-regulation of connective tissue remodelling. Nat. Rev. Mol. Cell Biol. 2002, 3, 349–363. [Google Scholar] [CrossRef]
- Hinz, B.; Celetta, G.; Tomasek, J.J.; Gabbiani, G.; Chaponnier, C. Alpha-smooth muscle actin expression upregulates fibroblast contractile activity. Mol. Biol. Cell 2001, 12, 2730–2741. [Google Scholar] [CrossRef]
- Shankar, J.; Nabi, I.R. Actin Cytoskeleton Regulation of Epithelial Mesenchymal Transition in Metastatic Cancer Cells. PLoS ONE 2015, 10, e0119954. [Google Scholar] [CrossRef]
- O’Toole, E.A.; Van Koningsveld, R.; Chen, M.; Woodley, D.T. Hypoxia induces epidermal keratinocyte matrix metalloproteinase-9 secretion via the protein kinase C pathway. J. Cell Physiol. 2008, 214, 47–55. [Google Scholar] [CrossRef]
- Kuwahara, H.; Tosa, M.; Egawa, S.; Murakami, M.; Mohammad, G.; Ogawa, R. Examination of Epithelial Mesenchymal Transition in Keloid Tissues and Possibility of Keloid Therapy Target. Prs-Glob. Open 2016, 4, e1138. [Google Scholar] [CrossRef]
- Liu, M.N.; Ning, X.X.; Li, R.; Yang, Z.; Yang, X.X.; Sun, S.R.; Qian, Q. Signalling pathways involved in hypoxia-induced renal fibrosis. J. Cell Mol. Med. 2017, 21, 1248–1259. [Google Scholar] [CrossRef]
- Leask, A. MEK/ERK inhibitors: Proof-of-concept studies in lung fibrosis. J. Cell Commun. Signal. 2012, 6, 59–60. [Google Scholar] [CrossRef]
- Samatar, A.A.; Poulikakos, P.I. Targeting RAS-ERK signalling in cancer: Promises and challenges. Nat. Rev. Drug Discov. 2014, 13, 928. [Google Scholar] [CrossRef]
- Kim, J.; Park, J.C.; Lee, M.H.; Yang, C.E.; Lee, J.H.; Lee, W.J. High-Mobility Group Box 1 Mediates Fibroblast Activity via RAGE-MAPK and NF-B Signaling in Keloid Scar Formation. Int. J. Mol. Sci 2018, 19, 76. [Google Scholar] [CrossRef]
- Yun, I.S.; Lee, M.H.; Rah, D.K.; Lew, D.H.; Park, J.C.; Lee, W.J. Heat Shock Protein 90 Inhibitor (17-AAG) Induces Apoptosis and Decreases Cell Migration/Motility of Keloid Fibroblasts. Plast. Reconstr. Surg. 2015, 136, 44e–53e. [Google Scholar] [CrossRef]
- Pakyari, M.; Farrokhi, A.; Maharlooei, M.K.; Ghahary, A. Critical Role of Transforming Growth Factor Beta in Different Phases of Wound Healing. Adv. Wound Care 2013, 2, 215–224. [Google Scholar] [CrossRef] [Green Version]
- Higgins, D.F.; Biju, M.P.; Akai, Y.; Wutz, A.; Johnson, R.S.; Haase, V.H. Hypoxic induction of Ctgf is directly mediated by Hif-1. Am. J. Physiol. Ren. 2004, 287, F1223–F1232. [Google Scholar] [CrossRef]
- Cheng, Y.; Lin, C.H.; Chen, J.Y.; Li, C.H.; Liu, Y.T.; Chen, B.C. Induction of Connective Tissue Growth Factor Expression by Hypoxia in Human Lung Fibroblasts via the MEKK1/MEK1/ERK1/GLI-1/GLI-2 and AP-1 Pathways. PLoS ONE 2016, 11, e0160593. [Google Scholar] [CrossRef]
- Kakudo, N.; Morimoto, N.; Ogawa, T.; Taketani, S.; Kusumoto, K. Hypoxia Enhances Proliferation of Human Adipose-Derived Stem Cells via HIF-1a Activation. PLoS ONE 2015, 10, e0139890. [Google Scholar] [CrossRef]
- Fotia, C.; Massa, A.; Boriani, F.; Baldini, N.; Granchi, D. Hypoxia enhances proliferation and stemness of human adipose-derived mesenchymal stem cells. Cytotechnology 2015, 67, 1073–1084. [Google Scholar] [CrossRef]
- Kietzmann, T.; Mennerich, D.; Dimova, E. Hypoxia-Inducible Factors (HIFs) and Phosphorylation: Impact on Stability, Localization, and Transactivity. Front. Cell Dev. Biol. 2016, 4, 11. [Google Scholar] [CrossRef]
- Sumbayev, V.V.; Yasinska, I.M. Regulation of MAP kinase-dependent apoptotic pathway: Implication of reactive oxygen and nitrogen species. Arch. Biochem. Biophys. 2005, 436, 406–412. [Google Scholar] [CrossRef]
- Wang, B.; Jiang, H.Y.; Ma, N.; Wang, Y.J. Phosphorylated-p38 mitogen-activated protein kinase expression is associated with clinical factors in invasive breast cancer. SpringerPlus 2016, 5, 934. [Google Scholar] [CrossRef]
- Lue, H.Q.; Kapurniotu, A.; Fingerle-Rowson, G.; Roger, T.; Leng, L.; Thiele, M.; Calandra, T.; Bucala, R.; Bernhagen, J. Rapid and transient activation of the ERK MAPK signalling pathway by macrophage migration inhibitory factor (MIF) and dependence on JAB1/CSN5 and Src kinase activity. Cell Signal. 2006, 18, 688–703. [Google Scholar] [CrossRef]
- Principe, D.R.; Diaz, A.M.; Torres, C.; Mangan, R.J.; DeCant, B.; McKinney, R.; Tsao, M.S.; Lowy, A.; Munshi, H.G.; Jung, B.; et al. TGFbeta engages MEK/ERK to differentially regulate benign and malignant pancreas cell function. Oncogene 2017, 36, 4336–4348. [Google Scholar] [CrossRef]
- Lu, X.; Law, B.K.; Chytil, A.M.; Brown, K.A.; Aakre, M.E.; Moses, H.L. Activation of the Erk pathway is required for TGF-beta 1-induced EMT in vitro. Neoplasia 2004, 6, 603–610. [Google Scholar] [CrossRef]
- Mottet, D.; Dumont, V.; Deccache, Y.; Demazy, C.; Ninane, N.; Raes, M.; Michiels, C. Regulation of hypoxia-inducible factor-1 alpha protein level during hypoxic conditions by the phosphatidylinositol 3-kinase/Akt/glycogen synthase kinase 3 beta pathway in HepG2 cells. J. Biol. Chem. 2003, 278, 31277–31285. [Google Scholar] [CrossRef]
- Jun, E.K.; Zhang, Q.; Yoon, B.S.; Moon, J.H.; Lee, G.; Park, G.; Kang, P.J.; Lee, J.H.; Kim, A.; You, S. Hypoxic Conditioned Medium from Human Amniotic Fluid-Derived Mesenchymal Stem Cells Accelerates Skin Wound Healing through TGF-beta/SMAD2 and PI3K/Akt Pathways. Int. J. Mol. Sci. 2014, 15, 605–628. [Google Scholar] [CrossRef]
- Wang, W.; Qu, M.; Xu, L.; Wu, X.; Gao, Z.; Gu, T.; Zhang, W.; Ding, X.; Liu, W.; Chen, Y.L. Sorafenib exerts an anti-keloid activity by antagonizing TGF-beta/Smad and MAPK/ERK signaling pathways. J. Mol. Med. 2016, 94, 1181–1194. [Google Scholar] [CrossRef]
- Soini, T.; Eloranta, K.; Pihlajoki, M.; Kyronlahti, A.; Akinrinade, O.; Andersson, N.; Lohi, J.; Pakarinen, M.P.; Wilson, D.B.; Heikinheimo, M. Transcription factor GATA4 associates with mesenchymal-like gene expression in human hepatoblastoma cells. Tumour Biol. 2018, 40. [Google Scholar] [CrossRef] [Green Version]
- Xiong, Y.; Liu, Y.; Xiong, W.Q.; Zhang, L.; Liu, H.W.; Du, Y.; Li, N. Hypoxia-inducible factor 1 alpha-induced epithelial-mesenchymal transition of endometrial epithelial cells may contribute to the development of endometriosis. Hum. Reprod. 2016, 31, 1327–1338. [Google Scholar] [CrossRef]
- Rao, Q.; Chen, Y.; Yeh, C.R.; Ding, J.; Li, L.; Chang, C.S.; Yeh, S.Y. Recruited mast cells in the tumor microenvironment enhance bladder cancer metastasis via modulation of ER beta/CCL2/CCR2 EMT/MMP9 signals. Oncotarget 2016, 7, 7842–7855. [Google Scholar] [CrossRef]
- Chen, S.; Liu, J.; Yang, M.; Lai, W.; Ye, L.; Chen, J.; Hou, X.; Ding, H.; Zhang, W.; Wu, Y.; et al. Fn14, a Downstream Target of the TGF-beta Signaling Pathway, Regulates Fibroblast Activation. PLoS ONE 2015, 10, e0143802. [Google Scholar] [CrossRef]
- Yalu, R.; Oyesiji, A.E.; Eisenberg, I.; Imbar, T.; Meidan, R. HIF1A-dependent increase in endothelin 2 levels in granulosa cells: Role of hypoxia, LH/cAMP, and reactive oxygen species. Reproduction 2015, 149, 11–20. [Google Scholar] [CrossRef]
- Wang, H.H.; Zhong, Q.; Yang, T.S.; Qi, Y.; Fu, M.C.; Yang, X.; Qiao, L.; Ling, Q.; Liu, S.F.; Zhao, Y.M. Comparative characterization of SHED and DPSCs during extended cultivation in vitro. Mol. Med. Rep. 2018, 17, 6551–6559. [Google Scholar] [CrossRef]
Target Gene | Primer Sequences (5′–3′) or Assay ID | Reference |
---|---|---|
E-cadherin | Forward: CACCACGGGCTTGGATTTTG Reverse: TGGGGGCTTCATTCACATCC | [47] |
N-cadherin | Forward: TCAGGCGTCTGTAGAGGCTT Reverse: ATGCACATCCTTCGATAAGACTG | [48] |
Vimentin | Forward: GACGCCATCAACACCGAGTT Reverse: CTTTGTCGTTGGTTAGCTGGT | [49] |
TGF-beta | Forward: ACCCACAACGAAATCTATGACA Reverse: GCTGAGGTATCGCCAGGAAT | [50] |
HIF1A | Forward: ACTCATCCATGTGACCACG Reverse: TAGTTCTCCCCCGGCTAG | [51] |
COL1A1 | Forward: AAGGTGTTGTGCGATGACG Reverse: TGGTCGGTGGGTGACTCTG | [50] |
Beta-actin | Forward: CTACCTCATGAAGATCCTCACCGA Reverse: TTCTCCTTAATGTCACGCACGATT | [52] |
CTGF | Hs00170014_m1 | |
MMP9 | Hs00957562_m1 | |
MMP2 | Hs01548727_m1 | |
TIMP2 | HS00234278_m1 | |
TIMP1 | Hs01092512_g1 | |
COL1A1 | Hs00164004_m1 | |
Beta-actin | Hs01060665_g1 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, J.; Kim, B.; Kim, S.M.; Yang, C.E.; Song, S.Y.; Lee, W.J.; Lee, J.H. Hypoxia-Induced Epithelial-To-Mesenchymal Transition Mediates Fibroblast Abnormalities via ERK Activation in Cutaneous Wound Healing. Int. J. Mol. Sci. 2019, 20, 2546. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms20102546
Kim J, Kim B, Kim SM, Yang CE, Song SY, Lee WJ, Lee JH. Hypoxia-Induced Epithelial-To-Mesenchymal Transition Mediates Fibroblast Abnormalities via ERK Activation in Cutaneous Wound Healing. International Journal of Molecular Sciences. 2019; 20(10):2546. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms20102546
Chicago/Turabian StyleKim, Jihee, Bomi Kim, Soo Min Kim, Chae Eun Yang, Seung Yong Song, Won Jai Lee, and Ju Hee Lee. 2019. "Hypoxia-Induced Epithelial-To-Mesenchymal Transition Mediates Fibroblast Abnormalities via ERK Activation in Cutaneous Wound Healing" International Journal of Molecular Sciences 20, no. 10: 2546. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms20102546