FGF23-Mediated Activation of Local RAAS Promotes Cardiac Hypertrophy and Fibrosis
Abstract
:1. Introduction
2. Results
2.1. Cardiac Hypertrophy and Left Ventricular (LV) Fibrosis Are Enhanced in Experimental Uremia and Associated with Increased FGF23 Synthesis in Heart and Bone
2.2. Cardiac Expression of RAAS-Associated Genes is Increased in 5/6Nx Rats and Correlates with LV Fibrosis
2.3. FGF23 Activates Local RAAS in Cardiomyocytes and Cardiac Fibroblasts in vitro by Increasing Expression of Agt, Ren, Ace and Ngal
2.4. FGF23-Induced Hypertrophy in Cultured Cardiomyocytes is Prevented by Cyclosporine A, Losartan and Spironolactone
2.5. FGF23-Mediated Induction of Profibrotic Markers TGFβ, CTGF and Collagen 1 is Attenuated by Inhibition of AT1R and MR
3. Discussion
4. Materials and Methods
4.1. Animal Experiments
4.2. Picrosirius Red Staining and Quantification of Myocardial Fibrosis
4.3. Isolation and Culture of Neonatal Rat Ventricular Myocytes (NRVM) and Cardiac Fibroblasts (NRCF)
4.4. Stimulation of Isolated NRVM and NRCF
4.5. Immunofluorescence Staining and Morphometry of Cultured NRVM
4.6. RNA Isolation, cDNA Synthesis and Quantitative Real-Time PCR Analysis
4.7. Cell Proliferation Assay
4.8. Statistical Analysis
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Hill, N.R.; Fatoba, S.T.; Oke, J.L.; Hirst, J.A.; O’Callaghan, C.A.; Lasserson, D.S.; Hobbs, F.D.R. Global Prevalence of Chronic Kidney Disease—A Systematic Review and Meta-Analysis. PLoS ONE 2016, 11, e0158765. [Google Scholar] [CrossRef] [PubMed]
- Thompson, S.; James, M.; Wiebe, N.; Hemmelgarn, B.; Manns, B.; Klarenbach, S.; Tonelli, M. Cause of Death in Patients with Reduced Kidney Function. J. Am. Soc. Nephrol. 2015, 26, 2504–2511. [Google Scholar] [CrossRef] [PubMed]
- Go, A.S.; Chertow, G.M.; Fan, D.; McCulloch, C.E.; Hsu, C.-Y. Chronic kidney disease and the risks of death, cardiovascular events, and hospitalization. N. Engl. J. Med. 2004, 351, 1296–1305. [Google Scholar] [CrossRef] [PubMed]
- Isakova, T.; Wahl, P.; Vargas, G.S.; Gutiérrez, O.M.; Scialla, J.; Xie, H.; Appleby, D.; Nessel, L.; Bellovich, K.; Chen, J.; et al. Fibroblast growth factor 23 is elevated before parathyroid hormone and phosphate in chronic kidney disease. Kidney Int. 2011, 79, 1370–1378. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pool, L.R.; Wolf, M. FGF23 and Nutritional Metabolism. Annu. Rev. Nutr. 2017, 37, 247–268. [Google Scholar] [CrossRef] [PubMed]
- Mitsnefes, M.M.; Betoko, A.; Schneider, M.F.; Salusky, I.B.; Wolf, M.S.; Jüppner, H.; Warady, B.A.; Furth, S.L.; Portale, A.A. FGF23 and Left Ventricular Hypertrophy in Children with CKD. Clin. J. Am. Soc. Nephrol. 2018, 13, 45–52. [Google Scholar] [CrossRef]
- Gutiérrez, O.M.; Januzzi, J.L.; Isakova, T.; Laliberte, K.; Smith, K.; Collerone, G.; Sarwar, A.; Hoffmann, U.; Coglianese, E.; Christenson, R.; et al. Fibroblast growth factor 23 and left ventricular hypertrophy in chronic kidney disease. Circulation 2009, 119, 2545–2552. [Google Scholar] [CrossRef]
- Faul, C.; Amaral, A.P.; Oskouei, B.; Hu, M.-C.; Sloan, A.; Isakova, T.; Gutiérrez, O.M.; Aguillon-Prada, R.; Lincoln, J.; Hare, J.M.; et al. FGF23 induces left ventricular hypertrophy. J. Clin. Invest. 2011, 121, 4393–4408. [Google Scholar] [CrossRef] [Green Version]
- Grabner, A.; Amaral, A.P.; Schramm, K.; Singh, S.; Sloan, A.; Yanucil, C.; Li, J.; Shehadeh, L.A.; Hare, J.M.; David, V.; et al. Activation of Cardiac Fibroblast Growth Factor Receptor 4 Causes Left Ventricular Hypertrophy. Cell Metab. 2015, 22, 1020–1032. [Google Scholar] [CrossRef] [Green Version]
- Richter, M.; Lautze, H.-J.; Walther, T.; Braun, T.; Kostin, S.; Kubin, T. The failing heart is a major source of circulating FGF23 via oncostatin M receptor activation. J. Heart Lung Transplant. 2015, 34, 1211–1214. [Google Scholar] [CrossRef]
- Leifheit-Nestler, M.; Grabner, A.; Hermann, L.; Richter, B.; Schmitz, K.; Fischer, D.-C.; Yanucil, C.; Faul, C.; Haffner, D. Vitamin D treatment attenuates cardiac FGF23/FGFR4 signaling and hypertrophy in uremic rats. Nephrol. Dial. Transplant. 2017, 32, 1493–1503. [Google Scholar] [CrossRef] [PubMed]
- Slavic, S.; Ford, K.; Modert, M.; Becirovic, A.; Handschuh, S.; Baierl, A.; Katica, N.; Zeitz, U.; Erben, R.G.; Andrukhova, O. Genetic Ablation of Fgf23 or Klotho Does not Modulate Experimental Heart Hypertrophy Induced by Pressure Overload. Sci. Rep. 2017, 7, 11298. [Google Scholar] [CrossRef]
- Andrukhova, O.; Slavic, S.; Odörfer, K.I.; Erben, R.G. Experimental Myocardial Infarction Upregulates Circulating Fibroblast Growth Factor-23. J. Bone Miner. Res. 2015, 30, 1831–1839. [Google Scholar] [CrossRef] [PubMed]
- Leifheit-Nestler, M.; Große Siemer, R.; Flasbart, K.; Richter, B.; Kirchhoff, F.; Ziegler, W.H.; Klintschar, M.; Becker, J.U.; Erbersdobler, A.; Aufricht, C.; et al. Induction of cardiac FGF23/FGFR4 expression is associated with left ventricular hypertrophy in patients with chronic kidney disease. Nephrol. Dial. Transpl. 2016, 31, 1088–1099. [Google Scholar] [CrossRef] [PubMed]
- Richter, M.; Polyakova, V.; Gajawada, P. Oncostatin M Induces FGF23 Expression in Cardiomyocytes. J. Clin. Exp. Cardiolog. 2012, 9, 1–6. [Google Scholar] [CrossRef]
- Remuzzi, G.; Perico, N.; Macia, M.; Ruggenenti, P. The role of renin-angiotensin-aldosterone system in the progression of chronic kidney disease. Kidney Int. Suppl. 2005, S57–S65. [Google Scholar] [CrossRef] [PubMed]
- Glassock, R.J.; Pecoits-Filho, R.; Barberato, S.H. Left ventricular mass in chronic kidney disease and ESRD. Clin. J. Am. Soc. Nephrol. 2009, 4 (Suppl. 1), S79–S91. [Google Scholar] [CrossRef] [PubMed]
- Ames, M.K.; Atkins, C.E.; Pitt, B. The renin-angiotensin-aldosterone system and its suppression. J. Vet. Intern. Med. 2019, 33, 363–382. [Google Scholar] [CrossRef]
- Paul, M.; Poyan Mehr, A.; Kreutz, R. Physiology of local renin-angiotensin systems. Physiol. Rev. 2006, 86, 747–803. [Google Scholar] [CrossRef]
- Dostal, D.E.; Rothblum, K.N.; Chernin, M.I.; Cooper, G.R.; Baker, K.M. Intracardiac detection of angiotensinogen and renin: A localized renin-angiotensin system in neonatal rat heart. Am. J. Physiol. 1992, 263, C838–C850. [Google Scholar] [CrossRef]
- Pi, M.; Ye, R.; Han, X.; Armstrong, B.; Liu, X.; Chen, Y.; Sun, Y.; Quarles, L.D. Cardiovascular Interactions between Fibroblast Growth Factor-23 and Angiotensin II. Sci. Rep. 2018, 8, 12398. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.; Carretero, O.A.; Liao, T.-D.; Peng, H.; Shesely, E.G.; Xu, J.; Liu, T.S.; Yang, J.J.; Reudelhuber, T.L.; Yang, X.-P. Local angiotensin II aggravates cardiac remodeling in hypertension. Am. J. Physiol. Heart Circ. Physiol. 2010, 299, H1328–H1338. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sopel, M.J.; Rosin, N.L.; Lee, T.D.G.; Légaré, J.-F. Myocardial fibrosis in response to Angiotensin II is preceded by the recruitment of mesenchymal progenitor cells. Lab. Invest. 2011, 91, 565–578. [Google Scholar] [CrossRef] [PubMed]
- Kagiyama, S.; Matsumura, K.; Fukuhara, M.; Sakagami, K.; Fujii, K.; Iida, M. Aldosterone-and-salt-induced cardiac fibrosis is independent from angiotensin II type 1a receptor signaling in mice. Hypertens. Res. 2007, 30, 979–989. [Google Scholar] [CrossRef] [PubMed]
- Catena, C.; Colussi, G.; Brosolo, G.; Novello, M.; Sechi, L.A. Aldosterone and Left Ventricular Remodeling. Horm. Metab. Res. 2015, 47, 981–986. [Google Scholar] [CrossRef] [PubMed]
- Zhang, B.; Umbach, A.T.; Chen, H.; Yan, J.; Fakhri, H.; Fajol, A.; Salker, M.S.; Spichtig, D.; Daryadel, A.; Wagner, C.A.; et al. Up-regulation of FGF23 release by aldosterone. Biochem. Biophys. Res. Commun. 2016, 470, 384–390. [Google Scholar] [CrossRef] [Green Version]
- Dai, B.; David, V.; Martin, A.; Huang, J.; Li, H.; Jiao, Y.; Gu, W.; Quarles, L.D. A comparative transcriptome analysis identifying FGF23 regulated genes in the kidney of a mouse CKD model. PLoS ONE 2012, 7, e44161. [Google Scholar] [CrossRef] [PubMed]
- Patel, V.B.; Zhong, J.-C.; Grant, M.B.; Oudit, G.Y. Role of the ACE2/Angiotensin 1-7 Axis of the Renin-Angiotensin System in Heart Failure. Circ. Res. 2016, 118, 1313–1326. [Google Scholar] [CrossRef]
- Quarles, L.D. Role of FGF23 in vitamin D and phosphate metabolism: Implications in chronic kidney disease. Exp. Cell Res. 2012, 318, 1040–1048. [Google Scholar] [CrossRef] [Green Version]
- Yuan, W.; Pan, W.; Kong, J.; Zheng, W.; Szeto, F.L.; Wong, K.E.; Cohen, R.; Klopot, A.; Zhang, Z.; Li, Y.C. 1,25-dihydroxyvitamin D3 suppresses renin gene transcription by blocking the activity of the cyclic AMP response element in the renin gene promoter. J. Biol. Chem. 2007, 282, 29821–29830. [Google Scholar] [CrossRef]
- Leifheit-Nestler, M.; Kirchhoff, F.; Nespor, J.; Richter, B.; Soetje, B.; Klintschar, M.; Heineke, J.; Haffner, D. Fibroblast growth factor 23 is induced by an activated renin-angiotensin-aldosterone system in cardiac myocytes and promotes the pro-fibrotic crosstalk between cardiac myocytes and fibroblasts. Nephrol. Dial. Transpl. 2018, 33, 1722–1734. [Google Scholar] [CrossRef] [PubMed]
- Segall, L.; Nistor, I.; Covic, A. Heart failure in patients with chronic kidney disease: A systematic integrative review. Biomed Res. Int. 2014, 2014, 937398. [Google Scholar] [CrossRef] [PubMed]
- Grabner, A.; Schramm, K.; Silswal, N.; Hendrix, M.; Yanucil, C.; Czaya, B.; Singh, S.; Wolf, M.; Hermann, S.; Stypmann, J.; et al. FGF23/FGFR4-mediated left ventricular hypertrophy is reversible. Sci. Rep. 2017, 7, 1993. [Google Scholar] [CrossRef] [PubMed]
- Hao, H.; Li, X.; Li, Q.; Lin, H.; Chen, Z.; Xie, J.; Xuan, W.; Liao, W.; Bin, J.; Huang, X.; et al. FGF23 promotes myocardial fibrosis in mice through activation of β-catenin. Oncotarget 2016, 7, 64649–64664. [Google Scholar] [CrossRef] [PubMed]
- Endo-Mochizuki, Y.; Mochizuki, N.; Sawa, H.; Takada, A.; Okamoto, H. Expression of renin and angiotensin-converting enzyme in human hearts. Heart Vessel. 1995, 10, 285–293. [Google Scholar] [CrossRef]
- Lear, W.; Ruzicka, M.; Leenen, F.H. ACE inhibitors and cardiac ACE mRNA in volume overload-induced cardiac hypertrophy. Am. J. Physiol. 1997, 273, H641–H646. [Google Scholar] [CrossRef] [PubMed]
- Schunkert, H.; Jackson, B.; Tang, S.S.; Schoen, F.J.; Smits, J.F.; Apstein, C.S.; Lorell, B.H. Distribution and functional significance of cardiac angiotensin converting enzyme in hypertrophied rat hearts. Circulation 1993, 87, 1328–1339. [Google Scholar] [CrossRef]
- Latouche, C.; El Moghrabi, S.; Messaoudi, S.; Nguyen Dinh Cat, A.; Hernandez-Diaz, I.; La Alvarez de Rosa, D.; Perret, C.; López Andrés, N.; Rossignol, P.; Zannad, F.; et al. Neutrophil gelatinase-associated lipocalin is a novel mineralocorticoid target in the cardiovascular system. Hypertension 2012, 59, 966–972. [Google Scholar] [CrossRef]
- Gardner, D. Natriuretic peptides: Markers or modulators of cardiac hypertrophy? Trends Endocrinol. Metab. 2003, 14, 411–416. [Google Scholar] [CrossRef]
- Kerkelä, R.; Ulvila, J.; Magga, J. Natriuretic Peptides in the Regulation of Cardiovascular Physiology and Metabolic Events. J. Am. Heart Assoc. 2015, 4, e002423. [Google Scholar] [CrossRef] [Green Version]
- Lijnen, P.; Petrov, V. Induction of cardiac fibrosis by aldosterone. J. Mol. Cell. Cardiol. 2000, 32, 865–879. [Google Scholar] [CrossRef] [PubMed]
- Leask, A. TGFbeta, cardiac fibroblasts, and the fibrotic response. Cardiovasc. Res. 2007, 74, 207–212. [Google Scholar] [CrossRef] [PubMed]
- Tokudome, T.; Horio, T.; Kishimoto, I.; Soeki, T.; Mori, K.; Kawano, Y.; Kohno, M.; Garbers, D.L.; Nakao, K.; Kangawa, K. Calcineurin-nuclear factor of activated T cells pathway-dependent cardiac remodeling in mice deficient in guanylyl cyclase A, a receptor for atrial and brain natriuretic peptides. Circulation 2005, 111, 3095–3104. [Google Scholar] [CrossRef] [PubMed]
- An, Z.; Yang, G.; Zheng, H.; Nie, W.; Liu, G. Biomarkers in patients with myocardial fibrosis. Open Life Sci. 2017, 12, 2711. [Google Scholar] [CrossRef]
- Lu, M.; Qin, Q.; Yao, J.; Sun, L.; Qin, X. Induction of LOX by TGF-β1/Smad/AP-1 signaling aggravates rat myocardial fibrosis and heart failure. IUBMB Life 2019, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Olson, E.R.; Naugle, J.E.; Zhang, X.; Bomser, J.A.; Meszaros, J.G. Inhibition of cardiac fibroblast proliferation and myofibroblast differentiation by resveratrol. Am. J. Physiol. Heart Circ. Physiol. 2005, 288, H1131–H1138. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Graciano, M.L.; Cavaglieri, R.d.C.; Dellê, H.; Dominguez, W.V.; Casarini, D.E.; Malheiros, D.M.A.C.; Noronha, I.L. Intrarenal Renin-Angiotensin system is upregulated in experimental model of progressive renal disease induced by chronic inhibition of nitric oxide synthesis. J. Am. Soc. Nephrol. 2004, 15, 1805–1815. [Google Scholar] [CrossRef]
- Del Prete, D.; Gambaro, G.; Lupo, A.; Anglani, F.; Brezzi, B.; Magistroni, R.; Graziotto, R.; Furci, L.; Modena, F.; Bernich, P.; et al. Precocious activation of genes of the renin-angiotensin system and the fibrogenic cascade in IgA glomerulonephritis. Kidney Int. 2003, 64, 149–159. [Google Scholar] [CrossRef] [Green Version]
- Schlaich, M.P.; Socratous, F.; Hennebry, S.; Eikelis, N.; Lambert, E.A.; Straznicky, N.; Esler, M.D.; Lambert, G.W. Sympathetic activation in chronic renal failure. J. Am. Soc. Nephrol. 2009, 20, 933–939. [Google Scholar] [CrossRef]
- Tesch, G.H.; Young, M.J. Mineralocorticoid Receptor Signaling as a Therapeutic Target for Renal and Cardiac Fibrosis. Front. Pharmacol. 2017, 8, 313. [Google Scholar] [CrossRef] [Green Version]
- Beraldo, J.I.; Benetti, A.; Borges-Júnior, F.A.; Arruda-Júnior, D.F.; Martins, F.L.; Jensen, L.; Dariolli, R.; Shimizu, M.H.; Seguro, A.C.; Luchi, W.M.; et al. Cardioprotection Conferred by Sitagliptin Is Associated with Reduced Cardiac Angiotensin II/Angiotensin-(1-7) Balance in Experimental Chronic Kidney Disease. Int. J. Mol. Sci. 2019, 20, 1940. [Google Scholar] [CrossRef] [PubMed]
- Freundlich, M.; Li, Y.C.; Quiroz, Y.; Bravo, Y.; Seeherunvong, W.; Faul, C.; Weisinger, J.R.; Rodriguez-Iturbe, B. Paricalcitol downregulates myocardial renin-angiotensin and fibroblast growth factor expression and attenuates cardiac hypertrophy in uremic rats. Am. J. Hypertens. 2014, 27, 720–726. [Google Scholar] [CrossRef] [PubMed]
- Wollert, K. The renin–angiotensin system and experimental heart failure. Cardiovasc. Res. 1999, 43, 838–849. [Google Scholar] [CrossRef]
- Xiang, W.; Kong, J.; Chen, S.; Cao, L.-P.; Qiao, G.; Zheng, W.; Liu, W.; Li, X.; Gardner, D.G.; Li, Y.C. Cardiac hypertrophy in vitamin D receptor knockout mice: Role of the systemic and cardiac renin-angiotensin systems. Am. J. Physiol. Endocrinol. Metab. 2005, 288, e125–e132. [Google Scholar] [CrossRef] [PubMed]
- Hasegawa, M.; Ishii, J.; Kitagawa, F.; Takahashi, H.; Sugiyama, K.; Tada, M.; Kanayama, K.; Takahashi, K.; Hayashi, H.; Koide, S.; et al. Plasma Neutrophil Gelatinase-Associated Lipocalin as a Predictor of Cardiovascular Events in Patients with Chronic Kidney Disease. BioMed Res. Int. 2016, 2016, 8761475. [Google Scholar] [CrossRef] [PubMed]
- Solak, Y.; Yilmaz, M.I.; Siriopol, D.; Saglam, M.; Unal, H.U.; Yaman, H.; Gok, M.; Cetinkaya, H.; Gaipov, A.; Eyileten, T.; et al. Serum neutrophil gelatinase-associated lipocalin is associated with cardiovascular events in patients with chronic kidney disease. Int. Urol. Nephrol. 2015, 47, 1993–2001. [Google Scholar] [CrossRef]
- Martínez-Martínez, E.; Buonafine, M.; Boukhalfa, I.; Ibarrola, J.; Fernández-Celis, A.; Kolkhof, P.; Rossignol, P.; Girerd, N.; Mulder, P.; López-Andrés, N.; et al. Aldosterone Target NGAL (Neutrophil Gelatinase-Associated Lipocalin) Is Involved in Cardiac Remodeling After Myocardial Infarction Through NFκB Pathway. Hypertension 2017, 70, 1148–1156. [Google Scholar] [CrossRef] [PubMed]
- Mhatre, K.N.; Wakula, P.; Klein, O.; Bisping, E.; Völkl, J.; Pieske, B.; Heinzel, F.R. Crosstalk between FGF23- and angiotensin II-mediated Ca2+ signaling in pathological cardiac hypertrophy. Cell. Mol. Life Sci. 2018, 75, 4403–4416. [Google Scholar] [CrossRef]
- Zannad, F.; Rossignol, P. Cardiorenal Syndrome Revisited. Circulation 2018, 138, 929–944. [Google Scholar] [CrossRef]
- Smith, E.R.; Tan, S.-J.; Holt, S.G.; Hewitson, T.D. FGF23 is synthesised locally by renal tubules and activates injury-primed fibroblasts. Sci. Rep. 2017, 7, 3345. [Google Scholar] [CrossRef]
- Smith, E.R.; Holt, S.G.; Hewitson, T.D. FGF23 activates injury-primed renal fibroblasts via FGFR4-dependent signalling and enhancement of TGF-β autoinduction. Int. J. Biochem. Cell Biol. 2017, 92, 63–78. [Google Scholar] [CrossRef] [PubMed]
- Han, M.; Li, A.-Y.; Meng, F.; Dong, L.-H.; Zheng, B.; Hu, H.-J.; Nie, L.; Wen, J.-K. Synergistic co-operation of signal transducer and activator of transcription 5B with activator protein 1 in angiotensin II-induced angiotensinogen gene activation in vascular smooth muscle cells. FEBS J. 2009, 276, 1720–1728. [Google Scholar] [CrossRef] [PubMed]
- Eyries, M.; Agrapart, M.; Alonso, A.; Soubrier, F. Phorbol ester induction of angiotensin-converting enzyme transcription is mediated by Egr-1 and AP-1 in human endothelial cells via ERK1/2 pathway. Circ. Res. 2002, 91, 899–906. [Google Scholar] [CrossRef] [PubMed]
- Huang, J.; Siragy, H.M. Regulation of (pro)renin receptor expression by glucose-induced mitogen-activated protein kinase, nuclear factor-kappaB, and activator protein-1 signaling pathways. Endocrinology 2010, 151, 3317–3325. [Google Scholar] [CrossRef] [PubMed]
- Liu, D.; Gao, L.; Roy, S.K.; Cornish, K.G.; Zucker, I.H. Neuronal angiotensin II type 1 receptor upregulation in heart failure: Activation of activator protein 1 and Jun N-terminal kinase. Circ. Res. 2006, 99, 1004–1011. [Google Scholar] [CrossRef] [PubMed]
- Rana, A.; Jain, S.; Puri, N.; Kaw, M.; Sirianni, N.; Eren, D.; Mopidevi, B.R.; Kumar, A. The transcriptional regulation of the human angiotensinogen gene after high-fat diet is haplotype-dependent: Novel insights into the gene-regulatory networks and implications for human hypertension. PLoS ONE 2017, 12, e0176373. [Google Scholar] [CrossRef] [PubMed]
- Dong, Q.; Li, S.; Wang, W.; Han, L.; Xia, Z.; Wu, Y.; Tang, Y.; Li, J.; Cheng, X. FGF23 regulates atrial fibrosis in atrial fibrillation by mediating the STAT3 and SMAD3 pathways. J. Cell. Physiol. 2019, 234, 19502–19510. [Google Scholar] [CrossRef]
- Hanifa, M.A.; Skott, M.; Maltesen, R.G.; Rasmussen, B.S.; Nielsen, S.; Frøkiaer, J.; Rimg, T.; Wimmer, R. Tissue, urine and blood metabolite signatures of chronic kidney disease in the 5/6 nephrectomy rat model. Metabolomics 2019, 15, 112. [Google Scholar] [CrossRef]
- Ma, L.J.; Fogo, A.B. Model of robust induction of glomerulosclerosis in mice: Importance of genetic background. Kidney Int. 2003, 64, 350–355. [Google Scholar] [CrossRef] [Green Version]
- Lim, B.J.; Yang, H.C.; Fogo, A.B. Animal models of regression/progression of kidney disease. Drug Discov. Today Dis. Models 2014, 11, 45–51. [Google Scholar] [CrossRef] [Green Version]
- Udell, J.A.; Morrow, D.A.; Jarolim, P.; Sloan, S.; Hoffman, E.B.; O’Donnell, T.F.; Vora, A.N.; Omland, T.; Solomon, S.D.; Pfeffer, M.A.; et al. Fibroblast growth factor-23, cardiovascular prognosis, and benefit of angiotensin-converting enzyme inhibition in stable ischemic heart disease. J. Am. Coll. Cardiol. 2014, 63, 2421–2428. [Google Scholar] [CrossRef] [PubMed]
- Wohlfahrt, P.; Melenovsky, V.; Kotrc, M.; Benes, J.; Jabor, A.; Franekova, J.; Lemaire, S.; Kautzner, J.; Jarolim, P. Association of Fibroblast Growth Factor-23 Levels and Angiotensin-Converting Enzyme Inhibition in Chronic Systolic Heart Failure. JACC Heart Fail. 2015, 3, 829–839. [Google Scholar] [CrossRef] [PubMed]
- Haffner, D.; Hocher, B.; Müller, D.; Simon, K.; König, K.; Richter, C.-M.; Eggert, B.; Schwarz, J.; Godes, M.; Nissel, R.; et al. Systemic cardiovascular disease in uremic rats induced by 1,25(OH)2D3. J. Hypertens. 2005, 23, 1067–1075. [Google Scholar] [CrossRef] [PubMed]
- Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; et al. Fiji: An open-source platform for biological-image analysis. Nat. Methods 2012, 9, 676–682. [Google Scholar] [CrossRef] [PubMed]
- Rueden, C.T.; Schindelin, J.; Hiner, M.C.; DeZonia, B.E.; Walter, A.E.; Arena, E.T.; Eliceiri, K.W. ImageJ2: ImageJ for the next generation of scientific image data. BMC Bioinform. 2017, 18, 529. [Google Scholar] [CrossRef] [PubMed]
- Wollert, K.C.; Taga, T.; Saito, M.; Narazaki, M.; Kishimoto, T.; Glembotski, C.C.; Vernallis, A.B.; Heath, J.K.; Pennica, D.; Wood, W.I.; et al. Cardiotrophin-1 activates a distinct form of cardiac muscle cell hypertrophy. Assembly of sarcomeric units in series VIA gp130/leukemia inhibitory factor receptor-dependent pathways. J. Biol. Chem. 1996, 271, 9535–9545. [Google Scholar] [CrossRef] [PubMed]
Characteristics | Sham | 5/6Nx | p Value |
---|---|---|---|
Number of rats (n) | 6 | 6 | |
Heart weight/body weight (mg/g) | 2.8 ± 0.1 | 3.7 ± 0.2 | 0.0005 |
Cardiomyocyte size (µm2) | 344 ± 19 | 598 ± 57 | 0.0038 |
Cardiac Fgf23 mRNA (2−ddCT) | 1.00 ± 0.07 | 9.29 ± 3.15 | 0.0250 |
Bone Fgf23 mRNA (2−ddCT) | 1.00 ± 0.20 | 11.93 ± 3.91 | 0.0129 |
Cardiac Fgfr1 mRNA (2−ddCT) | 1.00 ± 0.06 | 7.91 ± 2.49 | 0.0196 |
Cardiac Fgfr4 mRNA (2−ddCT) | 1.00 ± 0.07 | 21.91 ± 10.56 | 0.0022 |
Cardiac pNFAT protein (fold change) | 1.00 | 0.27 ± 0.18 | 0.0291 |
Gene | Forward (5′-3′) | Reverse (5′-3′) |
---|---|---|
Gapdh | ACTCCACGACATACTCAGCAC | CATCAACGACCCCTTCATT |
Agt | CAGCACGACTTCCTGACTTGGAT | GGATGCTGTGA GAACCTCTCCCA |
Ren | AGGATCAGTGCTGAATGGGGTGA | GGTTGTGAATCTCACAGGCAGTGT |
Ace | TGCCTAGATCCCAAGGTGACTTTGA | CAACTTCATGGCATCTGCCAGCA |
AT1R | GCTCTGCCACATTCCCTGAGTTA | CTTGGGGCAGTCATCTTGGATTCT |
Ngal | GATGTTGTTATCCTTGAGGCCC | CACTGACTACGACCAGTTTGCC |
ANP | AAATCCCGTATACAGTGCGG | GGAGGCATGACCTCATCTTC |
BNP | CCAGAACAATCCACGATGC | TCGAAGTCTCTCCTGGATCC |
Col1 | AAGGGTCCTTCTGGAGAACC | TGGAGAGCCAGGGAGACCCA |
Tgfb | GCAACAACGCAATCTATGAC | CCCTGTATTCCGTCTCCTT |
Ctgf | CTGGAAGACACATTTGGCCC | CAGAAGGTATTGTCATTGGT |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Böckmann, I.; Lischka, J.; Richter, B.; Deppe, J.; Rahn, A.; Fischer, D.-C.; Heineke, J.; Haffner, D.; Leifheit-Nestler, M. FGF23-Mediated Activation of Local RAAS Promotes Cardiac Hypertrophy and Fibrosis. Int. J. Mol. Sci. 2019, 20, 4634. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms20184634
Böckmann I, Lischka J, Richter B, Deppe J, Rahn A, Fischer D-C, Heineke J, Haffner D, Leifheit-Nestler M. FGF23-Mediated Activation of Local RAAS Promotes Cardiac Hypertrophy and Fibrosis. International Journal of Molecular Sciences. 2019; 20(18):4634. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms20184634
Chicago/Turabian StyleBöckmann, Ineke, Jonas Lischka, Beatrice Richter, Jennifer Deppe, Anja Rahn, Dagmar-Christiane Fischer, Jörg Heineke, Dieter Haffner, and Maren Leifheit-Nestler. 2019. "FGF23-Mediated Activation of Local RAAS Promotes Cardiac Hypertrophy and Fibrosis" International Journal of Molecular Sciences 20, no. 18: 4634. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms20184634