Empagliflozin Treatment Attenuates Hepatic Steatosis by Promoting White Adipose Expansion in Obese TallyHo Mice
Abstract
:1. Introduction
2. Results
2.1. Empagliflozin Attenuates Visceral Adiposity Independent of Weight Loss
2.2. Empagliflozin Decrease Hepatic Lipid Accumulation
2.3. Empagliflozin Promotes Nuchal White Adipose Expansion by Decreasing Brown Fat
3. Discussion
4. Materials and Methods
4.1. In Vivo Mouse Studies
4.2. In Vivo Magnetic Resonance Imaging (MRI)
4.3. Dynamic Contrast-Enhanced (DCE) MRI Using Gadoxetate Disodium (EOVIST®/Primovist®, BayerHealthCare AG, D-51368 Leverkusen, Germany)
4.4. Histology Analysis
4.5. Second Harmonic Generation
4.6. Powdered Liver Samples
4.7. Cholesterol Assay
4.8. Triglyceride Assay
4.9. Western Blotting
4.10. Inflammatory Cytokines
4.11. Quantitative PCR (qPCR)
4.12. Oil Red O
4.13. Immunohistochemistry for UCP1
4.14. Statistics
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Tamarai, K.; Bhatti, J.S.; Reddy, P.H. Molecular and cellular bases of diabetes: Focus on type 2 diabetes mouse model-TallyHo. Biochim. Biophys. Acta Mol. Basis Dis. 2019, 1865, 2276–2284. [Google Scholar] [CrossRef] [PubMed]
- Gale, E.A.; Gillespie, K.M. Diabetes and gender. Diabetologia 2001, 44, 3–15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tesch, G.H.; Allen, T.J. Rodent models of streptozotocin-induced diabetic nephropathy. Nephrology 2007, 12, 261–266. [Google Scholar] [CrossRef] [PubMed]
- Akshintala, D.; Chugh, R.; Amer, F.; Cusi, K. Nonalcoholic Fatty Liver Disease: The Overlooked Complication of Type 2 Diabetes. In Endotext; Feingold, K.R., Anawalt, B., Boyce, A., Chrousos, G., Dungan, K., Grossman, A., Hershman, J.M., Kaltsas, G., Koch, C., Kopp, P., et al., Eds.; MDText.com, Inc.: South Dartmouth, MA, USA, 2000. [Google Scholar]
- Alves-Bezerra, M.; Cohen, D.E. Triglyceride Metabolism in the Liver. Compr. Physiol. 2017, 8, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Farrell, G.; Schattenberg, J.M.; Leclercq, I.; Yeh, M.M.; Goldin, R.; Teoh, N.; Schuppan, D. Mouse Models of Nonalcoholic Steatohepatitis: Toward Optimization of Their Relevance to Human Nonalcoholic Steatohepatitis. Hepatology 2019, 69, 2241–2257. [Google Scholar] [CrossRef] [Green Version]
- Kothari, S.; Dhami-Shah, H.; Shah, S.R. Antidiabetic Drugs and Statins in Nonalcoholic Fatty Liver Disease. J. Clin. Exp. Hepatol. 2019, 9, 723–730. [Google Scholar] [CrossRef] [Green Version]
- Younossi, Z.M.; Golabi, P.; de Avila, L.; Paik, J.M.; Srishord, M.; Fukui, N.; Qiu, Y.; Burns, L.; Afendy, A.; Nader, F. The global epidemiology of NAFLD and NASH in patients with type 2 diabetes: A systematic review and meta-analysis. J. Hepatol. 2019, 71, 793–801. [Google Scholar] [CrossRef]
- Buzzetti, E.; Pinzani, M.; Tsochatzis, E.A. The multiple-hit pathogenesis of non-alcoholic fatty liver disease (NAFLD). Metabolism 2016, 65, 1038–1048. [Google Scholar] [CrossRef]
- Marsenic, O. Glucose control by the kidney: An emerging target in diabetes. Am. J. Kidney Dis. 2009, 53, 875–883. [Google Scholar] [CrossRef] [Green Version]
- Mather, A.; Pollock, C. Glucose handling by the kidney. Kidney Int. Suppl. 2011, 79, S1–S6. [Google Scholar] [CrossRef] [Green Version]
- Rieg, T.; Masuda, T.; Gerasimova, M.; Mayoux, E.; Platt, K.; Powell, D.R.; Thomson, S.C.; Koepsell, H.; Vallon, V. Increase in SGLT1-mediated transport explains renal glucose reabsorption during genetic and pharmacological SGLT2 inhibition in euglycemia. Am. J. Physiol. Renal. Physiol. 2014, 306, F188–F193. [Google Scholar] [CrossRef] [PubMed]
- Vallon, V.; Platt, K.A.; Cunard, R.; Schroth, J.; Whaley, J.; Thomson, S.C.; Koepsell, H.; Rieg, T. SGLT2 mediates glucose reabsorption in the early proximal tubule. J. Am. Soc. Nephrol. 2011, 22, 104–112. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jurczak, M.J.; Lee, H.Y.; Birkenfeld, A.L.; Jornayvaz, F.R.; Frederick, D.W.; Pongratz, R.L.; Zhao, X.; Moeckel, G.W.; Samuel, V.T.; Whaley, J.M.; et al. SGLT2 deletion improves glucose homeostasis and preserves pancreatic beta-cell function. Diabetes 2011, 60, 890–898. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kaplan, A.; Abidi, E.; El-Yazbi, A.; Eid, A.; Booz, G.W.; Zouein, F.A. Direct cardiovascular impact of SGLT2 inhibitors: Mechanisms and effects. Heart Fail. Rev. 2018, 23, 419–437. [Google Scholar] [CrossRef] [PubMed]
- Komiya, C.; Tsuchiya, K.; Shiba, K.; Miyachi, Y.; Furuke, S.; Shimazu, N.; Yamaguchi, S.; Kanno, K.; Ogawa, Y. Ipragliflozin Improves Hepatic Steatosis in Obese Mice and Liver Dysfunction in Type 2 Diabetic Patients Irrespective of Body Weight Reduction. PLoS ONE 2016, 11, e0151511. [Google Scholar] [CrossRef] [Green Version]
- Lahnwong, S.; Chattipakorn, S.C.; Chattipakorn, N. Potential mechanisms responsible for cardioprotective effects of sodium-glucose co-transporter 2 inhibitors. Cardiovasc. Diabetol. 2018, 17, 101. [Google Scholar] [CrossRef] [Green Version]
- Powell, D.R.; DaCosta, C.M.; Gay, J.; Ding, Z.M.; Smith, M.; Greer, J.; Doree, D.; Jeter-Jones, S.; Mseeh, F.; Rodriguez, L.A.; et al. Improved glycemic control in mice lacking Sglt1 and Sglt2. Am. J. Physiol. Endocrinol. Metab. 2013, 304, E117–E130. [Google Scholar] [CrossRef] [Green Version]
- Wang, D.; Luo, Y.; Wang, X.; Orlicky, D.J.; Myakala, K.; Yang, P.; Levi, M. The Sodium-Glucose Cotransporter 2 Inhibitor Dapagliflozin Prevents Renal and Liver Disease in Western Diet Induced Obesity Mice. Int. J. Mol. Sci. 2018, 19, 137. [Google Scholar] [CrossRef] [Green Version]
- Wang, X.X.; Levi, J.; Luo, Y.; Myakala, K.; Herman-Edelstein, M.; Qiu, L.; Wang, D.; Peng, Y.; Grenz, A.; Lucia, S.; et al. SGLT2 Protein Expression Is Increased in Human Diabetic Nephropathy: SGLT2 protein inhibition decreases renal lipid accumulation, inflammation, and the development of nephropathy in diabetic mice. J. Biol. Chem. 2017, 292, 5335–5348. [Google Scholar] [CrossRef] [Green Version]
- Loria, P.; Lonardo, A.; Bellentani, S.; Day, C.P.; Marchesini, G.; Carulli, N. Non-alcoholic fatty liver disease (NAFLD) and cardiovascular disease: An open question. Nutr. Metab. Cardiovasc. Dis. 2007, 17, 684–698. [Google Scholar] [CrossRef]
- Stepanova, M.; Younossi, Z.M. Independent association between nonalcoholic fatty liver disease and cardiovascular disease in the US population. Clin. Gastroenterol. Hepatol. 2012, 10, 646–650. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.H.; Saxton, A.M. The TALLYHO mouse as a model of human type 2 diabetes. Methods Mol. Biol. 2012, 933, 75–87. [Google Scholar] [CrossRef] [PubMed]
- Stewart, T.P.; Mao, X.; Aqqad, M.N.; Uffort, D.; Dillon, K.D.; Saxton, A.M.; Kim, J.H. Subcongenic analysis of tabw2 obesity QTL on mouse chromosome 6. BMC Genet. 2012, 13, 81. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shepard, B.D.; Ecelbarger, C.M. Sodium Glucose Transporter, Type 2 (SGLT2) Inhibitors (SGLT2i) and Glucagon-Like Peptide 1-Receptor Agonists: Newer Therapies in Whole-Body Glucose Stabilization. Semin. Nephrol. 2021, 41, 331–348. [Google Scholar] [CrossRef]
- Geng, T.; Hu, W.; Broadwater, M.H.; Snider, J.M.; Bielawski, J.; Russo, S.B.; Schwacke, J.H.; Ross, J.; Cowart, L.A. Fatty acids differentially regulate insulin resistance through endoplasm reticulum stress-mediated induction of tribbles homologue 3: A potential link between dietary fat composition and the pathophysiological outcomes of obesity. Diabetologia 2013, 56, 2078–2087. [Google Scholar] [CrossRef]
- Geng, T.; Sutter, A.; Harland, M.D.; Law, B.A.; Ross, J.S.; Lewin, D.; Palanisamy, A.; Russo, S.B.; Chavin, K.D.; Cowart, L.A. SphK1 mediates hepatic inflammation in a mouse model of NASH induced by high saturated fat feeding and initiates proinflammatory signaling in hepatocytes. J. Lipid Res. 2015, 56, 2359–2371. [Google Scholar] [CrossRef] [Green Version]
- Geng, T.; Xia, L.; Russo, S.; Kamara, D.; Cowart, L.A. Prosteatotic genes are associated with unsaturated fat suppression of saturated fat-induced hepatic steatosis in C57BL/6 mice. Nutr. Res. 2015, 35, 812–822. [Google Scholar] [CrossRef] [Green Version]
- Barrios, V.; Escobar, C. Canagliflozin: Metabolic, cardiovascular and renal protection. Future Cardiol. 2021, 17, 443–458. [Google Scholar] [CrossRef]
- Cherney, D.; Lund, S.S.; Perkins, B.A.; Groop, P.H.; Cooper, M.E.; Kaspers, S.; Pfarr, E.; Woerle, H.J.; von Eynatten, M. The effect of sodium glucose cotransporter 2 inhibition with empagliflozin on microalbuminuria and macroalbuminuria in patients with type 2 diabetes. Diabetologia 2016, 59, 1860–1870. [Google Scholar] [CrossRef]
- Perkovic, V.; Jardine, M.J.; Neal, B.; Bompoint, S.; Heerspink, H.J.L.; Charytan, D.M.; Edwards, R.; Agarwal, R.; Bakris, G.; Bull, S.; et al. Canagliflozin and Renal Outcomes in Type 2 Diabetes and Nephropathy. N. Engl. J. Med. 2019, 380, 2295–2306. [Google Scholar] [CrossRef] [Green Version]
- Zinman, B.; Lachin, J.M.; Inzucchi, S.E. Empagliflozin, Cardiovascular Outcomes, and Mortality in Type 2 Diabetes. N. Engl. J. Med. 2016, 374, 1094. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zinman, B.; Wanner, C.; Lachin, J.M.; Fitchett, D.; Bluhmki, E.; Hantel, S.; Mattheus, M.; Devins, T.; Johansen, O.E.; Woerle, H.J.; et al. Empagliflozin, Cardiovascular Outcomes, and Mortality in Type 2 Diabetes. N. Engl. J. Med. 2015, 373, 2117–2128. [Google Scholar] [CrossRef] [Green Version]
- Choi, I.Y.; Cha, S.H.; Yeom, S.K.; Lee, S.W.; Chung, H.H.; Je, B.K.; Seo, B.K.; Lee, K.Y. Diagnosis of acute cholecystitis: Value of contrast agent in the gallbladder and cystic duct on Gd-EOB-DTPA enhanced MR cholangiography. Clin. Imaging 2014, 38, 174–178. [Google Scholar] [CrossRef] [PubMed]
- Shuboni-Mulligan, D.D.; Parys, M.; Blanco-Fernandez, B.; Mallett, C.L.; Schnegelberger, R.; Takada, M.; Chakravarty, S.; Hagenbuch, B.; Shapiro, E.M. Dynamic Contrast-Enhanced MRI of OATP Dysfunction in Diabetes. Diabetes 2019, 68, 271–280. [Google Scholar] [CrossRef] [Green Version]
- Van Beers, B.E.; Pastor, C.M.; Hussain, H.K. Primovist, Eovist: What to expect? J. Hepatol. 2012, 57, 421–429. [Google Scholar] [CrossRef] [PubMed]
- Stringer, D.M.; Zahradka, P.; Declercq, V.C.; Ryz, N.R.; Diakiw, R.; Burr, L.L.; Xie, X.; Taylor, C.G. Modulation of lipid droplet size and lipid droplet proteins by trans-10,cis-12 conjugated linoleic acid parallels improvements in hepatic steatosis in obese, insulin-resistant rats. Biochim. Biophys. Acta 2010, 1801, 1375–1385. [Google Scholar] [CrossRef]
- Loos, R.J.F.; Yeo, G.S.H. The genetics of obesity: From discovery to biology. Nat. Rev. Genet. 2022, 23, 120–133. [Google Scholar] [CrossRef]
- Bhatti, J.S.; Thamarai, K.; Kandimalla, R.; Manczak, M.; Yin, X.; Kumar, S.; Vijayan, M.; Reddy, P.H. Mitochondria-Targeted Small Peptide, SS31 Ameliorates Diabetes Induced Mitochondrial Dynamics in Male TallyHO/JngJ Mice. Mol. Neurobiol. 2021, 58, 795–808. [Google Scholar] [CrossRef] [PubMed]
- Devlin, M.J.; Van Vliet, M.; Motyl, K.; Karim, L.; Brooks, D.J.; Louis, L.; Conlon, C.; Rosen, C.J.; Bouxsein, M.L. Early-onset type 2 diabetes impairs skeletal acquisition in the male TALLYHO/JngJ mouse. Endocrinology 2014, 155, 3806–3816. [Google Scholar] [CrossRef] [Green Version]
- Li, H.; Yang, H.; Ding, Y.; Aprecio, R.; Zhang, W.; Wang, Q.; Li, Y. Experimental periodontitis induced by Porphyromonas gingivalis does not alter the onset or severity of diabetes in mice. J. Periodontal. Res. 2013, 48, 582–590. [Google Scholar] [CrossRef]
- Kutscher, C.L.; Miller, M.; Schmalbach, N.L. Renal deficiency associated with diabetes insipidus in the SWR/J mouse. Physiol. Behav. 1975, 14, 815–818. [Google Scholar] [CrossRef]
- Babelova, A.; Burckhardt, B.C.; Wegner, W.; Burckhardt, G.; Henjakovic, M. Sex-differences in renal expression of selected transporters and transcription factors in lean and obese Zucker spontaneously hypertensive fatty rats. J. Diabetes Res. 2015, 2015, 483238. [Google Scholar] [CrossRef] [PubMed]
- Gustavsson, C.; Soga, T.; Wahlstrom, E.; Vesterlund, M.; Azimi, A.; Norstedt, G.; Tollet-Egnell, P. Sex-dependent hepatic transcripts and metabolites in the development of glucose intolerance and insulin resistance in Zucker diabetic fatty rats. J. Mol. Endocrinol. 2011, 47, 129–143. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hwang, L.L.; Wang, C.H.; Li, T.L.; Chang, S.D.; Lin, L.C.; Chen, C.P.; Chen, C.T.; Liang, K.C.; Ho, I.K.; Yang, W.S.; et al. Sex differences in high-fat diet-induced obesity, metabolic alterations and learning, and synaptic plasticity deficits in mice. Obesity 2010, 18, 463–469. [Google Scholar] [CrossRef] [PubMed]
- Le May, C.; Chu, K.; Hu, M.; Ortega, C.S.; Simpson, E.R.; Korach, K.S.; Tsai, M.J.; Mauvais-Jarvis, F. Estrogens protect pancreatic beta-cells from apoptosis and prevent insulin-deficient diabetes mellitus in mice. Proc. Natl. Acad. Sci. USA 2006, 103, 9232–9237. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pettersson, U.S.; Walden, T.B.; Carlsson, P.O.; Jansson, L.; Phillipson, M. Female mice are protected against high-fat diet induced metabolic syndrome and increase the regulatory T cell population in adipose tissue. PLoS ONE 2012, 7, e46057. [Google Scholar] [CrossRef]
- Shepard, B.D. Sex Differences in Diabetes and Kidney Disease: Mechanisms and Consequences. Am. J. Physiol. Renal Physiol. 2019, 317, F456–F462. [Google Scholar] [CrossRef]
- Hong, J.; Stubbins, R.E.; Smith, R.R.; Harvey, A.E.; Nunez, N.P. Differential susceptibility to obesity between male, female and ovariectomized female mice. Nutr. J. 2009, 8, 11. [Google Scholar] [CrossRef] [Green Version]
- Kovats, S. Estrogen receptors regulate innate immune cells and signaling pathways. Cell Immunol. 2015, 294, 63–69. [Google Scholar] [CrossRef] [Green Version]
- Kautzky-Willer, A.; Harreiter, J. Sex and gender differences in therapy of type 2 diabetes. Diabetes Res. Clin. Pract. 2017, 131, 230–241. [Google Scholar] [CrossRef]
- Jakher, H.; Chang, T.I.; Tan, M.; Mahaffey, K.W. Canagliflozin review-safety and efficacy profile in patients with T2DM. Diabetes Metab. Syndr. Obes. 2019, 12, 209–215. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nyirjesy, P.; Sobel, J.D.; Fung, A.; Mayer, C.; Capuano, G.; Ways, K.; Usiskin, K. Genital mycotic infections with canagliflozin, a sodium glucose co-transporter 2 inhibitor, in patients with type 2 diabetes mellitus: A pooled analysis of clinical studies. Curr. Med. Res. Opin. 2014, 30, 1109–1119. [Google Scholar] [CrossRef] [PubMed]
- Vasapollo, P.; Cione, E.; Luciani, F.; Gallelli, L. Generalized Intense Pruritus During Canagliflozin Treatment: Is it an Adverse Drug Reaction? Curr. Drug Saf. 2018, 13, 38–40. [Google Scholar] [CrossRef] [PubMed]
- Cox, A.R.; Chernis, N.; Masschelin, P.M.; Hartig, S.M. Immune Cells Gate White Adipose Tissue Expansion. Endocrinology 2019, 160, 1645–1658. [Google Scholar] [CrossRef] [PubMed]
- Hamdy, O.; Porramatikul, S.; Al-Ozairi, E. Metabolic obesity: The paradox between visceral and subcutaneous fat. Curr. Diabetes Rev. 2006, 2, 367–373. [Google Scholar] [CrossRef]
- Kaess, B.M.; Pedley, A.; Massaro, J.M.; Murabito, J.; Hoffmann, U.; Fox, C.S. The ratio of visceral to subcutaneous fat, a metric of body fat distribution, is a unique correlate of cardiometabolic risk. Diabetologia 2012, 55, 2622–2630. [Google Scholar] [CrossRef] [Green Version]
- Rosenquist, K.J.; Pedley, A.; Massaro, J.M.; Therkelsen, K.E.; Murabito, J.M.; Hoffmann, U.; Fox, C.S. Visceral and subcutaneous fat quality and cardiometabolic risk. JACC Cardiovasc. Imaging 2013, 6, 762–771. [Google Scholar] [CrossRef] [Green Version]
- Guo, T.; Gupta, A.; Yu, J.; Granados, J.Z.; Gandhi, A.Y.; Evers, B.M.; Iyengar, P.; Infante, R.E. LIFR-alpha-dependent adipocyte signaling in obesity limits adipose expansion contributing to fatty liver disease. iScience 2021, 24, 102227. [Google Scholar] [CrossRef]
- Ran, L.; Wang, X.; Mi, A.; Liu, Y.; Wu, J.; Wang, H.; Guo, M.; Sun, J.; Liu, B.; Li, Y.; et al. Loss of Adipose Growth Hormone Receptor in Mice Enhances Local Fatty Acid Trapping and Impairs Brown Adipose Tissue Thermogenesis. iScience 2019, 16, 106–121. [Google Scholar] [CrossRef] [Green Version]
- Cohen, P.; Kajimura, S. The cellular and functional complexity of thermogenic fat. Nat. Rev. Mol. Cell Biol. 2021, 22, 393–409. [Google Scholar] [CrossRef]
- Yu, Q.; Huang, S.; Xu, T.T.; Wang, Y.C.; Ju, S. Measuring Brown Fat Using MRI and Implications in the Metabolic Syndrome. J. Magn. Reson. Imaging 2021, 54, 1377–1392. [Google Scholar] [CrossRef] [PubMed]
- Yau, W.W.; Yen, P.M. Thermogenesis in Adipose Tissue Activated by Thyroid Hormone. Int. J. Mol. Sci. 2020, 21, 3020. [Google Scholar] [CrossRef] [PubMed]
- Szekeres, Z.; Toth, K.; Szabados, E. The Effects of SGLT2 Inhibitors on Lipid Metabolism. Metabolites 2021, 11, 87. [Google Scholar] [CrossRef] [PubMed]
- Xu, L.; Nagata, N.; Nagashimada, M.; Zhuge, F.; Ni, Y.; Chen, G.; Mayoux, E.; Kaneko, S.; Ota, T. SGLT2 Inhibition by Empagliflozin Promotes Fat Utilization and Browning and Attenuates Inflammation and Insulin Resistance by Polarizing M2 Macrophages in Diet-induced Obese Mice. EBioMedicine 2017, 20, 137–149. [Google Scholar] [CrossRef] [Green Version]
- Xu, L.; Ota, T. Emerging roles of SGLT2 inhibitors in obesity and insulin resistance: Focus on fat browning and macrophage polarization. Adipocyte 2018, 7, 121–128. [Google Scholar] [CrossRef] [Green Version]
- Russo, S.B.; Baicu, C.F.; Van Laer, A.; Geng, T.; Kasiganesan, H.; Zile, M.R.; Cowart, L.A. Ceramide synthase 5 mediates lipid-induced autophagy and hypertrophy in cardiomyocytes. J. Clin. Investig. 2012, 122, 3919–3930. [Google Scholar] [CrossRef] [Green Version]
- Gohlke, S.; Zagoriy, V.; Cuadros Inostroza, A.; Meret, M.; Mancini, C.; Japtok, L.; Schumacher, F.; Kuhlow, D.; Graja, A.; Stephanowitz, H.; et al. Identification of functional lipid metabolism biomarkers of brown adipose tissue aging. Mol. Metab. 2019, 24, 1–17. [Google Scholar] [CrossRef]
- Heerspink, H.J.L.; Stefansson, B.V.; Correa-Rotter, R.; Chertow, G.M.; Greene, T.; Hou, F.F.; Mann, J.F.E.; McMurray, J.J.V.; Lindberg, M.; Rossing, P.; et al. Dapagliflozin in Patients with Chronic Kidney Disease. N. Engl. J. Med. 2020, 383, 1436–1446. [Google Scholar] [CrossRef]
- Toledo, F.G.; Sniderman, A.D.; Kelley, D.E. Influence of hepatic steatosis (fatty liver) on severity and composition of dyslipidemia in type 2 diabetes. Diabetes Care 2006, 29, 1845–1850. [Google Scholar] [CrossRef] [Green Version]
- Coia, H.; Ma, N.; Hou, Y.; Permaul, E.; Berry, D.L.; Cruz, M.I.; Pannkuk, E.; Girgis, M.; Zhu, Z.; Lee, Y.; et al. Theaphenon E prevents fatty liver disease and increases CD4+ T cell survival in mice fed a high-fat diet. Clin. Nutr. 2021, 40, 110–119. [Google Scholar] [CrossRef]
- Takahashi, S.; Luo, Y.; Ranjit, S.; Xie, C.; Libby, A.E.; Orlicky, D.J.; Dvornikov, A.; Wang, X.X.; Myakala, K.; Jones, B.A.; et al. Bile acid sequestration reverses liver injury and prevents progression of nonalcoholic steatohepatitis in Western diet-fed mice. J. Biol. Chem. 2020, 295, 4733–4747. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brown, E.; McKee, T.; diTomaso, E.; Pluen, A.; Seed, B.; Boucher, Y.; Jain, R.K. Dynamic imaging of collagen and its modulation in tumors in vivo using second-harmonic generation. Nat Med 2003, 9, 796–800. [Google Scholar] [CrossRef] [PubMed]
- Gailhouste, L.; Grand, Y.L.; Odin, C.; Guyader, D.; Turlin, B.; Ezan, F.; Désille, Y.; Guilbert, T.; Bessard, A.; Frémin, C.; et al. Fibrillar Collagen Scoring by Second Harmonic Microscopy: A New Tool in the Assessment of Liver Fibrosis. J. Hepatol. 2010, 52, 398–406. Available online: http://0-www-sciencedirect-com.brum.beds.ac.uk/science/article/pii/S0168827809008101 (accessed on 31 March 2022). [CrossRef] [PubMed]
- Ranjit, S.; Dvornikov, A.; Stakic, M.; Hong, S.-H.; Levi, M.; Evans, R.M.; Gratton, E. Imaging Fibrosis and Separating Collagens Using Second Harmonic Generation and Phasor Approach to Fluorescence Lifetime Imaging. Sci. Rep. 2015, 5, 13378. Available online: http://0-www-nature-com.brum.beds.ac.uk/articles/srep13378#supplementary-information (accessed on 31 March 2022). [CrossRef] [Green Version]
- Strupler, M.; Pena, A.M.; Hernest, M.; Tharaux, P.L.; Martin, J.L.; Beaurepaire, E.; Schanne-Klein, M.C. Second Harmonic Imaging and Scoring of Collagen in Fibrotic Tissues. Opt. Express 2007, 15, 4054–4065. Available online: http://www.opticsexpress.org/abstract.cfm?URI=oe-15-7-4054 (accessed on 31 March 2022). [CrossRef] [PubMed]
- Crosignani, V.; Dvornikov, A.; Aguilar, J.S.; Stringari, C.; Edwards, R.; Mantulin, W.W.; Gratton, E. Deep tissue fluorescence imaging and in vivo biological applications. J. Biomed. Opt. 2012, 17, 116023. [Google Scholar] [CrossRef] [Green Version]
- Crosignani, V.; Jahid, S.; Dvornikov, A.S.; Gratton, E. A deep tissue fluorescence imaging system with enhanced SHG detection capabilities. Microsc. Res. Tech. 2014, 77, 368–373. [Google Scholar] [CrossRef] [Green Version]
- Dvornikov, A.; Gratton, E. Imaging in turbid media: A transmission detector gives 2-3 order of magnitude enhanced sensitivity compared to epi-detection schemes. Biomed. Opt. Express 2016, 7, 3747–3755. Available online: http://www.osapublishing.org/boe/abstract.cfm?URI=boe-7-9-3747 (accessed on 31 March 2022). [CrossRef] [Green Version]
- Ranjit, S.; Dvornikov, A.; Levi, M.; Furgeson, S.; Gratton, E. Characterizing fibrosis in UUO mice model using multiparametric analysis of phasor distribution from FLIM images. Biomed. Opt. Express 2016, 7, 3519–3530. Available online: http://www.osapublishing.org/boe/abstract.cfm?URI=boe-7-9-3519 (accessed on 31 March 2022). [CrossRef]
- Ranjit, S.; Dobrinskikh, E.; Montford, J.; Dvornikov, A.; Lehman, A.; Orlicky, D.J.; Nemenoff, R.; Gratton, E.; Levi, M.; Furgeson, S. Label-free fluorescence lifetime and second harmonic generation imaging microscopy improves quantification of experimental renal fibrosis. Kidney Int. 2016, 90, 1123–1128. Available online: http://0-www-sciencedirect-com.brum.beds.ac.uk/science/article/pii/S0085253816303246 (accessed on 31 March 2022). [CrossRef] [Green Version]
- Mehlem, A.; Hagberg, C.E.; Muhl, L.; Eriksson, U.; Falkevall, A. Imaging of neutral lipids by oil red O for analyzing the metabolic status in health and disease. Nat. Protoc. 2013, 8, 1149–1154. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene Name | Forward Primer | Reverse Primer |
---|---|---|
SREBP-1C | ACCACGGAGCCATGGATTG | GGGAAGTCACTGTCTTGGTTG |
Plin2 | GACAGGATGGAGGAAAGACTGC | GGTAGTCGTCACCACATCCTTC |
FAS | TCGTCTATACCACTGCTTACTAC | ACACCACCTGAACCTGAG |
ATGL1 | GCTGTGGAATGAGGACATAGGA | GCATAGTGAGTGGCTGGTGAA |
CD36 | TTGAAAAGTCTCGGACATTGAG | TCAGATCCGAACACAGCGTA |
CPT1b | AAGAGACCCCGTAGCCATCAT | GACCCAAAACAGTATCCCAATCA |
Fatp2 | GATGCCGTGTCCGTCTTTTAC | GACTTCAGACCTCCACGACTC |
CPT2 | CAAAAGACTCATCCGCTTTGTTC | CATCACGACTGGGTTTGGGTA |
ChREBPβ | TCTGCAGATCGCGTGGAG | CTTGTCCCGGCATAGCAAC |
18s rRNA | GTAACCCGTTGAACCCCATT | CCATCCAATCGGTAGTAGCG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kurtz, R.; Libby, A.; Jones, B.A.; Myakala, K.; Wang, X.; Lee, Y.; Knoer, G.; Lo Cascio, J.N.; McCormack, M.; Nguyen, G.; et al. Empagliflozin Treatment Attenuates Hepatic Steatosis by Promoting White Adipose Expansion in Obese TallyHo Mice. Int. J. Mol. Sci. 2022, 23, 5675. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms23105675
Kurtz R, Libby A, Jones BA, Myakala K, Wang X, Lee Y, Knoer G, Lo Cascio JN, McCormack M, Nguyen G, et al. Empagliflozin Treatment Attenuates Hepatic Steatosis by Promoting White Adipose Expansion in Obese TallyHo Mice. International Journal of Molecular Sciences. 2022; 23(10):5675. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms23105675
Chicago/Turabian StyleKurtz, Ryan, Andrew Libby, Bryce A. Jones, Komuraiah Myakala, Xiaoxin Wang, Yichien Lee, Grace Knoer, Julia N. Lo Cascio, Michaela McCormack, Grace Nguyen, and et al. 2022. "Empagliflozin Treatment Attenuates Hepatic Steatosis by Promoting White Adipose Expansion in Obese TallyHo Mice" International Journal of Molecular Sciences 23, no. 10: 5675. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms23105675