Coffee Polyphenol, Chlorogenic Acid, Suppresses Brain Aging and Its Effects Are Enhanced by Milk Fat Globule Membrane Components
Abstract
:1. Introduction
2. Results
2.1. Reduction in Mortality Due to CCP or MFGM Intake
2.2. Evaluation of Brain Function by Novel Object Recognition Test
2.3. Changes in the Expression of Inflammatory Genes in the Hippocampus and Cerebral Cortex
2.4. Changes in Expression of Genes Related to Cognitive Function and Lifespan
2.5. Effects of CPP and MFGM on Microglial Cells
2.6. Effects of Systemic Circulation on Inflammation in the Brain
3. Discussion
4. Materials and Methods
4.1. Animals and Reagents
4.2. Novel Object Recognition Test
4.3. Quantitative Real-Time Reverse Transcription PCR (qRT-PCR)
4.4. Effects of CPP and MFGM on Microglia
4.5. Measurement of Endotoxin in the Serum of Aged Mice
4.6. Statistical Analyses
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Acknowledgments
Conflicts of Interest
References
- Unno, K.; Nakamura, Y. Green Tea Suppresses Brain Aging. Molecules 2021, 26, 4897. [Google Scholar] [CrossRef] [PubMed]
- Unno, K.; Pervin, M.; Taguchi, K.; Konishi, T.; Nakamura, Y. Green Tea Catechins Trigger Immediate-Early Genes in the Hippocampus and Prevent Cognitive Decline and Lifespan Shortening. Molecules 2020, 25, 1484. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Onishi, S.; Meguro, S.; Pervin, M.; Kitazawa, H.; Yoto, A.; Ishino, M.; Shimba, Y.; Mochizuki, Y.; Miura, S.; Tokimitsu, I.; et al. Green Tea Extracts Attenuate Brain Dysfunction in High-Fat-Diet-Fed SAMP8 Mice. Nutrients 2019, 11, 821. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Onishi, S.; Ishino, M.; Kitazawa, H.; Yoto, A.; Shimba, Y.; Mochizuki, Y.; Unno, K.; Meguro, S.; Tokimitsu, I.; Miura, S. Green tea extracts ameliorate high-fat diet-induced muscle atrophy in senescence-accelerated mouse prone-8 mice. PLoS ONE 2018, 13, e0195753. [Google Scholar] [CrossRef]
- Takeda, T. Senescence-accelerated mouse (SAM) with special references to neurodegeneration models, SAMP8 and SAMP10 mice. Neurochem. Res. 2009, 34, 639–659. [Google Scholar] [CrossRef]
- Tajik, N.; Tajik, M.; Mack, I.; Enck, P. The potential effects of chlorogenic acid, the main phenolic components in coffee, on health: A comprehensive review of the literature. Eur. J. Nutr. 2017, 56, 2215–2244. [Google Scholar] [CrossRef]
- Naveed, M.; Hejazi, V.; Abbas, M.; Kamboh, A.A.; Khan, G.J.; Shumzaid, M.; Ahmad, F.; Babazadeh, D.; FangFang, X.; Modarresi-Ghazani, F.; et al. Chlorogenic acid (CGA): A pharmacological review and call for further research. Biomed. Pharm. 2018, 97, 67–74. [Google Scholar] [CrossRef]
- Santana-Gálvez, J.; Cisneros-Zevallos, L.; Jacobo-Velázquez, D.A. Chlorogenic Acid: Recent Advances on Its Dual Role as a Food Additive and a Nutraceutical against Metabolic Syndrome. Molecules 2017, 22, 358. [Google Scholar] [CrossRef] [Green Version]
- Bagdas, D.; Gul, Z.; Meade, J.A.; Cam, B.; Cinkilic, N.; Gurun, M.S. Pharmacologic Overview of Chlorogenic Acid and its Metabolites in Chronic Pain and Inflammation. Curr. Neuropharm. 2020, 18, 216–228. [Google Scholar] [CrossRef]
- Kosmerl, E.; Rocha-Mendoza, D.; Ortega-Anaya, J.; Jiménez-Flores, R.; García-Cano, I. Improving Human Health with Milk Fat Globule Membrane, Lactic Acid Bacteria, and Bifidobacteria. Microorganisms 2021, 9, 341. [Google Scholar] [CrossRef]
- Fontecha, J.; Brink, L.; Wu, S.; Pouliot, Y.; Visioli, F.; Jiménez-Flores, R. Sources, Production, and Clinical Treatments of Milk Fat Globule Membrane for Infant Nutrition and Well-Being. Nutrients 2020, 12, 1607. [Google Scholar] [CrossRef] [PubMed]
- Sugita, S.; Tamura, K.; Yano, M.; Minegishi, Y.; Ota, N. The Impact of Milk Fat Globule Membrane with Exercise on Age-Related Degeneration of Neuromuscular Junctions. Nutrients 2021, 13, 2310. [Google Scholar] [CrossRef] [PubMed]
- Suk, K. Lipocalin-2 as a therapeutic target for brain injury: An astrocentric perspective. Prog. Neurobiol. 2016, 144, 158–172. [Google Scholar] [CrossRef] [PubMed]
- Caraci, F.; Gulisano, W.; Guida, C.A.; Impellizzeri, A.A.; Drago, F.; Puzzo, D.; Palmeri, A. A key role for TGF-β1 in hippocampal synaptic plasticity and memory. Sci. Rep. 2015, 5, 11252. [Google Scholar] [CrossRef] [Green Version]
- He, Y.; Zhang, H.; Yung, A.; Villeda, S.A.; Jaeger, P.A.; Olayiwola, O.; Fainberg, N.; Wyss-Coray, T. ALK5-dependent TGF-β signaling is a major determinant of late-stage adult neurogenesis. Nat. Neurosci. 2014, 17, 943–952. [Google Scholar] [CrossRef] [Green Version]
- Zullo, J.M.; Drake, D.; Aron, L.; O’Hern, P.; Dhamne, S.C.; Davidsohn, N.; Mao, C.A.; Klein, W.H.; Rotenberg, A.; Bennett, D.A.; et al. Regulation of lifespan by neural excitation and REST. Nature 2019, 574, 359–364. [Google Scholar] [CrossRef]
- Tha, K.K.; Okuma, Y.; Miyazaki, H.; Murayama, T.; Uehara, T.; Hatakeyama, R.; Hayashi, Y.; Nomura, Y. Changes in expressions of proinflammatory cytokines IL-1beta, TNF-alpha and IL-6 in the brain of senescence accelerated mouse (SAM) P8. Brain Res. 2000, 885, 25–31. [Google Scholar] [CrossRef]
- Fernández, A.; Quintana, E.; Velasco, P.; Moreno-Jimenez, B.; de Andrés, B.; Gaspar, M.L.; Liste, I.; Vilar, M.; Mira, H.; Cano, E. Senescent accelerated prone 8 (SAMP8) mice as a model of age dependent neuroinflammation. J. Neuroinflamm. 2021, 18, 75. [Google Scholar] [CrossRef]
- Hook, V.; Yoon, M.; Mosier, C.; Ito, G.; Podvin, S.; Head, B.P.; Rissman, R.; O’Donoghue, A.J.; Hook, G. Cathepsin B in neurodegeneration of Alzheimer’s disease, traumatic brain injury, and related brain disorders. Biochim. Biophys. Acta (BBA)-Proteins Proteom. 2020, 1868, 140428. [Google Scholar] [CrossRef]
- Meng, J.; Liu, Y.; Xie, Z.; Qing, H.; Lei, P.; Ni, J. Nucleus distribution of cathepsin B in senescent microglia promotes brain aging through degradation of sirtuins. Neurobiol. Aging 2020, 96, 255–266. [Google Scholar] [CrossRef]
- Li, H.; Liu, Z.; Wu, Y.; Chen, Y.; Wang, J.; Wang, Z.; Huang, D.; Wang, M.; Yu, M.; Fei, J.; et al. The deficiency of NRSF/REST enhances the pro-inflammatory function of astrocytes in a model of Parkinson’s disease. Biochim. Biophys. Acta Mol. Basis Dis. 2020, 1866, 165590. [Google Scholar] [CrossRef] [PubMed]
- Shen, W.; Qi, R.; Zhang, J.; Wang, Z.; Wang, H.; Hu, C.; Zhao, Y.; Bie, M.; Wang, Y.; Fu, Y.; et al. Chlorogenic acid inhibits LPS-induced microglial activation and improves survival of dopaminergic neurons. Brain Res Bull. 2012, 88, 487–494. [Google Scholar] [CrossRef] [PubMed]
- Wang, R.P.; Ho, Y.S.; Leung, W.K.; Goto, T.; Chang, R.C. Systemic inflammation linking chronic periodontitis to cognitive decline. Brain Behav. Immun. 2019, 81, 63–73. [Google Scholar] [CrossRef] [PubMed]
- Süβ, P.; Lana, A.J.; Schlachetzki, J.C.M. Chronic peripheral inflammation: A possible contributor to neurodegenerative diseases. Neural Regen. Res. 2021, 16, 1711–1714. [Google Scholar] [CrossRef] [PubMed]
- Minciullo, P.L.; Catalano, A.; Mandraffino, G.; Casciaro, M.; Crucitti, A.; Maltese, G.; Morabito, N.; Lasco, A.; Gangemi, S.; Basile, G. Inflammaging and Anti-Inflammaging: The Role of Cytokines in Extreme Longevity. Arch. Immunol. Ther. Exp. 2016, 64, 111–126. [Google Scholar] [CrossRef]
- He, C.; Wu, Q.; Hayashi, N.; Nakano, F.; Nakatsukasa, E.; Tsuduki, T. Carbohydrate-restricted diet alters the gut microbiota, promotes senescence and shortens the life span in senescence-accelerated prone mice. J. Nutr. Biochem. 2020, 78, 108326. [Google Scholar] [CrossRef]
- Pallas, M.; Camins, A.; Smith, M.A.; Perry, G.; Lee, H.G.; Casadesus, G. From aging to Alzheimer’s disease: Unveiling “the switch” with the senescence-accelerated mouse model (SAMP8). J. Alzheimers Dis. 2008, 15, 615–624. [Google Scholar] [CrossRef]
- Zhao, Y.; Zhu, M.; Yu, Y.; Qiu, L.; Zhang, Y.; He, L.; Zhang, J. Brain REST/NRSF IS Not Only a Silent Repressor but Also an Active Protector. Mol. Neurobiol. 2017, 54, 541–550. [Google Scholar] [CrossRef]
- Wu, J.; Xie, X. Comparative sequence analysis reveals an intricate network among REST, CREB and miRNA in mediating neuronal gene expression. Genome Biol. 2006, 7, R85. [Google Scholar] [CrossRef] [Green Version]
- Keller, S.; Malarski, A.; Reuther, C.; Kertscher, R.; Kiehntopf, M.; Jahreis, G. Milk phospholipid and plant sterol-dependent modulation of plasma lipids in healthy volunteers. Eur. J. Nutr. 2013, 52, 1169–1179. [Google Scholar] [CrossRef]
- Dong-Newsom, P.; Powell, N.D.; Bailey, M.T.; Padgett, D.A.; Sheridan, J.F. Repeated social stress enhances the innate immune response to a primary HSV-1 infection in the cornea and trigeminal ganglia of Balb/c mice. Brain Behav. Immun. 2010, 24, 273–280. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Takano, S.; Uchida, K.; Miyagi, M.; Inoue, G.; Aikawa, J.; Iwabuchi, K.; Takaso, M. Adrenomedullin Regulates IL-1β Gene Expression in F4/80+ Macrophages during Synovial Inflammation. J. Immunol. Res. 2017, 2017, 9832430. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhao, Q.; Wu, X.; Yan, S.; Xie, X.; Fan, Y.; Zhang, J.; Peng, C.; You, Z. The antidepressant-like effects of pioglitazone in a chronic mild stress mouse model are associated with PPARγ-mediated alteration of microglial activation phenotypes. J. Neuroinflamm. 2016, 13, 259. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ho, M.Y.; Leu, S.J.; Sun, G.H.; Tao, M.H.; Tang, S.J.; Sun, K.H. IL-27 directly restrains lung tumorigenicity by suppressing cyclooxygenase-2-mediated activities. J. Immunol. 2009, 183, 6217–6226. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Delépine, C.; Nectoux, J.; Letourneur, F.; Baud, V.; Chelly, J.; Billuart, P.; Bienvenu, T. Astrocyte Transcriptome from the Mecp2-Truncated Mouse Model of Rett Syndrome. Neuromol. Med. 2015, 17, 353–363. [Google Scholar] [CrossRef] [PubMed]
- Rocchi, A.; Carminati, E.; De Fusco, A.; Kowalska, J.A.; Floss, T.; Benfenati, F. REST/NRSF deficiency impairs autophagy and leads to cellular senescence in neurons. Aging Cell 2021, 20, e13471. [Google Scholar] [CrossRef]
- McCourt, A.C.; Jakobsson, L.; Larsson, S.; Holm, C.; Piel, S.; Elmér, E.; Björkqvist, M. White Adipose Tissue Browning in the R6/2 Mouse Model of Huntington’s Disease. PLoS ONE 2016, 11, e0159870. [Google Scholar] [CrossRef] [Green Version]
- Lu, X.Y.; Huang, S.; Chen, Q.B.; Zhang, D.; Li, W.; Ao, R.; Leung, F.C.; Zhang, Z.; Huang, J.; Tang, Y.; et al. Metformin Ameliorates Aβ Pathology by Insulin-Degrading Enzyme in a Transgenic Mouse Model of Alzheimer’s Disease. Oxidative Med. Cell. Longev. 2020, 2020, 2315106. [Google Scholar] [CrossRef] [Green Version]
- Zhang, J.; Chen, S.R.; Chen, H.; Pan, H.L. RE1-silencing transcription factor controls the acute-to-chronic neuropathic pain transition and Chrm2 receptor gene expression in primary sensory neurons. J. Biol. Chem. 2018, 293, 19078–19091. [Google Scholar] [CrossRef] [Green Version]
- Hou, Y.; Li, G.; Wang, J.; Pan, Y.; Jiao, K.; Du, J.; Chen, R.; Wang, B.; Li, N. Okanin, effective constituent of the flower tea Coreopsis tinctoria, attenuates LPS-induced microglial activation through inhibition of the TLR4/NF-κB signaling pathways. Sci. Rep. 2017, 7, 45705. [Google Scholar] [CrossRef] [Green Version]
Group | Mice Number | Body Weight (g) | Feed Intake (g/Mouse/Day) | Average Intake of CPP and/or MFGM (mg/g Body Weight/Day) |
---|---|---|---|---|
CD | 6 | 38.9 ± 5.3 | 3.65 ± 0.27 | |
CD + M | 10 | 37.0 ± 4.9 | 3.53 ± 0.16 | 1 mg MFGM |
CD + C | 9 | 43.3 ± 6.1 | 3.98 ± 0.23 | 2 mg CPP |
CD + MC | 10 | 39.5 ± 5.1 | 4.39 ± 0.28 | 1 mg MFGM and 2 mg CCP |
Gene | Forward Sequence | Reverse Sequence | Ref. |
---|---|---|---|
TNF-α | CTGTCTACTGAACTTCGGGGTGAT | GGTCTGGGCCATAGAACTGATG | [31] |
IL-1β | GCAACTGTTCCTGAACTCAACT | ATCTTTTGGGGTCCGTCAACT | [32] |
IL-4 | CAGCTAGTTGTCATCCTGCTCTTC | GCCGATGATCTCTCTCAAGTGA | [33] |
TGF-β1 | CAAGGGCTACCATGCCAACT | GTACTGTGTGTCCAGGCTCCAA | [34] |
Lcn2 | TACAATGTCACCTCCATCCTGG | TGCACATTGTAGCTCTGTACCT | [35] |
CtsB | CTGCTGAAGACCTGCTTA | AATTGTAGACTCCACCTGAA | [36] |
CREB | GAGAGCTGGTATGTCAGGAATG | CCAGAAGAGATGCAGGAGAAAG | [37] |
BDNF | TACTTCGGTTGCATGAAGGCG | GTCAGACCTCTCGAACCTGCC | [38] |
REST | ATCGGACGCGGGTAGCGAG | GGCTGCCAGTTCAGCTTTCG | [39] |
iNOS | GGCAAACCCAAGGTCTACGTT | GAGCACGCTGAGTACCTCATTG | [40] |
β-actin | TGACAGGATGCAGAAGGAGA | GCTGGAAGGTGGACAGTGAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Unno, K.; Taguchi, K.; Hase, T.; Meguro, S.; Nakamura, Y. Coffee Polyphenol, Chlorogenic Acid, Suppresses Brain Aging and Its Effects Are Enhanced by Milk Fat Globule Membrane Components. Int. J. Mol. Sci. 2022, 23, 5832. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms23105832
Unno K, Taguchi K, Hase T, Meguro S, Nakamura Y. Coffee Polyphenol, Chlorogenic Acid, Suppresses Brain Aging and Its Effects Are Enhanced by Milk Fat Globule Membrane Components. International Journal of Molecular Sciences. 2022; 23(10):5832. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms23105832
Chicago/Turabian StyleUnno, Keiko, Kyoko Taguchi, Tadashi Hase, Shinichi Meguro, and Yoriyuki Nakamura. 2022. "Coffee Polyphenol, Chlorogenic Acid, Suppresses Brain Aging and Its Effects Are Enhanced by Milk Fat Globule Membrane Components" International Journal of Molecular Sciences 23, no. 10: 5832. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms23105832