Next Article in Journal
Advancement into the Arctic Region for Bioactive Sponge Secondary Metabolites
Next Article in Special Issue
Tetrodotoxin as a Tool to Elucidate Sensory Transduction Mechanisms: The Case for the Arterial Chemoreceptors of the Carotid Body
Previous Article in Journal
Neoamphimedine Circumvents Metnase-Enhanced DNA Topoisomerase IIα Activity Through ATP-Competitive Inhibition
Previous Article in Special Issue
Isolation and Identification of a New Tetrodotoxin-Producing Bacterial Species, Raoultella terrigena, from Hong Kong Marine Puffer Fish Takifugu niphobles
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Tetrodotoxin Sensitivity of the Vertebrate Cardiac Na+ Current

Department of Biology, University of Eastern Finland, Joensuu 80101, Finland
*
Author to whom correspondence should be addressed.
Mar. Drugs 2011, 9(11), 2409-2422; https://0-doi-org.brum.beds.ac.uk/10.3390/md9112409
Submission received: 20 September 2011 / Revised: 2 November 2011 / Accepted: 10 November 2011 / Published: 21 November 2011
(This article belongs to the Special Issue Tetrodotoxin 2011)

Abstract

:
Evolutionary origin and physiological significance of the tetrodotoxin (TTX) resistance of the vertebrate cardiac Na+ current (INa) is still unresolved. To this end, TTX sensitivity of the cardiac INa was examined in cardiac myocytes of a cyclostome (lamprey), three teleost fishes (crucian carp, burbot and rainbow trout), a clawed frog, a snake (viper) and a bird (quail). In lamprey, teleost fishes, frog and bird the cardiac INa was highly TTX-sensitive with EC50-values between 1.4 and 6.6 nmol·L−1. In the snake heart, about 80% of the INa was TTX-resistant with EC50 value of 0.65 μmol·L−1, the rest being TTX-sensitive (EC50 = 0.5 nmol·L−1). Although TTX-resistance of the cardiac INa appears to be limited to mammals and reptiles, the presence of TTX-resistant isoform of Na+ channel in the lamprey heart suggest an early evolutionary origin of the TTX-resistance, perhaps in the common ancestor of all vertebrates.

Graphical Abstract

1. Introduction

Opening of the voltage-sensitive Na+ channels (Nav) depolarizes plasma membrane and causes a rapid impulse spread in excitable cells via abrupt Na+ influx. The family of Nav1 channels consists of 9 α-subunits in mammals and 8 α-subunits in teleost fish, which arose from 4 ancestral genes of early vertebrates through individual gene duplications and whole genome duplication (3R), respectively [15]. On the basis of their affinity to guanidium compounds tetrodotoxin (TTX) and saxitoxin (STX), Nav are classified into TTX-sensitive or TTX-resistant phenotypes. In most cases, TTX-resistance is achieved by a mutation of an aromatic amino acid (tyrosine, phenylalanine, tryptophan) in the position 401 (sequence numbering as in rat Nav1.4) to serine, cysteine or asparagine [68]. However, other amino acid substitutions in various sites of the Na+ channel pore have been reported in different TTX carrying vertebrates or their predators involving several Nav1 genes [912].
Resistance to TTX has independently arisen in several vertebrate groups, probably in response to feeding on organisms that contain guanidium toxins. Although the probability of dietary exposure to TTX or STX is low in mammals, three TTX-resistant Na+ channel isoforms are expressed either in the heart (Nav1.5) or in the peripheral nervous system (Nav1.8, Nav1.9) [6,13]. Considering that selection pressure on INa via guanidium toxin exposure is absent in most mammals, physiological significance and evolutionary origin of TTX-resistance of the mammalian INa remains an enigma. It is possible that TTX-resistant isoforms are evolutionary vestiges from their predecessors, which needed them to avoid guanidium poisoning. Consistently with this hypothesis, it has been suggested that TTX-resistance of the cardiac Na+ channel appeared in early vertebrates before the divergence of fish and mammalian lineages [7]. The vertebrate cardiac Nav1.5 is assumed to be an ortholog of the ancestral TTX-resistant channel from which Nav1.8 and Nav1.9 were derived by two successive gene duplications later in tetrapod evolution [14]. While synteny of the three genes strongly suggests that Nav1.8 and Nav1.9 arose from Nav1.5 by two successive gene duplications, there is little evidence that the ancestral vertebrate gene was TTX-resistant. If Nav1.5 represents an ancestral TTX-resistant gene, INa is expected to be TTX-resistant not only in mammalian heart but also in the hearts of “lower” vertebrates, including reptiles, frogs and fishes (provided that Nav1.5 is expressed in those hearts). Several preliminary findings suggest, however, that INa of frog and fish hearts might be more sensitive to TTX than the mammalian cardiac INa [1518], although an opposite view for the fish has also been presented [7]. However, the TTX-phenotype of the vertebrate cardiac INa has, until now, remained unresolved in several major vertebrate groups.
To better understand the underlying reasons and physiological significance of the TTX-resistance of the mammalian cardiac INa, evolution of TTX-resistance of the cardiac INa needs to be known. Therefore, this study aims to examine the phenotype of cardiac INa in regard to its blocking sensitivity by TTX in three main classes of ectothermic vertebrates (fishes, frogs and reptiles). Patch-clamp method on enzymatically isolated cardiac myocytes was used for direct determination of INa sensitivity to TTX. Some molecular data is also provided about the Na+ channel composition of vertebrate hearts.

2. Results and Discussion

2.1. TTX-Sensitivity of the Vertebrate Cardiac INa

TTX sensitivity of the ventricular INa was determined in four fish species including the evolutionary old cyclostome, the lamprey (Lampetra fluviatilis), a frog (Xenopus laevis), a reptile (common European viper, Vipera berus) and a bird (quail, Coturnix coturnix). Voltage-dependence of INa was similar in all ectothermic vertebrates with the peak INa at −20~−40 mV, but the current density strongly varied between species (Figure 1). Hill slopes of the concentration-response curve were −0.95~−1.39 in the three teleost species and the frog, while the slope of the lamprey INa was shallower (−2.05) (Figure 2). The concentration-response curve of the V. berus INa was best fit by assuming two competitive binding sites. There were little differences in TTX sensitivity of INa among the fishes and the frog; in all species INa was highly sensitive to TTX with EC50-values between 1.4 (L. fluviatilis) and 6.6 nmol·L−1 (X. laevis). When these values are compared to the EC50 value of the mammalian cardiac INa (1 μmol·L−1), the INa of the ectotherms is 2–3 orders of magnitude more sensitive than the INa of the mammalian heart (Figure 3); INa of L. fluviatilis and X. laevis are 714 and 152 times more sensitive to TTX than the INa of the human heart. A clear exception among the ectothermic vertebrates is the snake, V. berus, with two apparent binding sites of INa inhibition: a high affinity inhibition with EC50 of 0.5 ± 0.2 nmol·L−1 and a low affinity inhibition with EC50 of 0.65 ± 0.03 μmol·L−1. The low affinity component constituted 80 ± 0.3% of the total INa indicating that this current system is mainly TTX-resistant in the snake heart. Thus, our analysis suggests that cardiac INa of the ectothermic vertebrates is highly TTX-sensitive in fishes (including the lamprey) and frogs, but TTX-resistant in reptiles. Interestingly, the INa of the bird (C. coturnix) heart was highly sensitive to TTX with EC50 value of 3.5 ± 0.09 nmol·L−1. Accordingly, among homeotherms, the avian heart seems to be TTX-sensitive, while the mammalian heart is TTX-resistant.
The present electrophysiological findings on TTX sensitivity of the cardiac INa are consistent with the [3H]STX binding experiments on vertebrate cardiac membranes indicating a high affinity binding (Kd = 5.1 nM) in the frog (Rana pipiens) and a low affinity binding in the turtle (Chrysemys scripta elegans) (Kd = 2.3 μM) [19]. The mammalian cardiac INa is well-known for its TTX resistance (EC50 about 1 μM) [6,20,21], while results on the TTX sensitivity of the avian cardiac INa are controversial. Indirect estimations of INa from the velocity of action potential upstroke give EC50 values for TTX of the chick heart in the range of 10–20 nM suggesting that the avian cardiac INa is TTX-sensitive [22,23]. On the other hand, [3H]TTX or [3H]STX binding experiments suggest that, similar to the mammalian cardiac Na+ channels, the chick cardiac Na+ channels have low affinity to guanidium toxins [19,24]. Our direct patch-clamp studies on the TTX sensitivity of the quail ventricular INa are consistent with the electrophysiological studies on the chick heart. Therefore, the current state of knowledge suggests that the INa of mammalian and reptilian hearts is TTX-resistant with EC50 in the micromolar range, while the INa of piscine, amphibian and avian hearts is 2–3 orders of magnitude more sensitive to TTX, i.e., in the range of 1.4–6.6 nmoles·L−1 (Figure 3).
The high TTX sensitivity of the cardiac INa in the evolutionally old cyclostome vertebrate, the three teleost species, the frog and the bird suggests that TTX resistance is largely limited to mammals and reptiles. This division of vertebrate hearts in TTX-resistant and TTX-sensitive forms might suggest that the evolution of TTX-resistance of the cardiac INa appeared some 340 million years ago in the common ancestor of the Amniote tetrapods and the trait was secondarily lost in the bird lineage. Furthermore, the present findings on TTX phenotype of the vertebrate cardiac INa are apparently inconsistent with the suggestion that TTX resistance appeared before the divergence of the fish and mammalian lineages, because INa of fish and frog hearts appears to be TTX-sensitive (but see Section 2.3).

2.2. Alpha Subunit Composition of the Cardiac Na+ Channels

The above conclusions on TTX-sensitivity/resistance are solely based on the phenotype of cardiac INa in enzymatically isolated cardiac myocytes, without taking into account the molecular basis of the INa. The high TTX-sensitivity of piscine, amphibian and avian cardiac INa raises a question about the Na+ channel composition of their hearts. TTX-resistance of the mammalian cardiac INa is due to the predominance of the TTX-resistant Na+ channel isoform, Nav1.5. To find out the molecular basis for TTX-sensitivity of the cardiac INa in ectothermic vertebrates, Na+ channel composition was examined by molecular cloning and quantitative PCR from fish and frog hearts. In addition to previously sequenced trout genes [18], partial cDNA sequences for Nav1.4 and Nav1.5 were cloned from burbot (658 bp and 662 bp, respectively), crucian carp (592 and 668 bp), lamprey (1797 and 2082 bp) and frog (749 and 656 bp). Additionally, partial sequences of putative Nav1.1 (2262 bp) and Nav1.6 (644 bp) channels were cloned from the lamprey. Surprisingly, in the Xenopus heart Nav1.5 was almost an exclusive alpha subunit isoform constituting over 99% the ventricular transcripts (Figure 4). Similarly, in crucian carp Nav1.5 formed 82% of the cardiac Na+ channel transcripts, the rest being represented by Nav1.4. Thus, in spite of the high TTX-sensitivity of the INa, the predominant cardiac isoform in these ectotherms was Nav1.5. Interestingly, in burbot and rainbow trout ventricles Nav1.4 was clearly the dominant isoform forming 67% and 72% of the ventricular transcripts, respectively (Nav1.5 represented only 32% and 28% of the transcripts). Isoform composition of the lamprey heart was clearly different from those of other ectotherms. Nav1.1 seemed to be the most abundant isoform at the transcript level (45%), followed by Nav1.4 (33%), Nav1.5 (13%) and Nav1.6 (9%). These comparisons show that alpha subunit composition of the cardiac Na+ channel is variable among ectothermic vertebrates with the predominance of Nav1.4 and Nav1.5 isoforms in other ectotherms except the lamprey.
In mammals, the low TTX sensitivity of the cardiac INa is based on almost exclusive expression of the Nav1.5 in the heart; over 90% of the mammalian cardiac Na+ channels are Nav1.5, with the exception of mouse heart (70%) [25]. It is noteworthy is that the TTX resistance/sensitivity of the piscine and amphibian INa is not tightly associated with any particular Na+ channel isoform. Even though Nav1.5 is the main Na+ channel isoform (>80%) in the hearts of crucian carp and Xenopus, the cardiac INa is highly sensitive to TTX in both species. In burbot and trout, Nav1.4 forms about 80% of the cardiac Na+ channels transcripts and, as expected on the basis of high TTX sensitivity of this isoform in mammals, the cardiac INa in both fish species is highly TTX-sensitive. The TTX-sensitive INa of the lamprey heart is based on expression of four different Na+ channels. Sequence comparisons tentatively suggest that these channels are orthologs to Nav1.1, Nav1.4, Nav1.5 and Nav1.6 of the higher vertebrates. This may signify that lamprey heart expresses all four Na+ channels of the “basal” vertebrate which appeared after the two rounds of whole genome duplication (2R) [26,27].

2.3. Amino Acid Sequence of the TTX Binding Site in Domain I

That the phenotype of the cardiac INa in several ectothermic vertebrates is highly TTX-sensitive irrespective of the Na+ channel isoform raises a question about the amino acid composition of the TTX binding site, in particular in the position 401 of the Nav1.5. Consistent with the TTX-sensitive electrophysiological phenotype, Nav1.5 of the frog and three teleost fish species (crucian carp, burbot, trout) had an aromatic amino acid (tyrosine) in the position of 401 probably rendering the channel highly sensitive to TTX (Figure 5). The same applies also to the Nav1.5 of the zebra fish, contrary to the suggestion of Soong and Venkatesh [7]. Interestingly, the putative Nav1.5 ortholog of the lamprey had a non-aromatic amino acid (serine) in this position, which is known to confer TTX-resistance to the INa. While the low expression level (13%) of the Nav1.5 may explain why INa in the lamprey heart is TTX-sensitive, the presence of serine in the critical position of the lamprey Nav1.5 violates the assumption that TTX-resistant Na+ channel first appeared in the common ancestor of the amniote vertebrates (see Section 2.1). Isoform composition and TTX binding site was not examined from the snake and the quail hearts. However, the aromatic amino acid (tyrosine) in the position 401 of the chicken (Gallus gallus) Nav1.5 is completely in line with the TTX-sensitivity of the bird cardiac INa. In contrast, Y401 of the Nav1.5 in green anole (Anolis carolinensis) contradicts the finding that large portion of the cardiac INa of the snake heart is TTX-resistant [4]. The presence of TTX-sensitive and TTX-resistant components in the cardiac INa of the snake heart may suggest that there exists variability in TTX-sensitivity of INa among different reptilian lineages. Therefore, more reptilian species including representatives of snakes, lizards, turtles, crocodiles and birds should be examined in regard to cardiac Na+ channel composition and their TTX-sensitivity.

3. Conclusions

The present electrophysiological findings suggest that the cardiac phenotype of INa is TTX-sensitive in fishes, frogs and birds, and TTX-resistant in mammals and at least in some reptiles. Furthermore, it appears that the expression of Nav1.5 as the major cardiac Na+ channel does not automatically mean a TTX-resistant INa phenotype: in fishes, frogs and birds Nav1.5 has an aromatic amino acid in the position 401 and therefore the cardiac INa is highly sensitive to TTX.
The presence of S401 in the Nav1.5 ortholog of the lamprey is consistent with the hypothesis that TTX-resistance appeared early in the vertebrate evolution, possibly in the common ancestor of all vertebrates (Figure 6) [3]. The wide-spread occurrence of the TTX-sensitive isoform of Nav1.5 in fishes, frogs and birds suggests a later mutation of the channel, possibly due to functional requirements, turned the current TTX-sensitive. The reason why the mammalian heart and at least some reptile hearts express TTX-resistant INa, while one of the amniote groups (birds) has a TTX-sensitive isoform still remains open. TTX-resistance of the cardiac INa in mammals and most reptiles is unlikely to be a defense mechanism against poisonous dietary items, since the whole-organism resistance to TTX requires that all members of the entire Na+ channel family have developed resistance to the toxin [28]. In mammals, only three members (Nav1.5, Nav1.8 and Nav1.9) of the Nav1 family are TTX-resistant. Therefore, it is more likely that the TTX-resistance of the cardiac Nav1.5 channel (and its paralogs) is a byproduct from a completely different selection pressure that resulted in mutation of the amino acid residue 401 of the domain I. In this scheme the whole-body resistance to TTX in pufferfishes (family Tetraodontidae), a goby fish (Yongeichthys criniger), a few amphibians and a garter snake (Thamnopsis sirtalis) appears as exceptions among the vertebrate animals [29,30]. These species accumulate TTX as a biologic defense agent against predators or as predators to prevent TTX intoxication from ingestion of TTX-bearing prey. A more detailed characterization of the cardiac INa phenotype and its molecular basis in different vertebrate groups is needed for deeper understanding of the evolution of cardiac INa. Functional comparison of TTX-sensitive and TTX-resistant isoforms of bird and mammalian Nav1.5, respectively, might shed new light into this issue.

4. Experimental Section

4.1. Animals

Four fish, one frog, one reptile and one bird species were included in the experiments. River lamprey (Lampetra fluviatilis L.; Cephalaspidomorphi; body mass 43 ± 7 g, n = 10), crucian carp (Carassius carassius L.; Osteichthyes; 48 ± 8 g, n = 10) and burbot (Lota lota L.; Osteichthyes; 226 ± 17 g, n = 9) were caught from the wild and acclimated in the laboratory at +4 °C for a minimum of 4 weeks before experiments. Rainbow trout (Oncorhynchus mykiss, Walbaum; Osteichthyes; 249 ± 20 g, n = 12) were obtained from a local fish farm and were also acclimated in the lab at +4 °C. Different fish species were maintained separately in 500-L stainless steel tanks with a continuous supply of aerated groundwater under a 12 h:12 h light:dark photoperiod. During that time the fish were fed commercial trout food (Biomar, Brande, Denmark) to satiation five times a week. Clawed frog (Xenopus laevis, Daudin; Amphibia; 32 ± 5 g, n = 8) were from the stock maintained and reproduced in our lab. Frogs were reared in 100-L aquaria at 20 ± 1 °C and fed ad libitum commercial frog food (Frog Brittle, Nasco, Fort Atkinson, WI, USA) every other day. Lighting of the aquaria was supplied by fluorescent lamps with a photoperiod of 12 h:12 h light:dark. A common European viper (Vipera berus L.; Reptilia; 440 g, n = 1) was caught from the wild in August and maintained in a glass terrarium at room temperature (20 °C). One quail (Coturnix coturnix; 382 g, n = 1) was used in patch-clamp studies. All experiments were conducted with the consent of the national committee for animal experimentation (permission STH252A).

4.2. Patch-Clamp Recording of INa

Experiments were conducted on enzymatically isolated ventricular myocytes. Cardiac myocytes were isolated by retrograde perfusion of the heart with a trypsin and collagenase containing solution as described earlier [17]. Myocytes were used within 8 hours from isolation. A small aliquot of myocyte suspension was transferred to a recording chamber (RC-26, Warner Instrument Corp, Brunswick USA; volume 150 μL) and superfused with external saline solutions at the rate of 1.5–2.0 mL·min−1. Initially, the myocytes were superfused with normal K+-based saline (containing in mmol·L−1: 150 NaCl, 5.4 KCl, 1.8 CaCl2, 1.2 MgCl2, 10 glucose, 10 HEPES, 0.01 nifedipine, pH adjusted to 7.7 with NaOH) where gigaseal and whole-cell patch clamp mode of recording were established. Internal perfusion of the myocytes with pipette solution (containing in mmol·L−1: 5 NaCl, 130 CsCl, 1 MgCl2, 5 EGTA, 5 Mg2ATP, 5 HEPES, pH adjusted to 7.2 with CsOH) was continued in this external saline solution for about 3 min to allow buffering of intracellular Ca2+ with 5 mM EGTA. Then, the solution flow was switched to a low-Na+ external solution (containing in mmol·L−1: 20 NaCl, 120 CsCl, 1 MgCl2, 0.5 CaCl2, 10 glucose, 10 HEPES, 0.01 nifedipine, pH adjusted to 7.7 with CsOH) to reduce driving force for Na+ influx and improve reliable recording of INa [31]. Low external Na+ concentration (20 mM), low experimental temperature (4–22 °C) and relatively small size of the myocytes (17–94 pF) rendered INa small (<2 nA) enough for a good voltage control. To ensure undistorted recordings a minimum of 80% series resistance compensation (9.09 ± 0.56 MΩ before compensation, n = 82) was routinely applied. INa was recorded at the sampling rate of 10 kHz and the traces were low-pass filtered at 5 kHz. The calculated liquid-junction potential of the electrodes was about 1.5 mV which was not corrected in the results.
Concentration-dependence of INa inhibition was determined by exposing myocytes to cumulatively increasing concentrations of TTX (10−10–10−7 M; TTX citrate from Tocris Cookson). Cells were exposed to each TTX concentration for 5 min to reach a steady-state inhibition of peak INa, elicited by a depolarizing pulse from −120 mV to −20 mV for every 5th second. Concentration-response curves were fitted with an equation for one binding site:
I = I min + I max - I min 1 + 10 ( log EC 50 - C ) × H
or in the case of the snake INa with an equation for two competitive binding sites using SigmaPlot 11.0 software.
I = I min + ( I max - I min ) × ( F 1 1 + 10 ( C - log EC 50 1 ) + 1 - F 1 1 + 10 ( C - log EC 50 2 ) )
Imin is the residual INa at the highest TTX concentration, Imax the maximum INa before drug addition, EC50 (or EC50(1) and EC50(2) for V. berus) is the drug concentration which causes half-maximal inhibition of INa on its binding site, C the molar concentration of TTX, and H the Hill slope factor. Only myocytes for which a complete dose-response curve for TTX was obtained are included in the results.

4.3. Cloning of TTX Binding Area of Cardiac Na+ Channels

Heart was quickly excised and immediately frozen in liquid nitrogen. Total RNA was extracted with Trizol Reagent (Invitrogen, Carlsbad, USA) according to manufacturer’s instructions. RNA was qualified by gel electrophoresis and quantified by UV spectrophotometer. First-strand cDNA was prepared from the total cardiac RNA treated with RQ1 RNase-Free DNase (Promega, Madison, Wisconsin, USA). Reverse transcription was performed by M-MuLV Reverse Transcriptase RNase H+ (Finnzymes, Espoo, Finland) using random hexamers. Partial cDNAs corresponding to NaV1.4a, NaV1.5a and NaV1.6a were obtained by PCR using degenerative primers, designed to the conserved regions of corresponding mammalian and fish genes (Table 1). PCR was performed in a 25 μL reaction mixture containing 50 mM Tris·HCl, 1.5 mM MgCl2, 15 mM (NH4)2SO4, 0.1% Triton X-100, 200 μM of each dNTP, 1 U DyNAzyme EXT (Finnzymes), 2 μL cDNA and 5 pmol each primer. Amplification was performed in PCR conditions: initial denaturation at 94 °C for 2 min followed by 1–4 cycles with low annealing temperature at 94 °C for 30 s, 40 °C for 30 s and 72 °C for 90 s further followed by 31 cycles with higher annealing temperature at 55 °C and final extension at 72 °C for 5 min. PCR products were checked on a 0.8% agarose gel and if no products were obtained, 0.5 μL of the PCR product was reamplified using PCR conditions: initial denaturation at 96 °C for 2 min followed by 35 cycles at 95 °C for 30 s, 55 °C for 30 s and at 72 °C for 90 s, and final extension at 72 °C for 5 min. New primers were designed on the basis of the sequences obtained (Table 1).
After amplification, all PCR products were analyzed by gel electrophoresis, extracted from gel by Qiaex II gel extraction kit (QIAGEN, Valencia, California, USA), cloned into the pGEM-T Easy Vector (Promega) and sequenced by ABI Prism 310 Genetic Analyzer (Applied Biosystems, Foster City, California, USA). The partial Na+ channel sequences were assembled and analyzed using AutoAssembler software. Transeq software was used to convert the cDNA sequences into amino acid sequences.

4.4. Quantitative RT-PCR

Quantitative PCR was performed with DyNAmo HS SYBR Green qPCR Kit (Finnzymes) and Chromo4 Continuous Fluorescence Detector (MJ Research, Waltham, Massachusetts, USA) using primer pairs listed in Table 2. Primers for each Na+ channel gene were designed on the basis of the cloned sequences using Primer3-software ( http://frodo.wi.mit.edu/primer3/) with options of 95–105 bp for product length and 57 °C for Tm. Specificity of each primer pair was checked using the plasmid DNA of the respective channel clone as template in RT PCR and with the melting curve analysis. The efficiency of the reaction was regarded acceptable if it was in the range of 3.2–3.6. A sample of total RNA (2 μg), extracted from ventricular tissue, was treated with RQ1 RNase-Free DNase (Promega), and the first strand cDNA synthesis was performed with random hexamers and M-MuLV RNase H+ (Finnzymes) at 25 °C for 10 min, at 37 °C for 30 min and at 85 °C for 5 min. Controls, in the absence of RT, were accomplished for each sample to determine possible DNA contamination. Polymerase was activated at 94 °C for 15 min and amplification was performed for 40 cycles at 94 °C for 10 s, 57 °C for 20 s and 72 °C for 30 s. After PCR, specificity of the reaction was checked by melting curve analysis. Two controls, one containing all the reaction components except the template and the other one containing the product of cDNA synthesis but without RT enzyme, was included in every experiment. DnaJA2 was used as a reference gene [32].

Acknowledgments

Anita Kervinen is appreciated for skillful technical assistance. This research was supported by grants from The Academy of Finland (grant number 127192) to MV.

References

  1. Lopreato, G.F.; Lu, Y.; Southwell, A.; Atkinson, N.S.; Hillis, D.M.; Wilcox, T.P.; Zakon, H.H. Evolution and divergence of sodium channel genes in vertebrates. Proc. Natl. Acad. Sci. USA 2001, 98, 7588–7592. [Google Scholar]
  2. Novak, A.E.; Jost, M.C.; Lu, Y.; Taylor, A.D.; Zakon, H.H.; Ribera, A.B. Gene dublications and evolution of vertebrate voltage-gated sodium channels. J. Mol. Evol 2006, 63, 208–221. [Google Scholar]
  3. Widmark, J.; Sundström, G.; Ocampo Daza, D.; Larhammar, D. Differential evolution of voltage-gated sodium channels in tetrapods and teleost Fishes. Mol. Biol. Evol 2011, 28, 859–871. [Google Scholar]
  4. Zakon, H.H.; Jost, M.C.; Lu, Y. Expansion of voltage-dependent Na+ channel gene family in early tetrapods coincided with the emergence of terrestriality and increased brain complexity. Mol. Biol. Evol 2011, 28, 1415–1424. [Google Scholar]
  5. Plummer, N.W.; Meisler, M.H. Evolution and diversity of mammalian sodium channel genes. Genomics 1999, 57, 323–331. [Google Scholar]
  6. Satin, J.; Kyle, J.W.; Chen, M.; Bell, P.; Cribbs, L.L.; Fozzard, H.A.; Rogart, R.B. A mutant of TTX-resistant cardiac sodium channels with TTX-sensitive properties. Science 1992, 256, 1202–1205. [Google Scholar]
  7. Soong, T.W.; Venkatesh, B. Adaptive evolution of tetrodotoxin resistance in animals. Trends Genet 2006, 22, 621–626. [Google Scholar]
  8. Leffler, A.; Herzog, R.; Dib-Hajj, S.; Waxman, S.; Cummins, T. Pharmacological properties of neuronal TTX-resistant sodium channels and the role of a critical serine pore residue. Pflugers Arch 2005, 451, 454–463. [Google Scholar]
  9. Kaneko, Y.; Matsumoto, G.; Hanyu, Y. TTX resistivity of Na+ channel in newt retinal neuron. Biochem. Biophys. Res. Commun 1997, 240, 651–656. [Google Scholar]
  10. Yotsu-Yamashita, M.; Nishimoto, K.; Nitanai, Y.; Isemura, M.; Sugimoto, A.; Yasumoto, T. Binding properties of 3H-PbTx-3 and 3H-saxitoxin to brain membranes and to skeletal muscle membranes of pufferfish Fugu pardalis and the primary structure of a voltage-gated Na+ channel alpha-subunit (fMNa1) from skeletal muscle of F. pardalis. Biochem. Biophys. Res. Commun 2000, 267, 403–412. [Google Scholar]
  11. Geffeney, S.; Brodie, E.D.; Ruben, P.C.; Brodie, E.D. Mechanisms of adaptation in a predator-prey arms race: TTX-resistant sodium channels. Science 2002, 297, 1336–1339. [Google Scholar]
  12. Jost, M.C.; Hillis, D.M.; Lu, Y.; Kyle, J.W.; Fozzard, H.A.; Zakon, H.H. Toxin-resistant sodium channels: parallel adaptive evolution across a complete gene family. Mol. Biol. Evol 2008, 25, 1016–1024. [Google Scholar]
  13. Sivilotti, L.; Okuse, K.; Akopian, A.N.; Moss, S.; Wood, J.N. A single serine residue confers tetrodotoxin insensitivity on the rat sensory-neuron-specific sodium channel SNS. FEBS Lett 1997, 409, 49–52. [Google Scholar]
  14. Dib-Hajj, S.D.; Tyrrell, L.; Escayg, A.; Wood, P.M.; Meisler, M.H.; Waxman, S.G. Coding sequence, genomic organization, and conserved chromosomal localization of the mouse gene Scn11a encoding the sodium channel NaN. Genomics 1999, 59, 309–318. [Google Scholar]
  15. Tarr, M.; Trank, J.W. An assessment of the double sucrose-gap voltage clamp technique as applied to frog atrial muscle. Biophys. J 1974, 14, 627–643. [Google Scholar]
  16. Yamaoka, K. Does the maximum upstroke velocity of the action potential (Vmax) represent available sodium conductance in frog ventricular cells? Jpn. J. Physiol 1987, 37, 585–599. [Google Scholar]
  17. Vornanen, M. Sarcolemmal Ca influx through L-type Ca channels in ventricular myocytes of a teleost fish. Am. J. Physiol 1997, 272, R1432–R1440. [Google Scholar]
  18. Haverinen, J.; Hassinen, M.; Vornanen, M. Fish cardiac sodium channels are tetrodotoxin sensitive. Acta Physiol 2007, 191, 197–204. [Google Scholar]
  19. Tanaka, J.C.; Doyle, D.D.; Barr, L. Sodium channels in vertebrate hearts. Three types of saxitoxin binding sites in heart. Bioch. Biophys. Acta 1984, 775, 203–214. [Google Scholar]
  20. Baer, M.; Best, P.M.; Reuter, H. Voltage-dependent action of tetrodotoxin in mammalian cardiac muscle. Nature 1976, 263, 344–345. [Google Scholar]
  21. Cohen, C.J.; Bean, B.P.; Colatsky, T.J.; Tsien, R.W. Teterodotoxin block of sodium channels in rabbit Purkinje fibers. J. Gen. Physiol 1981, 78, 383–411. [Google Scholar]
  22. Iijima, T.; Pappano, A.J. Ontogenetic increase of the maximal rate of rise of the chick embryonic heart action potential. Relationship to voltage, time, and tetrodotoxin. Circ. Res 1979, 44, 358–367. [Google Scholar]
  23. Marcus, N.C.; Fozzard, H. Tetrodotoxin sensitivity in the developing and adult chick heart. J. Mol. Cell. Cardiol 1981, 13, 335–340. [Google Scholar]
  24. Rogart, R.B.; Regan, L.J.; Dziekan, L.C.; Galper, J.B. Identification of two sodium channel subtypes in chick heart and brain. Proc. Natl. Acad. Sci. USA 1983, 80, 1106–1110. [Google Scholar]
  25. Blechschmidt, S.; Haufe, V.; Benndorf, K.; Zimmer, T. Voltage-gated Na+ channel transcript patterns in the mammalian heart are species-dependent. Prog. Biophys. Mol. Biol 2008, 98, 309–318. [Google Scholar]
  26. Sidow, A. Gen(om)e duplications in the evolution of early vertebrates. Curr. Opin. Genet. Dev 1996, 6, 715–722. [Google Scholar]
  27. Kuraku, S.; Meyer, A.; Kuratani, S. Timing of Genome Duplications Relative to the Origin of the Vertebrates: Did Cyclostomes Diverge before or after? Mol. Biol. Evol 2009, 26, 47–59. [Google Scholar]
  28. Zakon, H.H.; Jost, M.C.; Zwickl, D.J.; Lu, Y.; Hillis, D.M. Molecular evolution of Na+ channels in teleost fishes. Integrative Zoology 2009, 4, 64–74. [Google Scholar]
  29. Noguchi, T.; Arakawa, O. Tetrodotoxin—Distribution and accumulation in aquatic organisms, and cases of human intoxication. Mar. Drugs 2008, 6, 220–242. [Google Scholar]
  30. Brodie, E.D.I.; Brodie, E.D.J. Tetrodotoxin resistance in garter snakes: an evolutionary response of pradator to dangerous prey. Evolution 1990, 44, 651–659. [Google Scholar]
  31. Haverinen, J.; Vornanen, M. Temperature acclimation modifies Na+ current in fish cardiac myocytes. J. Exp. Biol 2004, 207, 2823–2833. [Google Scholar]
  32. Hassinen, M.; Paajanen, V.; Haverinen, J.; Eronen, H.; Vornanen, M. Cloning and expression of cardiac Kir2.1 and Kir2.2 channels in thermally acclimated rainbow trout. Am. J. Physiol 2007, 292, R2328–R2339. [Google Scholar]
Figure 1. Density and voltage-dependence of cardiac INa in ventricular myocytes of 7 vertebrate species (Lampetra fluviatilis, Carassius carassius, Lota lota, Oncorhynchus mykiss, Xenopus laevis, Vipera berus and Coturnix coturnix). Experiments were conducted at 4 °C for the fish species and at 22 °C for the clawed frog (X. laevis), the European common viper (V. berus) and the quail (Coturnix coturnix). The results are means ± SEM of 5–15 myocytes from 3–8 animals for other species except for V. berus and C. coturnix (one animal).
Figure 1. Density and voltage-dependence of cardiac INa in ventricular myocytes of 7 vertebrate species (Lampetra fluviatilis, Carassius carassius, Lota lota, Oncorhynchus mykiss, Xenopus laevis, Vipera berus and Coturnix coturnix). Experiments were conducted at 4 °C for the fish species and at 22 °C for the clawed frog (X. laevis), the European common viper (V. berus) and the quail (Coturnix coturnix). The results are means ± SEM of 5–15 myocytes from 3–8 animals for other species except for V. berus and C. coturnix (one animal).
Marinedrugs 09 02409f1
Figure 2. Concentration-response curves of TTX inhibition of the cardiac INa in ventricular myocytes of 7 vertebrate species (Lampetra fluviatilis, Carassius carassius, Lota lota, Oncorhynchus mykiss, Xenopus laevis, Vipera berus and Coturnic coturnix). Concentration for half-maximal inhibition of INa (EC50 in nmol·L−1) and Hill slope factor are also shown for each curve. The results are means ± SEM of 5–12 myocytes 3–8 animals for other species except for V. berus and C. coturnix (one animal). Note the different x-axis scale for Vipera berus.
Figure 2. Concentration-response curves of TTX inhibition of the cardiac INa in ventricular myocytes of 7 vertebrate species (Lampetra fluviatilis, Carassius carassius, Lota lota, Oncorhynchus mykiss, Xenopus laevis, Vipera berus and Coturnic coturnix). Concentration for half-maximal inhibition of INa (EC50 in nmol·L−1) and Hill slope factor are also shown for each curve. The results are means ± SEM of 5–12 myocytes 3–8 animals for other species except for V. berus and C. coturnix (one animal). Note the different x-axis scale for Vipera berus.
Marinedrugs 09 02409f2
Figure 3. Comparison of TTX sensitivity of cardiac INa in 7 vertebrate animals (Lampetra fluviatilis, Carassius carassius, Lota lota, Oncorhynchus mykiss, Xenopus laevis, Vipera berus and Coturnix coturnix) as concentration-response curves. The data for the human cardiac INa are from [6].
Figure 3. Comparison of TTX sensitivity of cardiac INa in 7 vertebrate animals (Lampetra fluviatilis, Carassius carassius, Lota lota, Oncorhynchus mykiss, Xenopus laevis, Vipera berus and Coturnix coturnix) as concentration-response curves. The data for the human cardiac INa are from [6].
Marinedrugs 09 02409f3
Figure 4. Expression pattern of Na+ channel isoforms in the heart of 5 vertebrate species (Lampetra fluviatilis, Carassius carassius, Lota lota, Oncorhynchus mykiss and Xenopus laevis). Relative transcript expression of different Na+ channel isoforms are shown as means ± SEM (n = 2–5 animals).
Figure 4. Expression pattern of Na+ channel isoforms in the heart of 5 vertebrate species (Lampetra fluviatilis, Carassius carassius, Lota lota, Oncorhynchus mykiss and Xenopus laevis). Relative transcript expression of different Na+ channel isoforms are shown as means ± SEM (n = 2–5 animals).
Marinedrugs 09 02409f4
Figure 5. Sequence alignment of the TTX binding site in the pore loop region between S5 and S6 of the domain I in Na+ channel isoforms Nav1.4 and Nav1.5 from Lampetra fluviatilis (lf), Carassius carassius (cc), Lota lota (ll), Oncorhynchus mykiss (om), Danio rerio (dr, ABB29445 for Nav1.4a and ABB29446 for Nav1.4b), Tagifugu rubribes (tr, ABB29441 for Nav1.4a and ABB29442 for Nav1.4b), Xenopus laevis (xl), Anolis carolinens (ac, BK007956 for Nav1.4 and BK007957 for Nav1.5), Gallus gallus (gg, BK007949 for Nav1.4 and XM_418535 for Nav1.5) and human (h, NP_000325). The critical amino residues for TTX-sensitivity in the position 401 (sequence numbering as in the rat isoform Nav1.4) are shown in bold red.
Figure 5. Sequence alignment of the TTX binding site in the pore loop region between S5 and S6 of the domain I in Na+ channel isoforms Nav1.4 and Nav1.5 from Lampetra fluviatilis (lf), Carassius carassius (cc), Lota lota (ll), Oncorhynchus mykiss (om), Danio rerio (dr, ABB29445 for Nav1.4a and ABB29446 for Nav1.4b), Tagifugu rubribes (tr, ABB29441 for Nav1.4a and ABB29442 for Nav1.4b), Xenopus laevis (xl), Anolis carolinens (ac, BK007956 for Nav1.4 and BK007957 for Nav1.5), Gallus gallus (gg, BK007949 for Nav1.4 and XM_418535 for Nav1.5) and human (h, NP_000325). The critical amino residues for TTX-sensitivity in the position 401 (sequence numbering as in the rat isoform Nav1.4) are shown in bold red.
Marinedrugs 09 02409f5
Figure 6. A scheme showing putative evolutionary origin for TTX resistance of cardiac INa in vertebrate animals. The scheme is based on patch-clamp analysis of cardiac INa in isolated cardiac myocytes. The presence of TTX-sensitive (green) or TTX-resistant (red) forms of the major cardiac Na+ channel alpha subunits, Nav1.4 and Nav1.5, are indicated. Na+ channel is assumed to be TTX-sensitive if there is an aromatic amino acid (tyrosine, phenylalanine, tryptophan) in the site 401.
Figure 6. A scheme showing putative evolutionary origin for TTX resistance of cardiac INa in vertebrate animals. The scheme is based on patch-clamp analysis of cardiac INa in isolated cardiac myocytes. The presence of TTX-sensitive (green) or TTX-resistant (red) forms of the major cardiac Na+ channel alpha subunits, Nav1.4 and Nav1.5, are indicated. Na+ channel is assumed to be TTX-sensitive if there is an aromatic amino acid (tyrosine, phenylalanine, tryptophan) in the site 401.
Marinedrugs 09 02409f6
Table 1. Primers used for the cloning of SCN genes from different species.
Table 1. Primers used for the cloning of SCN genes from different species.
Target GenePrimers for the First PCRPrimers for the Second PCR
ccSCN4AF: ATGGCDMSCATKCTCCCTCC
R: GCCATGGCNACCACVGCSAGGAT
F: ATGGCDMSCATKCTCCCTCC
R: AGGTAGAARGAVCCCAGRAAKATGA
ccSCN5AF: TCCTHCGRGACCCVTGGAAYTGGCT
R: GCCATGGCNACCACVGCSAGGAT
F: TTCCTHCGRGACCCVTGGAAYTGGCT
R: AGGTAGAARGAVCCCAGRAAKATGA
lfSCN1A,4A,5A,8AF: TCCTHCGRGACCCVTGGAAYTGGCT
R: GCCATGGCNACCACVGCSAGGAT
F: TTCCTHCGRGACCCVTGGAAYTGGCT
R: AGGTAGAARGAVCCCAGRAAKATGA
lfSCN4AF: TGCTTGTCATCGCATGTTTT
R: CCACATGGTCTCGATCCACT
F: TCATGACSCARGACTMCTGG
R: CCACATGGTCTCGATCCACT
lfSCN5AF: CCTTAAAACGTTCCGAGTGC
R: CCACATGGTCTCGATCCACT
F: TCATGACSCARGACTMCTGG
R: CCACATGGTCTCGATCCACT
llSCN4A
llSCN5A
F: TCCTHCGRGACCCVTGGAAYTGGCT
R: GCCATGGCNACCACVGCSAGGAT
F: TTCCTHCGRGACCCVTGGAAYTGGCT
R: AGGTAGAARGAVCCCAGRAAKATGA
xlSCN4A
xlSCN5A
F: TCCTHCGRGACCCVTGGAAYTGGCT
R: GCCATGGCNACCACVGCSAGGAT
F: TTCCTHCGRGACCCVTGGAAYTGGCT
R: AGGTAGAARGAVCCCAGRAAKATGA
Table 2. Primers used for quantitative PCR.
Table 2. Primers used for quantitative PCR.
Target GenePrimer SequencesAmplicon Size (bp)
ccSCN4AF: CAACAGTGATAACCTGACCA
R: GGTTCGCTGGGTTTTCAATA
102
ccSCN5AF: CCTTCAGACAACAGCAGCAC
R: CTTGGCTCCTTCCACTTTGA
105
ccDnaJA2F: GGACTTGTACGACCGTTATGG
R:CGCCAAAGATATGGGAAAAGAT
93
lfSCN1AF: AGTTCAACGAGACCGTCGAG
R: CCACACAGGAGAGCATCCTT
100
lfSCN4AF: TGCTTGTCATCGCATGTTTT
R: CCACGGAAATGGTTTTCAAC
98
lfSCN5AF: CCTTAAAACGTTCCGAGTGC
R: GAGCTTTTTCACCGACTGGA
99
lfSCN8AF: CGCTACCAAACGTCTCGTTC
R: CCCTTGACTTCCCAGACGTA
103
lfDnaJA2F: AGCCCCATGGACATATTTGA
R: GCCCACAGACAACTGGTGTA
96
llSCN4AF: AACGACAGCCTTGGTGATGT
R: TCTGGCCGTTTCGGTAGTAG
103
llSCN5AF: AACGCCTCCTTCTACTGCAA
R: AACGCATCCTTGGCTCCTT
101
llDnaJA2F: CCCGAGAAGAAGGAGCTGTA
R: CCGAAGATGTGGGAGAAGAT
101
omSCN4AF: CAGCAACAGTACGTGGGACT
R: CAGAAGCGTTTCCACAGAGA
101
omSCN5AF: ACACCCTCAACACCAACACA
R: CGCTCCCTCCACTTTGTAGT
104
omSCN8AF: GGAGCTCCATGAACGACTTC
R: CTTCCCTGCATCTTGTCCAT
101
omDnaJA2F: TTGTAATGGAGAAGGTGAGG
R: TGGGCCGCTCTCTTGTATGT
233
xlSCN4AF: CAACAGTACCTTAAACGCCACA
R: TAGGCATCCCAGTCAATGGT
105
xlSCN5AF: ATTTCAATGCGACCCAGATG
R: CCGTCCTTGTGGTAGATGTT
106
xlDnaJA2F: GTCGCAATGGGAGAAGAAGA
R: CTTGCTGAGCTGAAGTTTGG
101

Share and Cite

MDPI and ACS Style

Vornanen, M.; Hassinen, M.; Haverinen, J. Tetrodotoxin Sensitivity of the Vertebrate Cardiac Na+ Current. Mar. Drugs 2011, 9, 2409-2422. https://0-doi-org.brum.beds.ac.uk/10.3390/md9112409

AMA Style

Vornanen M, Hassinen M, Haverinen J. Tetrodotoxin Sensitivity of the Vertebrate Cardiac Na+ Current. Marine Drugs. 2011; 9(11):2409-2422. https://0-doi-org.brum.beds.ac.uk/10.3390/md9112409

Chicago/Turabian Style

Vornanen, Matti, Minna Hassinen, and Jaakko Haverinen. 2011. "Tetrodotoxin Sensitivity of the Vertebrate Cardiac Na+ Current" Marine Drugs 9, no. 11: 2409-2422. https://0-doi-org.brum.beds.ac.uk/10.3390/md9112409

Article Metrics

Back to TopTop