Construction and Immunogenicity of Virus-Like Particles of Feline Parvovirus from the Tiger
Abstract
:Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Stuetzer, B.; Hartmann, K. Feline parvovirus infection and associated diseases. Vet. J. 2014, 201, 150–155. [Google Scholar] [CrossRef] [PubMed]
- Awad, R.A.; Khalil, W.K.B.; Attallah, A.G. Epidemiology and diagnosis of feline panleukopenia virus in Egypt: Clinical and molecular diagnosis in cats. Vet. World 2018, 11, 578–584. [Google Scholar] [CrossRef] [PubMed]
- Steinel, A.; Munson, L.; van Vuuren, M.; Truyen, U. Genetic characterization of feline parvovirus sequences from various carnivores. J. Gen. Virol. 2000, 81, 345–350. [Google Scholar] [CrossRef] [PubMed]
- Steinel, A.; Parrish, C.R.; Bloom, M.E.; Truyen, U. Parvovirus infections in wild carnivores. J. Wildl. Dis. 2001, 37, 594–607. [Google Scholar] [CrossRef] [PubMed]
- Yang, S.T.; Wang, S.J.; Feng, H.; Zeng, L.; Xia, Z.P.; Zhang, R.Z.; Zou, X.H.; Wang, C.Y.; Liu, Q.; Xia, X.Z. Isolation and characterization of feline panleukopenia virus from a diarrheic monkey. Vet. Microbiol. 2010, 143, 155–159. [Google Scholar] [CrossRef]
- Pfankuche, V.M.; Jo, W.K.; de Van, V.E.; Jungwirth, N.; Lorenzen, S.; Adme, O.; Baumgã Rtner, W.; Puff, C. Neuronal Vacuolization in Feline Panleukopenia Virus Infection. Vet. Pathol. 2018, 55, 294–297. [Google Scholar] [CrossRef]
- Wang, X.G.; Li, T.Y.; Liu, H.Y.; Du, J.M.; Zhou, F.; Dong, Y.M.; He, X.Y.; Li, Y.T.; Wang, C.Q. Recombinant feline parvovirus infection of immunized tigers in central China. Emerg. Microbes Infect. 2017, 6, e42. [Google Scholar] [CrossRef] [Green Version]
- Wang, K.; Du, S.S.; Wang, Y.Q.; Wang, S.Y.; Luo, X.Q.; Zhang, Y.Y.; Liu, C.F.; Wang, H.J.; Pei, Z.H.; Hu, G.X. Isolation and identification of tiger parvovirus in captive siberian tigers and phylogenetic analysis of VP2 gene. Infect. Genet. Evol. 2019, 75, 103957–103963. [Google Scholar] [CrossRef]
- Goodrich, J.M.; Quigley, K.S.; Lewis, J.C.M.; Astafiev, A.A.; Slabi, E.V.; Miquelle, D.G.; Smirnov, E.N.; Kerley, L.L.; Armstrong, D.L.; Quigley, H.B. Serosurvey of Free-ranging Amur Tigers in the Russian Far East. J. Wildl. Dis. 2012, 48, 186–189. [Google Scholar] [CrossRef] [Green Version]
- Yang, S.T.; Xia, X.Z.; Qiao, J.; Liu, Q.; Chang, S.; Xie, Z.J.; Ju, H.Y.; Zou, X.H.; Gao, Y.W. Complete protection of cats against feline panleukopenia virus challenge by a recombinant canine adenovirus type 2 expressing VP2 from FPV. Vaccine 2008, 26, 1482–1487. [Google Scholar] [CrossRef]
- Risi, E.; Agoulon, A.; Allaire, F.; Le Dréan-Quénec’hdu, S.; Martin, V.; Mahl, P. Antibody response to vaccines for rhinotracheitis, caliciviral disease, panleukopenia, feline leukemia, and rabies in tigers (Panthera tigris) and lions (Panthera leo). J. Zoo Wildl. Med. 2012, 43, 248–255. [Google Scholar] [CrossRef] [PubMed]
- Duenwald, J.C.; Holland, J.M.; Gorham, J.R.; Ott, R.L. Feline panleukopenia: Experimental cerebellar hypoplasia produced in neonatal ferrets with live virus vaccine. Res. Vet. Sci. 1971, 12, 394–396. [Google Scholar] [CrossRef]
- Brussel, K.; Carrai, M.; Lin, C.; Kelman, M.; Setyo, L.; Aberdein, D.; Brailey, J.; Lawler, M.; Maher, S.; Plaganyi, I.; et al. Distinct lineages of feline parvovirus associated with epizootic outbreaks in Australia, New Zealand and the United Arab Emirates. Viruses 2019, 11, 1155. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Truyen, U.; Parrish, C.R. Feline panleukopenia virus: Its interesting evolution and current problems in immunoprophylaxis against a serious pathogen. Vet. Microbiol. 2013, 165, 29–32. [Google Scholar] [CrossRef] [PubMed]
- Chapman, M.S.; Rossmann, M.G. Structure, sequence, and function correlations among parvoviruses. Virology 1993, 194, 491–508. [Google Scholar] [CrossRef]
- Diao, F.F.; Zhao, Y.F.; Wang, J.L.; Wei, X.H.; Cui, K.; Liu, C.Y.; Guo, S.Y.; Jiang, S.J.; Xie, Z.J. Molecular characterization of feline panleukopenia virus isolated from mink and its pathogenesis in mink. Vet. Microbiol. 2017, 205, 92–98. [Google Scholar]
- Hueffer, K.; Parker, J.S.L.; Weichert, W.S.; Geisel, R.E.; Sgro, J.-Y.; Parrish, C.R. The natural host range shift and subsequent evolution of canine parvovirus resulted from virus-specific binding to the canine transferrin receptor. J. Virol. 2003, 77, 1718–1726. [Google Scholar] [CrossRef] [Green Version]
- Xu, J.; Guo, H.C.; Wei, Y.Q.; Dong, H.; Han, S.C.; Ao, D.; Sun, D.H.; Wang, H.M.; Cao, S.Z.; Sun, S.Q. Self-assembly of virus-like particles of canine parvovirus capsid protein expressed from Escherichia coli and application as virus-like particle vaccine. Appl. Microbiol. Biotechnol. 2014, 98, 3529–3538. [Google Scholar] [CrossRef]
- Antonis, A.F.G.; Bruschke, C.J.M.; Rueda, P.; Maranga, L.; Casal, J.I.; Vela, C.; Hilgers, L.A.T.; Belt, P.B.G.M.; Weerdmeester, K.; Carrondo, M.J.T. A novel recombinant virus-like particle vaccine for prevention of porcine parvovirus-induced reproductive failure. Vaccine 2006, 24, 5481–5490. [Google Scholar] [CrossRef]
- Martínez-Solís, M.; Herrero, S.; Targovnik, A.M. Engineering of the baculovirus expression system for optimized protein production. Appl. Microbiol. Biotechnol. 2019, 103, 113–123. [Google Scholar] [CrossRef]
- Decaro, N.; Buonavoglia, C. Canine parvovirus—A review of epidemiological and diagnostic aspects, with emphasis on type 2c. Vet. Microbiol. 2012, 155, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Feng, H.; Hu, G.Q.; Wang, H.L.; Liang, M.; Liang, H.R.; Guo, H.; Zhao, P.S.; Yang, Y.J.; Zheng, X.X.; Zhang, Z.F. Canine parvovirus VP2 protein expressed in silkworm pupae self-assembles into virus-like particles with high immunogenicity. PLoS ONE 2014, 9, e79575. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jin, H.L.; Xia, X.H.; Liu, B.; Fu, Y.; Chen, X.P.; Wang, H.L.; Xia, Z.Q. High-yield production of canine parvovirus virus-like particles in a baculovirus expression system. Arch. Virol. 2016, 161, 705–710. [Google Scholar] [CrossRef] [PubMed]
- Carmichael, L.E.; Joubert, J.C.; Pollock, R.V. Hemagglutination by canine parvovirus: Serologic studies and diagnostic applications. Am. J. Vet. Res. 1980, 41, 784–791. [Google Scholar] [PubMed]
- Cheng, N.; Zhao, Y.K.; Han, Q.X.; Zhang, W.J.; Xi, J.; Yu, Y.L.; Wang, H.L.; Li, G.H.; Gao, Y.W.; Yang, S.T.; et al. Development of a reverse genetics system for a feline panleukopenia virus. Virus Genes 2019, 55, 95–103. [Google Scholar] [CrossRef]
- Bergmann, M.; Schwertler, S.; Reese, S.; Speck, S.; Truyen, U.; Katrin, H. Antibody response to feline panleukopenia virus vaccination in healthy adult cats. J. Feline Med. Surg. 2018, 20, 1087–1093. [Google Scholar] [CrossRef]
- Mouzin, D.E.; Lorenzen, M.J.; Haworth, J.D.; King, V.L. Duration of serologic response to three viral antigens in cats. J. Am. Vet. Med. Assoc. 2004, 224, 61–66. [Google Scholar] [CrossRef]
Primer | Primer Sequence (5′-3′) | Product Length |
---|---|---|
PH-VP2-F | TATGCGGCCGCATGTCCGACGGTGCTGT (Not I) | 1755 bp |
PH-VP2-R | TATAAGCTTTTAGTACAGCTTACGAGGA (Hind III) | |
P10-VP2-F | TATCTCGAGATGTCCGACGGTGCTGTGC (Xho I) | 1755 bp |
P10-VP2-R | TATGGTACCTTAGTACAGCTTACGAGGAG (Kpn I) |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jiao, C.; Zhang, H.; Liu, W.; Jin, H.; Liu, D.; Zhao, J.; Feng, N.; Zhang, C.; Shi, J. Construction and Immunogenicity of Virus-Like Particles of Feline Parvovirus from the Tiger. Viruses 2020, 12, 315. https://0-doi-org.brum.beds.ac.uk/10.3390/v12030315
Jiao C, Zhang H, Liu W, Jin H, Liu D, Zhao J, Feng N, Zhang C, Shi J. Construction and Immunogenicity of Virus-Like Particles of Feline Parvovirus from the Tiger. Viruses. 2020; 12(3):315. https://0-doi-org.brum.beds.ac.uk/10.3390/v12030315
Chicago/Turabian StyleJiao, Cuicui, Hongliang Zhang, Wei Liu, Hongli Jin, Di Liu, Jian Zhao, Na Feng, Chuanmei Zhang, and Jing Shi. 2020. "Construction and Immunogenicity of Virus-Like Particles of Feline Parvovirus from the Tiger" Viruses 12, no. 3: 315. https://0-doi-org.brum.beds.ac.uk/10.3390/v12030315