Abrogation of Constitutive and Induced Type I and Type III Interferons and Interferon-Stimulated Genes in Keratinocytes by Canine Papillomavirus 2 E6 and E7
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plasmids and Retrovirus Transduction
2.2. Cell Culture
2.3. Reverse Transcription Real Time PCR
2.4. Statistical Analysis
3. Results
3.1. Constitutive mRNA Expression of a Subset of IFN and IFN-Stimulated Genes Is Reduced by CPV2 E6 in Canine Keratinocytes
3.2. Diminished Poly(dA:dT)-Induction of IFN and IFN-Stimulated Genes by CPV2 E6 and E7 in Canine Keratinocytes
3.3. Diminished Poly(I:C)-Induction of IFN and IFN-Stimulated Genes by CPV2 E6 and E7 in Canine Keratinocytes
3.4. Diminished IFN-β-Induction of IFN-Stimulated Genes by CPV2 E7 but Not E6 in Canine Keratinocytes
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Bernard, H.U.; Burk, R.D.; Chen, Z.; van Doorslaer, K.; Hausen, H.; de Villiers, E.M. Classification of papillomaviruses (PVs) based on 189 PV types and proposal of taxonomic amendments. Virology 2010, 401, 70–79. [Google Scholar] [CrossRef] [Green Version]
- de Villiers, E.M.; Fauquet, C.; Broker, T.R.; Bernard, H.U.; zur Hausen, H. Classification of papillomaviruses. Virology 2004, 324, 17–27. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McBride, A.A. Oncogenic human papillomaviruses. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2017, 372. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gheit, T. Mucosal and Cutaneous Human Papillomavirus Infections and Cancer Biology. Front. Oncol. 2019, 9, 355. [Google Scholar] [CrossRef] [Green Version]
- Leiding, J.W.; Holland, S.M. Warts and all: Human papillomavirus in primary immunodeficiencies. J. Allergy Clin. Immunol. 2012, 130, 1030–1048. [Google Scholar] [CrossRef] [Green Version]
- Wieland, U.; Kreuter, A.; Pfister, H. Human papillomavirus and immunosuppression. Curr. Probl. Dermatol. 2014, 45, 154–165. [Google Scholar] [CrossRef] [PubMed]
- Altamura, G.; Corteggio, A.; Pacini, L.; Conte, A.; Pierantoni, G.M.; Tommasino, M.; Accardi, R.; Borzacchiello, G. Transforming properties of Felis catus papillomavirus type 2 E6 and E7 putative oncogenes in vitro and their transcriptional activity in feline squamous cell carcinoma in vivo. Virology 2016, 496, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Goldschmidt, M.H.; Kennedy, J.S.; Kennedy, D.R.; Yuan, H.; Holt, D.E.; Casal, M.L.; Traas, A.M.; Mauldin, E.A.; Moore, P.F.; Henthorn, P.S.; et al. Severe papillomavirus infection progressing to metastatic squamous cell carcinoma in bone marrow-transplanted X-linked SCID dogs. J. Virol. 2006, 80, 6621–6628. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Felsburg, P.J.; Hartnett, B.J.; Henthorn, P.S.; Moore, P.F.; Krakowka, S.; Ochs, H.D. Canine X-linked severe combined immunodeficiency. Vet. Immunol. Immunopathol. 1999, 69, 127–135. [Google Scholar] [CrossRef]
- Felsburg, P.J.; Somberg, R.L.; Hartnett, B.J.; Henthorn, P.S.; Carding, S.R. Canine X-linked severe combined immunodeficiency. A model for investigating the requirement for the common gamma chain (gamma c) in human lymphocyte development and function. Immunol. Res. 1998, 17, 63–73. [Google Scholar] [CrossRef]
- Yuan, H.; Ghim, S.; Newsome, J.; Apolinario, T.; Olcese, V.; Martin, M.; Delius, H.; Felsburg, P.; Jenson, B.; Schlegel, R. An epidermotropic canine papillomavirus with malignant potential contains an E5 gene and establishes a unique genus. Virology 2007, 359, 28–36. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Iversen, M.B.; Ank, N.; Melchjorsen, J.; Paludan, S.R. Expression of type III interferon (IFN) in the vaginal mucosa is mediated primarily by dendritic cells and displays stronger dependence on NF-kappaB than type I IFNs. J. Virol. 2010, 84, 4579–4586. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stanley, M.A. Epithelial cell responses to infection with human papillomavirus. Clin. Microbiol. Rev. 2012, 25, 215–222. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Barbalat, R.; Ewald, S.E.; Mouchess, M.L.; Barton, G.M. Nucleic acid recognition by the innate immune system. Annu. Rev. Immunol. 2011, 29, 185–214. [Google Scholar] [CrossRef] [PubMed]
- Kalali, B.N.; Kollisch, G.; Mages, J.; Muller, T.; Bauer, S.; Wagner, H.; Ring, J.; Lang, R.; Mempel, M.; Ollert, M. Double-stranded RNA induces an antiviral defense status in epidermal keratinocytes through TLR3-, PKR-, and MDA5/RIG-I-mediated differential signaling. J. Immunol. 2008, 181, 2694–2704. [Google Scholar] [CrossRef] [Green Version]
- Almine, J.F.; O′Hare, C.A.; Dunphy, G.; Haga, I.R.; Naik, R.J.; Atrih, A.; Connolly, D.J.; Taylor, J.; Kelsall, I.R.; Bowie, A.G.; et al. IFI16 and cGAS cooperate in the activation of STING during DNA sensing in human keratinocytes. Nat. Commun. 2017, 8, 14392. [Google Scholar] [CrossRef]
- Kawamura, T.; Ogawa, Y.; Aoki, R.; Shimada, S. Innate and intrinsic antiviral immunity in skin. J. Dermatol. Sci. 2014, 75, 159–166. [Google Scholar] [CrossRef]
- LaFleur, D.W.; Nardelli, B.; Tsareva, T.; Mather, D.; Feng, P.; Semenuk, M.; Taylor, K.; Buergin, M.; Chinchilla, D.; Roshke, V.; et al. Interferon-kappa, a novel type I interferon expressed in human keratinocytes. J. Biol. Chem. 2001, 276, 39765–39771. [Google Scholar] [CrossRef] [Green Version]
- Lazear, H.M.; Nice, T.J.; Diamond, M.S. Interferon-lambda: Immune Functions at Barrier Surfaces and Beyond. Immunity 2015, 43, 15–28. [Google Scholar] [CrossRef] [Green Version]
- Lau, L.; Gray, E.E.; Brunette, R.L.; Stetson, D.B. DNA tumor virus oncogenes antagonize the cGAS-STING DNA-sensing pathway. Science 2015, 350, 568–571. [Google Scholar] [CrossRef] [Green Version]
- Perea, S.E.; Massimi, P.; Banks, L. Human papillomavirus type 16 E7 impairs the activation of the interferon regulatory factor-1. Int. J. Mol. Med. 2000, 5, 661–666. [Google Scholar] [CrossRef] [PubMed]
- Reiser, J.; Hurst, J.; Voges, M.; Krauss, P.; Munch, P.; Iftner, T.; Stubenrauch, F. High-risk human papillomaviruses repress constitutive kappa interferon transcription via E6 to prevent pathogen recognition receptor and antiviral-gene expression. J. Virol. 2011, 85, 11372–11380. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ronco, L.V.; Karpova, A.Y.; Vidal, M.; Howley, P.M. Human papillomavirus 16 E6 oncoprotein binds to interferon regulatory factor-3 and inhibits its transcriptional activity. Genes. Dev. 1998, 12, 2061–2072. [Google Scholar] [CrossRef] [Green Version]
- Cordano, P.; Gillan, V.; Bratlie, S.; Bouvard, V.; Banks, L.; Tommasino, M.; Campo, M.S. The E6E7 oncoproteins of cutaneous human papillomavirus type 38 interfere with the interferon pathway. Virology 2008, 377, 408–418. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, J.; Zhou, D.; Prabhu, A.; Schlegel, R.; Yuan, H. The canine papillomavirus and gamma HPV E7 proteins use an alternative domain to bind and destabilize the retinoblastoma protein. PLoS Pathog. 2010, 6, e1001089. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Luff, J.A.; Yuan, H.; Kennedy, D.; Schlegel, R.; Felsburg, P.; Moore, P.F. Keratinocyte antiviral response to Poly(dA:dT) stimulation and papillomavirus infection in a canine model of X-linked severe combined immunodeficiency. PLoS ONE 2014, 9, e102033. [Google Scholar] [CrossRef]
- Luff, J.A.; Yuan, H.; Suter, M.M.; Muller, E.J.; Schlegel, R.; Moore, P.F. Canine keratinocytes upregulate type I interferons and proinflammatory cytokines in response to poly(dA:dT) but not to canine papillomavirus. Vet. Immunol. Immunopathol. 2013, 153, 177–186. [Google Scholar] [CrossRef] [Green Version]
- Fox, B.A.; Sheppard, P.O.; O′Hara, P.J. The role of genomic data in the discovery, annotation and evolutionary interpretation of the interferon-lambda family. PLoS ONE 2009, 4, e4933. [Google Scholar] [CrossRef]
- Fan, W.; Xu, L.; Ren, L.; Qu, H.; Li, J.; Liang, J.; Liu, W.; Yang, L.; Luo, T. Functional characterization of canine interferon-lambda. J. Interferon Cytokine Res. 2014, 34, 848–857. [Google Scholar] [CrossRef] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Karim, R.; Tummers, B.; Meyers, C.; Biryukov, J.L.; Alam, S.; Backendorf, C.; Jha, V.; Offringa, R.; van Ommen, G.J.; Melief, C.J.; et al. Human papillomavirus (HPV) upregulates the cellular deubiquitinase UCHL1 to suppress the keratinocyte’s innate immune response. PLoS Pathog. 2013, 9, e1003384. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, H.C.; Chathuranga, K.; Lee, J.S. Intracellular sensing of viral genomes and viral evasion. Exp. Mol. Med. 2019, 51, 1–13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Westrich, J.A.; Warren, C.J.; Pyeon, D. Evasion of host immune defenses by human papillomavirus. Virus Res. 2017, 231, 21–33. [Google Scholar] [CrossRef]
- zur Hausen, H. Papillomaviruses causing cancer: Evasion from host-cell control in early events in carcinogenesis. J. Natl. Cancer Inst. 2000, 92, 690–698. [Google Scholar] [CrossRef] [Green Version]
- Oldak, M.; Tolzmann, L.; Wnorowski, A.; Podgorska, M.J.; Silling, S.; Lin, R.; Hiscott, J.; Muller, C.S.; Vogt, T.; Smola, H.; et al. Differential regulation of human papillomavirus type 8 by interferon regulatory factors 3 and 7. J. Virol. 2011, 85, 178–188. [Google Scholar] [CrossRef] [Green Version]
- Park, J.S.; Kim, E.J.; Kwon, H.J.; Hwang, E.S.; Namkoong, S.E.; Um, S.J. Inactivation of interferon regulatory factor-1 tumor suppressor protein by HPV E7 oncoprotein. Implication for the E7-mediated immune evasion mechanism in cervical carcinogenesis. J. Biol. Chem. 2000, 275, 6764–6769. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Um, S.J.; Rhyu, J.W.; Kim, E.J.; Jeon, K.C.; Hwang, E.S.; Park, J.S. Abrogation of IRF-1 response by high-risk HPV E7 protein in vivo. Cancer Lett. 2002, 179, 205–212. [Google Scholar] [CrossRef]
- Luo, X.; Donnelly, C.R.; Gong, W.; Heath, B.R.; Hao, Y.; Donnelly, L.A.; Moghbeli, T.; Tan, Y.S.; Lin, X.; Bellile, E.; et al. HPV16 drives cancer immune escape via NLRX1-mediated degradation of STING. J. Clin. Investig. 2020. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lo Cigno, I.; Calati, F.; Borgogna, C.; Zevini, A.; Albertini, S.; Martuscelli, L.; De Andrea, M.; Hiscott, J.; Landolfo, S.; Gariglio, M. Human Papillomavirus E7 Oncoprotein Subverts Host Innate Immunity via SUV39H1-Mediated Epigenetic Silencing of Immune Sensor Genes. J. Virol. 2020, 94. [Google Scholar] [CrossRef]
- Antonsson, A.; Payne, E.; Hengst, K.; McMillan, N.A. The human papillomavirus type 16 E7 protein binds human interferon regulatory factor-9 via a novel PEST domain required for transformation. J. Interferon Cytokine Res. 2006, 26, 455–461. [Google Scholar] [CrossRef]
- Li, S.; Labrecque, S.; Gauzzi, M.C.; Cuddihy, A.R.; Wong, A.H.; Pellegrini, S.; Matlashewski, G.J.; Koromilas, A.E. The human papilloma virus (HPV)-18 E6 oncoprotein physically associates with Tyk2 and impairs Jak-STAT activation by interferon-alpha. Oncogene 1999, 18, 5727–5737. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ning, S.; Pagano, J.S.; Barber, G.N. IRF7: Activation, regulation, modification and function. Genes. Immun. 2011, 12, 399–414. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Target Gene | Primer Sequence Forward and Reverse (5′–3′) | Efficiency (%) |
---|---|---|
RPL13A (reference gene) | TGGGCCGGAAGGTTGTAGTCGT | 99 |
TTGCGGAGGAAGGCCAGGTAATTCA | ||
IFN-λ1 | TCCCTACTTCCAAACCCACC | 95 |
GTTCTTCCAGGAGAGCGACT | ||
IFN-λ2L | CGCCTCTTCCCTAGAAACCGGGACC | 96 |
CTCCAGGACCTTCAGTGTCAAGGCC | ||
IRF7 | GCAAGGTCTACTGGGAGGTG | 97 |
GTGCTGAAGTCGAAGATGGGG | ||
CPV2 E6 | ATATTTATGAAACCGTTAGCC | 99 |
CGCAGCTGTCACAAGTGTTCC | ||
CPV2 E7 | ACAGAGAGAACCTGGGCGATA | 100 |
ATAATGCCAAGCCCGTCTAA |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Quinlan, S.; May, S.; Weeks, R.; Yuan, H.; Luff, J.A. Abrogation of Constitutive and Induced Type I and Type III Interferons and Interferon-Stimulated Genes in Keratinocytes by Canine Papillomavirus 2 E6 and E7. Viruses 2020, 12, 677. https://0-doi-org.brum.beds.ac.uk/10.3390/v12060677
Quinlan S, May S, Weeks R, Yuan H, Luff JA. Abrogation of Constitutive and Induced Type I and Type III Interferons and Interferon-Stimulated Genes in Keratinocytes by Canine Papillomavirus 2 E6 and E7. Viruses. 2020; 12(6):677. https://0-doi-org.brum.beds.ac.uk/10.3390/v12060677
Chicago/Turabian StyleQuinlan, Sarah, Susan May, Ryan Weeks, Hang Yuan, and Jennifer A. Luff. 2020. "Abrogation of Constitutive and Induced Type I and Type III Interferons and Interferon-Stimulated Genes in Keratinocytes by Canine Papillomavirus 2 E6 and E7" Viruses 12, no. 6: 677. https://0-doi-org.brum.beds.ac.uk/10.3390/v12060677