Next Article in Journal
Advanced Therapy Medicinal Products for the Eye: Definitions and Regulatory Framework
Previous Article in Journal
Adherence and Acceptability of an Oral Antibiotic Used for the Prevention of Pediatric Urinary Tract Infection in Japan
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Tyrosine Kinase Inhibitors Are Promising Therapeutic Tools for Cats with HER2-Positive Mammary Carcinoma

1
CIISA—Centro de Investigação Interdisciplinar em Sanidade Animal, Faculdade de Medicina Veterinária, Universidade de Lisboa, Avenida da Universidade Técnica, 1300-477 Lisboa, Portugal
2
Antiviral Resistance Laboratory, Infectious Diseases Department, National Institute of Health Dr. Ricardo Jorge, Av. Padre Cruz, 1649-016 Lisbon, Portugal
*
Author to whom correspondence should be addressed.
Submission received: 16 February 2021 / Revised: 28 February 2021 / Accepted: 2 March 2021 / Published: 6 March 2021
(This article belongs to the Section Drug Targeting and Design)

Abstract

:
Feline mammary carcinoma (FMC) is a common neoplasia in cat, being HER2-positive the most prevalent subtype. In woman’s breast cancer, tyrosine kinase inhibitors (TKi) are used as a therapeutic option, by blocking the phosphorylation of the HER2 tyrosine kinase domain. Moreover, clinical trials demonstrated that TKi produce synergistic antiproliferative effects in combination with mTOR inhibitors, overcoming resistance to therapy. Thus, to uncover new chemotherapeutic strategies for cats, the antiproliferative effects of two TKi (lapatinib and neratinib), and their combination with a mTOR inhibitor (rapamycin), were evaluated in FMC cell lines (CAT-M, FMCp and FMCm) and compared with a human breast cancer cell line (SkBR-3). Results revealed that both TKi induced antiproliferative effects in all feline cell lines, by blocking the phosphorylation of EGFR members and its downstream effectors. Furthermore, combined treatments with rapamycin presented synergetic antiproliferative effects. Additionally, the DNA sequence of the her2 TK domain (exons 18 to 20) was determined in 40 FMC tissue samples, and despite several mutations were found none of them were described as inducing resistance to therapy. Altogether, our results demonstrated that TKi and combined protocols may be useful in the treatment of cats with mammary carcinomas, and that TKi-resistant FMC are rare.

1. Introduction

The feline mammary carcinoma (FMC) is one of the most common feline tumors (12% to 40% of all neoplasms) [1,2], sharing similar clinicopathological features and histologic subtypes with human breast cancer [3], making the cat a suitable model for comparative oncology studies [4,5,6,7]. Indeed, cats with HER2-positive mammary carcinoma also show a poor prognosis, with high clinical tumor aggressiveness, metastization capability and shorter overall-survival (OS) [1,2,8,9], with the overexpression of the epidermal growth factor receptor 2 (HER2) been reported in a range from 33% to 60% of all FMC cases [10]. Unfortunately, no specific therapeutic targets are available for cats with HER2-positive mammary tumors, being the adjuvant chemotherapy unbeneficial in most of the cases, with the radical surgery being the unique therapeutic strategy [11]. Thus, new molecular targets are needed to develop more efficient therapeutic protocols.
In cat, the her2 gene is localized in the chromosome E1, presenting a sequence identity of 92% with its human counterpart [12,13]. The HER2 is a tyrosine kinase (TK) transmembrane glycoprotein (186 kDa), constituted by three domains: an extracellular region, a transmembrane domain and an intracellular subdomain with TK activity [14]. In cell membrane, the HER2 can dimerize with itself or with other members of the epidermal growth factor receptor (EGFR) family, showing a proto-oncogene activity, with the ability to modulate cell cycle and apoptotic responses [1,12,14]. Furthermore, HER2 phosphorylation promotes cell proliferation via the RAS-ERK pathway and inhibits cell death via the PI3K-AKT-mTOR pathway, which makes the phosphorylated HER2 a marker of poor prognosis [15] and a useful molecular target in breast cancer therapy. However 50% of patients with HER2-positive breast cancer show immunotherapy resistance to anti-HER2 monoclonal antibodies, being the use of TK inhibitors (TKi) an alternative approach for these targeted immunotherapies. The TKi are small chemical compounds that prevent HER2 phosphorylation, by competing with the adenosine triphosphate (ATP) at the cytoplasmic catalytic kinase domain and, consequently, blocking the signaling for the downstream cascade activation [16]. Several TKi are conventionally used in human breast cancer therapy, such as lapatinib and neratinib. Accordingly, lapatinib is a reversible dual EGFR inhibitor, binding the ATP-binding pocket of HER1 and HER2 proteins [17], presenting apoptotic effects [16]. This compound has a specific binding location, encoded by exon 20 of the her2 gene, with several point mutations being associated with therapy resistance (e.g., L755S, T798M) [18]. In parallel, neratinib is an irreversible pan-HER inhibitor that interacts with HER1, HER2 and HER4 proteins [14], able to overcome lapatinib therapy resistance [18]. This molecule binds the TK ATP binding pocket, with a high binding specificity in a conserved cysteine (Cys) residue [19], leading to cell death, by a ferroptosis mechanism [20,21], with woman breast cancer patients having the acquired mutation at the residue T798I in HER2 and/or HER4 overexpression showing neratinib resistance [22]. Indeed, the HER4 protein is crucial for normal mammalian gland development and differentiation, and it is hypothesized that HER2-positive tumor cells can shift their dependency from HER2 to HER4 [23], to maintain cell survival and growth.
Nowadays, the combined treatments, such as the use of TKi conjugated with the mammalian target of rapamycin (mTOR) inhibitor, are valuable therapeutic tools, in order to reduce resistance development and drug secondary effects. Indeed, the rapamycin that is a fungicide macrolide with immunosuppressive and anticancer properties, binds to an immunophilin protein family, inhibiting the serine-threonine kinase mTOR [24,25] and its complex (mTORC) involved in cell cycle progression and cell proliferation [25], two hallmarks of the carcinogenesis process [24].
For breast cancer patients, treatments based on precision and target specificity are crucial towards the improvement of the therapeutic response and preventing drug resistance [17]. Once no data is available about the use of these compounds in feline mammary carcinoma, this study aims to: (1) evaluate the antiproliferative effects of two TKi (lapatinib and neratinib) using three feline mammary carcinoma cell lines (CAT-M, FMCp and FMCm); (2) characterize the effect of the TKi in the phosphorylation patterns on EGFR family members (HER1, HER2 and HER4), its downstream pathways (PI3K/AKT and ERK1/2) and on the tumor suppressor PTEN protein; (3) measure the cytotoxic effects of the mTOR inhibitor, rapamycin and evaluate its effect on the mTOR phosphorylation pattern; (4) evaluate the synergistic antiproliferative effects of the combined treatments of using TKi and rapamycin; and (5) identify genomic mutations in the feline her2 gene TK domain in FMC tissue samples, in order to assess their use as prognostic/drug-resistance biomarkers.

2. Materials and Methods

2.1. Feline and Human Mammary Carcinoma Cell Lines

In this study, three feline mammary carcinoma cell lines (CAT-M, from the American Type Culture Collection (ATCC), Manassas, VA, USA; FMCp and FMCm kindly provided by Prof. Nobuo Sasaki (DVM) and Prof. Takayuki Nakagawa (DVM), University of Tokyo, Japan) were immunophenotyped and tested, as well as a HER2-overexpressing human breast cancer cell line (SkBR-3, from the ATCC) used as positive control (Table S1). CAT-M and SkBR-3 cell lines were maintained in Dulbecco’s modified Eagle Medium (DMEM; Corning, New York, NY, USA), whereas FMCp and FMCm cell lines were growing in Roswell Park Memorial Institute 1640 Medium (RPMI; Corning), both supplemented with heat-inactivated 20% (v/v) fetal bovine serum (FBS; Corning), and incubated at 37 °C, in a humidified atmosphere of 5% (v/v) CO2 (Nuaire, Plymouth, MN, USA). Periodically, cell lines were tested for Mycoplasma (MycoSEQ™ Mycoplasma Detection Kit, Thermo Fisher, Waltham, MA, USA) and examined for their morphology and proliferation rate.

2.2. In Vitro Cytotoxicity Assays

To determine the effect of the TKi (lapatinib and neratinib; Sigma-Aldrich, Darmstadt, Germany) and of the mTOR inhibitor (rapamycin; Sigma-Aldrich), viability assays were performed using the Cell Proliferation Reagent WST-1 kit (abcam, Cambridge, UK), following to the manufacturer’s instructions. Briefly, cell lines were seeded in 96-well plates to reach a 90% confluency at 24 h. Then, cells were exposed to increasing concentrations of each drug to obtain a dose-response plot (Table 1), while control wells were left unexposed. Dimethyl sulfoxide (DMSO; Sigma-Aldrich) was used as vehicle control, at a maximum final concentration of 1%. After 72 h of drug exposure, the WST-1 reagent (abcam) was added during an incubation period of 4 h, at 37 °C, and absorbance at 440 nm was measured using a plate reader (FLUOStar Optima, BMG LabTech, GmbH, Offenburg, Germany). Triplicate wells were used to determine each data point and three independent experiments were performed.
In combined treatments (lapatinib plus rapamycin; neratinib plus rapamycin) the same strategy was followed, with the concentrations chosen in a range that a small or no cytotoxic effect was observed.

2.3. Immunoblotting

For the quantification of protein expression levels, the western blot technique was performed as previously reported by us [2,26], and other groups [27,28]. Briefly, for the preparation of whole cell extracts, cell lines were seeded in 6-well plates, in order to obtain a confluency of 90%, after 24 h. Then, cells were exposed to drugs, using IC50 concentrations, and a negative control was left unexposed, using DMSO (Sigma-Aldrich) as a vehicle. After 72 h of exposure, cells were collected using 200µL of RIPA lysis buffer (50 mM TrisHCl, 150 mM NaCl, 1% Tween-20, 0.5% sodium deoxycholate, 0.1% SDS, 5 mM EDTA, pH 8.0) supplemented with 1% 100X Halt™ protease inhibitor cocktail EDTA-free (Thermo Fischer) and 2 mg/mL iodoacetamide (AppliChem, GmbH, Darmstadt, Germany). Afterwards, whole cell extracts were resuspended with 10 µL of SDS-PAGE Loading Buffer 5X (NZYTech, Lisbon, Portugal), denatured for 10 min at 96 °C, and stored at −80 °C, until further use. Before immunoblotting, the extracts were fully thawed, and then resolved in 7.5% SDS-PAGE. Proteins were transferred onto nitrocellulose membranes (Amersham Protran 0.45 NC, GE Healthcare, Chicago, IL, USA) and blocked in 5% (w/v) dried skimmed milk diluted in phosphate buffered saline (PBS)−0.1% (v/v) Tween-20 (National Diagnostics, Atlanta, GA, USA). Membranes were probed with primary antibodies (abcam; Table 2) diluted in 1% (w/v) dried skimmed milk in PBS−0.1% Tween-20 (National Diagnostics), overnight at 4 °C, and then with horseradish peroxidase (HRP)-conjugated secondary antibodies (Goat HRP anti-rabbit IgG H&L and goat HRP anti-mouse IgG H&L, 1:10,000, Abcam) for 1 h at room temperature (RT). Bands were detected using ECL (Clarity Substrate, Bio-Rad, Hercules, CA, USA), visualized and analyzed using a Chemidoc XRS + system with Image Lab capture software (Bio-Rad).

2.4. Animal Population

The forty cats diagnosed with mammary carcinoma enrolled in this study, were recruited at the Hospital of Faculty of Veterinary Medicine, University of Lisbon, being the surgical procedures consented by the owners, and without interfering with the animals’ well-being. Their clinical history was fully documented (Table 3) [2], including breed, age, reproductive status and contraceptive administration, treatment (surgery, or surgery plus chemotherapy), number, location and size of tumor lesions, histopathological classification, tumor immunophenotype [3,29], malignancy grade [30], presence of tumor necrosis, lymphatic invasion, lymphocytic infiltration, cutaneous ulceration, regional lymph node involvement and clinical stage (TNM system). All tissue samples were frozen at −80 °C and stored until further use.

2.5. DNA Extraction, Amplification and Sequence Analysis of the Feline her2 TK Domain

Genomic DNA extraction was performed in the three feline cell lines, collected after reaching confluence in a T25 culture flask, and in 5 mg of 44 frozen tissue samples (40 feline mammary tumor samples and 4 breed controls), as previously described [31,32,33], using a QIAmp FFPE kit (Qiagen, Dusseldorf, Germany) and following the manufacturer’s recommendations. Tissue samples were homogenized with the Tissue Lyser II (Qiagen), and all samples were digested with protease K (20 mg/mL; Qiagen). After several washing steps, the genomic DNA was eluted from the extraction columns and its quality and quantity was measured in NanoDrop ND-100 Spectrophotometer (Thermo Fisher Scientific). The feline her2 TK domain (NC_018736.3) was identified by comparison with the genomic human her2 sequence (NC_000017.11), and primers for DNA amplification of exons 18 to 22 were designed in the Primer designing tool (NCBI, Bethesda, MD, USA) (Table 4). PCR technique was performed with a standard reaction mixture (4 µL/sample of Phusion GC buffer from Thermo Fischer Scientific; 0.4 µL/sample of dNTPs from Grisp, Porto, Portugal; 0.1 µL/sample of each forward and reverse primer and 0.2 µL/sample of DNA polymerase from Thermo Fischer Scientific) at a final DNA concentration of 4 ng/mL. For amplification of the exons 18 and 19 of the her2 gene, PCR reactions were performed in a PCR Thermal Cycler (VWR, Leicestershire, England) as follows: denaturation at 98 °C for 30 s, followed by 35 cycles at 98 °C for 10 s, 60 °C for 30 s, 72 °C for 10 s, plus one final extension step at 72 °C for 10 min. For exons 20 to 22, the melting temperature was 58 °C. After confirmation of the expected size for each amplified sequence in a 2% agarose gel (Sigma-Aldrich), DNA fragments were purified and sequenced by Sanger technique (StabVida, Almada, Portugal). DNA sequences were inspected for inaccuracies.
The feline sequenced samples were aligned with the identified feline her2 (NC_018736.3), using the ClustalW tool (BioEdit Alignment Editor software) and the consensus sequence was confirmed using SeqTrace 9.1 software [34], while SNP and protein amino acid changes were identified by using Expert Protein Analysis System (ExPASY) translate tool and compared with the original protein sequence (NP_001041628.1, NCBI). Mutations identified in the feline tissue samples were compared to the human her2 sequence (NC_000017.11) and searched in National Cancer Institute database, International Cancer Genome Consortium and Catalogue of Somatic Mutations in Cancer (COSMIC) databases for putatively induced resistance to the TKi tested in this study.

2.6. Statistical Analysis

Statistical analysis was carried out using the GraphPad Prism software (version 5.04, for Windows, San Diego, CA, USA), with two-tailed p-values less than 0.05 being considered statistically significant, and a 95% confidence interval (* p < 0.05, ** p < 0.01 and *** p < 0.001). Regarding the cytotoxicity assays, outliers with more than two standard deviations were removed and the IC50 value for each drug was calculated using Log (Inhibitor) vs. Response (Variable slope) function. For the drug conjugation assays, the two-way ANOVA test was performed. In the animal population, correlations considering the genomic mutations were assessed between groups using the non-parametric Mann Whitney test.

3. Results

3.1. Lapatinib and Neratinib Exert Antiproliferative Effects in All Feline Mammary Carcinoma Cell Lines

Results showed that incubation of FMC cell lines with lapatinib or neratinib, exert potent antiproliferative effects in a dose-dependent fashion. Indeed, the lapatinib was able to induce 100% of cytotoxicity in all feline cell lines (CAT-M with a IC50 = 3930 nM ± 49, Figure 1A; FMCp with a IC50 = 4870 nM ± 100, Figure 1B; FMCm with a IC50 = 17,470 nM ± 100, Figure 1C), while neratinib showed lower cytotoxicity (33.5% of cytotoxicity in CAT-M cells, Figure 1A; 79.4% of cytotoxicity in FMCp cells, Figure 1B; and 31.4% of cytotoxicity in FMCm, Figure 1C). As expected, the human breast cancer SkBR-3 cell line showed 91.1% of cytotoxicity when incubated with lapatinib (IC50 = 16,220 nM ± 1040) and a cytotoxicity of 60.5% in the presence of neratinib (Figure 1D).

3.2. Lapatinib and Neratinib Inhibit the Phosphorylation of HER2 and Its Downstream Cascade

Considering the promising results obtained from the incubation of all feline cell lines to both TKi, the HER2 expression was evaluated by immunoblot analysis. Results revealing that HER2 expression is much lower in feline cell lines than in human positive control (SkBR-3), being the cell line FMCp HER2-negative (Figure 2A). Once the HER2 expression in feline cell lines was higher in CAT-M cells, further analysis was performed to characterize the effects of TKi on the HER2 signaling pathway activity using this cell line. After lapatinib exposure, a decreasing on the phosphorylation levels of HER1 and HER2 was detected, coupled with a reduction in the phosphorylation levels of the downstream effectors AKT and ERK1/2. Moreover, an increase in phosphorylated PTEN at Thr366 was also observed (Figure 2B). Corroborating the lower cytotoxicity induced by neratinib incubations, differences in the phosphorylated levels were less noticeable (Figure 2B).
Interestingly, when feline tumor cells were incubated with TKi, in particularly, with lapatinib, the HER2 expression levels increased, both in CAT-M (Figure 2C) and FMCp (Figure 2D) cell lines.

3.3. Rapamycin Does Not Induce Strong Antiproliferative Effects in Feline Cell Lines

The use of rapamycin as a single drug did not presented a valuable antiproliferative effect (Figure 3A). Accordingly, the CAT-M and FMCm cell lines showed 38.7% and 41.3% of cytotoxicity, respectively, with the FMCp showing slightly more sensitivity to rapamycin (43.3% of cytotoxicity). Similar results were obtained with the control SkBR-3 cell line (26.9% of cytotoxicity). Additionally, the immunoblot analysis revealed a decrease in the mTOR phosphorylation levels after rapamycin exposure (Figure 3B).

3.4. Combined Exposures of TKi and mTOR Inhibitor Showed Strong Synergistic Antiproliferative Effects

The combined exposures of lapatinib plus rapamycin and neratinib plus rapamycin, demonstrated high synergistic cytotoxic effects regardless of feline cell lines. For instance, in the CAT-M cell line, the cytotoxic effects increased from 5.6% to 57.5% (p = 0.0360) by adding 6.25 nM of rapamycin to 3125 nM of lapatinib and raised from 2.5% to 49.9% (p = 0.0044) when cells were incubated with 12.5 nM of neratinib plus 6.25 nM of rapamycin (Figure 4A). Similarly, in FMCp cell line, the antiproliferative effects increased from 6.9% to 54.4% (p < 0.001) when lapatinib at 780 nM was combined with rapamycin at 6.25 nM and from 0.4% to 44.5% (p = 0.0034) when neratinib at 3.125 nM was combined with rapamycin at 6.25 nM (Figure 4B). In the metastatic FMCm cell line, the higher antiproliferative effects were obtained by the use of lapatinib at 22,650 nM plus rapamycin at 6.25 nM, increasing from 9.6% to 95.2% (p < 0.001), and exposing cells to neratinib at 25 nM plus rapamycin at 6.25 nM, increasing the antiproliferative effects from 9.6% to 76.3% (p < 0.001; Figure 4C). In the control SkBR-3 cell line, also synergistic effects were detected in all combination assays (Figure 4D).

3.5. Mutations Found in the her2 TK Domain of FMC Clinical Samples Were Not Associated with TKi Therapy Resistance

Previous studies on somatic mutations in the TK domain of the her2 gene, in human breast cancer patients, revealed several mutations associated with therapy resistance to TKi and/or specific clinicopathological features, reported in National Cancer Institute database, International Cancer Genome Consortium and COSMIC databases. In this work, the mutational analysis of the feline her2 TK domain, showed that mutations occur in the majority of tumor samples (90%, 36/40), being identified a total of 42 single variants (SVs) (Figure 5), located in introns (54.8%; 23/42) and exons (45.2%; 19/42) (Table S2). Regarding the intronic SVs, 21.7% (5/23) were found in splicing regions (c.19631 and c.19643; c.20278 and c.20289; c.20612), with the majority detected between exons 18 and 19 (60.9%; 14/23). Further sequence analysis revealed that exons 18 and 20 showed a higher number of mutations (57.9%, 11/19 and 36.8%, 7/19, respectively), contrasting with the exon 22 that has only one mutation with a very high frequency (85%; 34/40; c.20940 T > G) and with exons 19 and 21 where no mutations were detected. Finally, when tumor samples were divided into four molecular subtypes, 71.4% of the triple-negative tumors (5/7), 58.3% of the HER2-positive (7/12) and 55.6% of the luminal B (10/18) showed at least one mutation. No mutations were detected in luminal A tumors (0/3).
A special consideration was made at exon 20, which encodes for the local binding of the TKi. In this exon 7 mutations were reported, in a total of 13 samples, and occurring 46.2% (6/13) in the HER2-positive tumor subtype. Furthermore, evaluating the SVs, 4 missense mutations (c.20380 C > G; c.20384 A > T; c.20428 G > C; c.20459 A > T), 2 synonymous mutations (c.20382 T > C; 20436 G > A) and 1 base change that leads to a STOP codon (c.20385 T > G) were observed.
After comparing the feline mutations with the genomic human her2 sequence, and searching in the referred databases, none of the mutations were reported as inducing resistance to TKi tested.
In order to identify new prognostic biomarkers, correlations were made between the SVs reported and animals’ clinicopathological features. This analysis did not reveal any correlation, beyond the mutation c.19573A > T, located in exon 18 associated with tumor size (* p = 0.045; Figure 6), revealing that the mean rank of the general samples was 2.64 cm ± 1.13, comparing with 4.13 cm ± 1.44, of the samples presenting that mutation.

4. Discussion

Feline mammary carcinoma is usually diagnosed belatedly, presenting an aggressive behavior, with the FMC HER2-positive showing a poor prognosis [3,8,35]. Therefore, an early detection and an effective therapy is crucial, in order to improve survival time in cats with mammary tumors. Thus, in this study, the antiproliferative effects of two TKi (lapatinib and neratinib) were evaluated using three FMC cell lines (CAT-M, FMCp and FMCm), with different HER2 expression levels and no mutations described as possibly conducing to resistance to therapy (Table S3). Moreover, the obtained results were compared to a human HER2-overexpressing breast cancer cell line (SkBR-3).
In therapeutic protocols, TKi inhibit the phosphorylation of EGFR family members, blocking its downstream pathways, such as lapatinib. This TKi was approved for solid, and metastatic HER2-positive breast tumors [36,37] preventing the phosphorylation of HER1 (T1173) and HER2 (T1221/1222), markers of poor prognosis in breast cancer patients [15,23]. Lapatinib was reported as inducing an antiproliferative effect in cells expressing different HER2 concentrations [38], as proved in this assay, being the HER2-positive CAT-M cells the most susceptible (IC50 = 3930 nM ± 49), with similar results obtained in the SkBR-3 cell line (IC50 = 16,220 nM ± 1040) [39,40,41,42]. Although, 100% of cytotoxicity was also observed in the HER2-negative FMCp cell line (IC50 = 4870 nM ± 100). Indeed, studies in humans demonstrated that lapatinib is useful in patients with triple-negative breast tumors, by activating NF-kB and the anti-apoptotic Bcl-2 protein [43], sensitizing tumor cells to the annexin A6 upregulation [44] and inducing apoptosis [45]. Furthermore, lapatinib also interacts with HER1, which is usually upregulated in triple-negative tumors, being suggested as an alternative therapeutic tool for patients with this breast cancer subtype [46,47]. In parallel, the metastatic cell line (FMCm) showed the highest IC50 value (17,470 nM ± 100), suggesting that in metastatic tumors, lapatinib is more useful when combined with other compounds [36,37]. In addition, the molecular effects of lapatinib seem to be conserved between human and feline cell lines, with CAT-M cells showing lower phosphorylation levels of HER2 (Y1221 + Y1222), HER1 (Y1173), AKT (S473) [41,48] and ERK1/2 (T202/Y204 + T185/Y187) [40,49,50,51,52] after lapatinib exposure. Results obtained also demonstrated that lapatinib reduced the phosphorylation levels of PTEN at T366, putatively through the glycogen synthase kinase 3 (GSK-3), playing a role in the destabilization of the protein, which leads to a more potent effect in the suppression of cancer cells proliferation [53]. Additionally, as previously reported in humans, lapatinib also increased the HER2 expression levels, possibly by stabilizing the protein at the cell membrane and inhibiting its ubiquitination [39]. Interestingly, this effect was also observed in the HER2-negative FMCp cell line, which could support the antiproliferative effects obtained by lapatinib.
The other TKi tested in this study was neratinib, a compound approved for the adjuvant treatment of early-stage and metastatic HER2-positive breast cancer (Food and Drug Administration). Interestingly, this TKi interacts with different EGFR family members (HER1, HER2 and HER4), inducing ubiquitination and lysosomal degradation of the HER2 [54], and it is able to reverse membrane-bound ATP transporters surpassing multidrug resistance [55]. In the neratinib assay cytotoxic effects were reported for all the FMC cell lines. Indeed, CAT-M cell line presented a maximum of 33.5% of cytotoxicity, smaller when compared to the human, SkBR-3 cell line (60.5% of cytotoxicity) [54], possibly due to CAT-M cells’ lower HER2 expression levels. Notably, the FMCp cell line presented a high sensitivity to neratinib (74.9% of cytotoxicity), suggesting its effect in other EGFR family members [20,56], and supporting the use of neratinib in HER2-negative breast cancer [57]. On the other hand, the metastatic FMCm cell line, revealed to be the less susceptible to neratinib (31.4% of cytotoxicity), suggesting its use as adjuvant in metastatic tumors [58,59]. Furthermore, in this cell line, the use of neratinib did not demonstrate a dose-dependent effect. This kind of behavior is documented for humans, e.g., by NmU overexpression [60], a protein involved in breast cancer progression and metastization [61], or by an increased activity of the enzyme cytochrome P4503A4 [62], leading to resistance to therapy. Additionally, after exposing cells to neratinib, it was not possible to demonstrate its molecular effects. In fact, only a slightly decrease in the phosphorylation levels of HER1 (Y1173) [63] were observed. Moreover, an increase in HER2 was obtained by exposure to neratinib, suggesting its stabilization at the cell membrane, by preventing protein phosphorylation.
Another valuable target in tumor therapy is the mTOR pathway, described as being hyperactivated in 80% of human cancers [64], and particularly in cats mTOR is involved in metastization, invasion and tumor progression [65]. The use of a mTOR inhibitor, rapamycin, in FMC cell lines revealed weak antiproliferative effects, similarly to the human SkBR-3 cell line, and as reported in humans [24,64,66]. However, the highest cytotoxic effect was obtained for the FMCp cell line (43.3% of cytotoxicity), corroborating the data that mTOR is frequently overexpressed in HER2-negative breast cancer [67]. Moreover, our results showed that the cytotoxicity of rapamycin did not demonstrate a dose-dependent effect, suggesting that cells were able to do the efflux of rapamycin, as reported in humans, by the overexpression of the ABCB1 transporter [68]. Additionally, evaluating the mTOR (S2448), using the CAT-M cell line as example, a decrease in its phosphorylation pattern was observed after exposure to rapamycin, as documented for women [24,69,70]. Since in breast cancer therapy several advantages are known to result from the combined treatments [19,71], and after the characterization of all the above compounds a synergistic effect of its combinations were demonstrated in the feline mammary carcinoma cell lines. The major advantage of this combined protocols is to block simultaneously different cell pathways, and overcome acquired resistant patterns, as documented for lapatinib, e.g., by HER3 [24] or HER4 activated pathways [23], cell signal reprogramming [72], recovering of the AKT/mTOR pathway [73], or Src-dependent resistance [40]. Furthermore, also for the TKi neratinib, acquired resistance is described, e.g., by NmU overexpression [60], or the reactivation of the proto-oncogene YES-1, a member of the Src family [74]. In the combined protocols, the best results were achieved in the FMCm cell line, with the highest increase in the cytotoxic effect occurring by the combination of lapatinib at 22,650 nM plus rapamycin at 6.25 nM, with an increase of 85.6% of cytotoxicity (from 9.6% to 95.2%), and for the combination of neratinib at 25 nM plus rapamycin at 6.25 nM, where an increase of 66.7% of cytotoxicity (from 9.6% to 76.3%) was obtained. The reported results, suggest the use of combined protocols as a valuable tool for feline mammary tumor therapy, as described for women breast cancer patients [19,71], particularly in metastatic [36,37] and triple-negative tumors [71]. Indeed, for the FMCp cell line, HER2-negative, an increase in 47.5% of cytotoxicity (from 6.9% to 54.4%) was obtained in the conjugation of lapatinib at 780 nM plus rapamycin at 6.25 nM, and by the use of neratinib at 3.125 nM plus rapamycin at 6.25 nM, where an increase of 44.1% of cytotoxicity (from 0.4% to 44.5%) was observed.
Beyond the referred acquired resistance to TKi, genomic mutations could also be responsible for a resistant profile to lapatinib, as well as neratinib. In breast cancer patients is known that her2 is mutated in 2 to 3% of primary tumors and more than 70% of the mutations occurs in HER2-negative breast cancer subtype [75], as in the FMC tumor tissue samples. In this study, a total of 42 different SVs were found in the feline her2-TK domain, with 90% (36/40) of the clinical samples showing at least one mutation. Furthermore, mutations revealed to be more common in intronic regions (54.8%; 23/42), particularly, between the exon 18 and 19 (60.9%), with 21.7% of them being identified in the splicing regions. The intron splicing locations revealed to be of extreme importance [76], as already reported in her2 gene in cats [77] and in women, being associated with breast cancer risk [78] and responsible for resistance to therapy [79,80]. Regarding the exons, several mutations were found (45.2%; 19/42), with the majority of them showing a low frequency. Most of the mutations identified were located at the exon 18 (57.9%), being the heterozygous synonymous mutation c.19573 A > C associated to larger tumor sizes (p = 0.044) and occurring in luminal B and triple-negative carcinoma subtypes. Considering exon 20, which encodes for the location recognized by both TKi [18,19], it comprises 36.8% of the mutations, in the FMC clinical samples. In the case of breast cancer patients mutations within this exon, they were reported to increase the HER2 catalytic activity [81,82], being the L755 (e.g., L755S and L755P), associated with resistance to lapatinib therapy [58,81,83,84], and L869R, together with T798I, promoting HER2 signaling and oncogenic growth, associated to neratinib acquired resistance [22,58]. Moreover, a rare mutation in breast tumors was identified in the feline luminal B and HER2-positive tumor subtypes, c.20385 T > G, that encodes for a STOP codon, leading to a truncated form of the protein and being associated with therapeutic resistance [85]. Furthermore, the mutations described should not compromise the use of TKi in cats, since none of them were described as inducing resistance to therapy in breast cancer patients, according to National Cancer Institute database, International Cancer Genome Consortium and COSMIC databases.

5. Conclusions

Beyond the cat being considered a noble breast cancer model, in this study it was possible to demonstrate valuable antiproliferative effects, and a conserved action mechanism of lapatinib and neratinib in three distinct feline mammary carcinoma cell lines, similarly to the results reported in the human breast cancer cell line (SkBR-3). Moreover, the obtained data suggests the use of FMC cell lines as in vitro tools for screening of new therapeutic drugs. In this study, the best results were achieved by the use of lapatinb, being possible to demonstrate a decrease in the phosphorylation pattern of the EGFR family members and its downstream pathways. Furthermore, combined assays with TKi and mTOR inhibitor showed synergistic effects, anticipating the benefits of using small drug doses. Since mutations found suggest that TKi-resistant FMC are very rare, altogether, our in vitro results strongly suggest the potential usefulness of TKi alone or combined with rapamycin in the treatment of cats with feline mammary carcinoma.

Supplementary Materials

The following are available online at https://0-www-mdpi-com.brum.beds.ac.uk/1999-4923/13/3/346/s1, Table S1: Immunohistochemic characterization of the FMC cell lines (CAT-M, FMCp and FMCm), and the human breast cancer cell line (SkBR-3); Table S2: Analysis of the her2 TK domain mutations in the feline mammary carcinoma clinical samples. DNA samples were acquired from tumor mammary tissues, and PCR and sequencing steps were performed with specific primers; Table S3: Feline cell lines presented a few number of mutations in the feline her2 TK domain, and none of them were described in women, as leading to TKi resistance. DNA samples were acquired from the cells in culture, and PCR and sequencing steps were performed with specific primers.

Author Contributions

A.G. and F.F. conceived and designed the experiments. A.G. performed the experiments. A.G., F.A., C.N., J.C. and F.F. analyzed and interpreted the data. F.F. funding acquisition. F.F. methodology. F.F. supervision. F.F. project administration. A.G., F.F. Writing—Original draft. A.G., F.F., F.A., C.N., J.C. Writing—Review & editing. All authors contributed to and approved the final manuscript.

Funding

This research was funded by Fundação para a Ciência e a Tecnologia (Portugal) through the projects PTDC/CVT-EPI/3638/2014 and UIDB/00276/2020. A.G. is receipt of a PhD fellowship from Fundação para a Ciência e a Tecnologia (ref. SFRH/BD/132260/2017) and C.N. is receipt of a PhD fellowship from University of Lisbon (ref.C00191r).

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki, and in accordance with EU Directive 2010/63/EU and national legislation (DL113/2013). Furthermore, samples were collected after informed consent from cat owners and with no interference with the animals’ well-being.

Informed Consent Statement

Not applicable.

Data Availability Statement

The datasets used and analyzed in the current study are available from the corresponding author in response to reasonable requests.

Acknowledgments

The authors would like to thank to Raffaella De Maria, University of Turin, Department of Veterinary Sciences, Italy that gave us all the feline cell lines (originally property from Nobuo Sasaki (DVM) and Takayuki Nakagawa (DVM), from Graduate School of Frontier Science, University of Tokyo, Japan). We also would like to thank to Luís Costa, Molecular Medicine Institute, University of Lisbon, Portugal, that kindly ceded the human breast cancer cell line, SkBR-3.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

References

  1. Millanta, F.; Calandrella, M.; Citi, S.; della Santa, D.; Poli, A. Overexpression of HER-2 in feline invasive mammary carcinomas: An immunohistochemical survey and evaluation of its prognostic potential. Vet. Pathol. 2005, 42, 30–34. [Google Scholar] [CrossRef] [PubMed]
  2. Soares, M.; Ribeiro, R.; Najmudin, S.; Gameiro, A.; Rodrigues, R.; Cardoso, F.; Ferreira, F. Serum HER2 levels are increased in cats with mammary carcinomas and predict tissue HER2 status. Oncotarget 2016, 7, 17314–17326. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Soares, M.; Madeira, S.; Correira, J.; Peleteiro, M.; Cardoso, F.; Ferreira, F. Molecular based subtyping of feline mammary carcinomas and clinicopathological characterization. Breast 2016, 27, 44–51. [Google Scholar] [CrossRef] [PubMed]
  4. Cannon, C. Cats, Cancer and Comparative Oncology. Vet. Sci. 2015, 2, 111–126. [Google Scholar] [CrossRef]
  5. Porrello, A.; Cardelli, P.; Spugnini, E.P. Oncology of companion animals as a model for humans. An overview of tumor histotypes. J. Exp. Clin. Cancer Res. 2006, 25, 97–105. [Google Scholar]
  6. Vail, D.M.; Macewen, E.G. Spontaneously Occurring Tumors of Companion Animals as Models for Human Cancer. Cancer Investig. 2000, 18, 781–792. [Google Scholar] [CrossRef] [PubMed]
  7. Ranieri, G.; Pantaleo, M.; Piccinno, M.; Roncetti, M.; Mutinati, M.; Marech, I.; Patruno, R.; Rizzo, A.; Sciorsci, R.L. Tyrosine kinase inhibitors (TKIs) in human and pet tumours with special reference to breast cancer: A comparative review. Crit. Rev. Oncol. Hematol. 2013, 88, 293–308. [Google Scholar] [CrossRef]
  8. Vu, T.; Claret, F.X. Trastuzumab: Updated Mechanisms of Action and Resistance in Breast Cancer. Front. Oncol. 2012, 2, 1–6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  9. Budiarto, B.R. Detection of HER2 Gene Polymorphism in Breast Cancer: PCR Optimization Study. Sci. Pharm. 2016, 84, 103–111. [Google Scholar] [CrossRef] [Green Version]
  10. Soares, M.; Correia, J.; Rodrigues, P.; Simões, M.; Matos, A.; de Ferreira, F. Feline HER2 Protein Expression Levels and Gene Status in Feline Mammary Carcinoma: Optimization of Immunohistochemistry (IHC) and In Situ Hybridization (ISH) Techniques. Microsc. Microanal. 2013, 19, 876–882. [Google Scholar] [CrossRef]
  11. Michishita, M.; Ohtsuka, A.; Nakahira, R.; Tajima, T.; Nakagawa, T.; Sasaki, N.; Arai, T.; Takahashi, K. Anti-tumor effect of bevacizumab on a xenograft model of feline mammary carcinoma. J. Vet. Med. Sci. 2016, 78, 685–689. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Maria, R.D.; Olivero, M.; Iussich, S.; Nakaichi, M.; Murata, T.; Biolatti, B.; Flavia, M.; Renzo, D. Spontaneous Feline Mammary Carcinoma Is a Model of HER2 Overexpressing Poor Prognosis Human Breast Cancer. Cancer Res. 2005, 65, 907–912. [Google Scholar] [PubMed]
  13. Santos, S.; Baptista, C.S.; Abreu, R.M.; Bastos, E.; Amorim, I.; Gut, I.G.; Gärtner, F.; Chaves, R. ERBB2 in cat mammary neoplasias disclosed a positive correlation between RNA and protein low expression levels: A model for erbB-2 negative human breast cancer. PLoS ONE 2013, 8, e83673. [Google Scholar] [CrossRef]
  14. Tiwari, S.R.; Mishra, P.; Abraham, J. Neratinib, A Novel HER2-Targeted Tyrosine Kinase Inhibitor. Clin. Breast Cancer 2015, 16, 344–348. [Google Scholar] [CrossRef]
  15. Frogne, T.; Laenkholm, A.; Lyng, M.B.; Henriksen, K.L.; Lykkesfeldt, A.E. Research article Determination of HER2 phosphorylation at tyrosine 1221/1222 improves prediction of poor survival for breast cancer patients with hormone receptor-positive tumors. Breast Cancer Res. 2009, 11, 1–14. [Google Scholar] [CrossRef] [Green Version]
  16. Schroeder, R.L.; Stevens, C.L.; Sridhar, J. Small molecule tyrosine kinase inhibitors of ErbB2/HER2/Neu in the treatment of aggressive breast cancer. Molecules 2014, 19, 15196–15212. [Google Scholar] [CrossRef] [Green Version]
  17. Shi, H.; Zhang, W.; Zhi, Q.; Jiang, M. Lapatinib resistance in HER2+ cancers: Latest findings and new concepts on molecular mechanisms. Tumor Biol. 2016, 37, 15411–15431. [Google Scholar] [CrossRef] [PubMed]
  18. Sun, Y.; Feng, X.; Qu, J.; Han, W.; Liu, Z.; Li, X.; Zou, M.; Zhen, Y.; Zhu, J. Expression and Characterization of the Extracellular Domain of Human HER2 from Escherichia Coli, and Production of Polyclonal Antibodies against the Recombinant Proteins. Appl. Biochem. Biotechnol. 2015, 176, 1029–1043. [Google Scholar] [CrossRef] [PubMed]
  19. Kong, A.; Feldinger, K. Profile of neratinib and its potential in the treatment of breast cancer. Breast Cancer Targets Ther. 2015, 7, 147–162. [Google Scholar] [CrossRef] [Green Version]
  20. Nagpal, A.; Redvers, R.P.; Ling, X.; Ayton, S.; Fuentes, M.; Tavancheh, E.; Diala, I.; Lalani, A.; Loi, S.; David, S.; et al. Neoadjuvant neratinib promotes ferroptosis and inhibits brain metastasis in a novel syngeneic model of spontaneous HER2+ve breast cancer metastasis. Breast Cancer Res. 2019, 21, 1–19. [Google Scholar] [CrossRef] [PubMed]
  21. Lu, B.; Chen, X.B.; Ying, M.D.; He, Q.J.; Cao, J.; Yang, B. The role of ferroptosis in cancer development and treatment response. Front. Pharmacol. 2018, 8, 1–8. [Google Scholar] [CrossRef] [PubMed]
  22. Hanker, A.B.; Brewer, M.R.; Sheehan, J.H.; Koch, J.P.; Sliwoski, G.R.; Nagy, R.; Lanman, R.; Berger, M.F.; Hyman, D.M.; Solit, D.B.; et al. An acquired HER2T798I gatekeeper mutation induces resistance to neratinib in a patient with HER2 mutant-driven breast cancer. Cancer Discov. 2017, 7, 575–585. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Canfiel, K.; Li, J.; Wilkins, O.M.; Morrison, M.M.; Ung, M.; Wells, W.; Williams, C.R.; Liby, K.T.; Vullhorst, D.; Buonanno, A.; et al. Receptor tyrosine kinase ERBB4 mediates acquired resistance to ERBB2 inhibitors in breast cancer cells. Cell Cycle 2015, 14, 648–655. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Noh, W.; Mondesire, W.H.; Peng, J.; Jian, W.; Zhang, H. Determinants of Rapamycin Sensitivity in Breast Cancer Cells. Clin. Cancer Res. 2004, 10, 1013–1023. [Google Scholar] [CrossRef] [Green Version]
  25. Jhanwar-Uniyal, M.; Wainwright, J.V.; Mohan, A.L.; Tobias, M.E.; Murali, R.; Gandhi, C.D.; Schmidt, M.H. Diverse signaling mechanisms of mTOR complexes: mTORC1 and mTORC2 in forming a formidable relationship. Adv. Biol. Regul. 2019, 72, 51–62. [Google Scholar] [CrossRef] [PubMed]
  26. Almeida, F.; Gameiro, A.; Correia, J.; Ferreira, F. Histone Deacetylase Inhibitors and Microtubule Inhibitors Induce Apoptosis in Feline Luminal Mammary Carcinoma Cells. Animals 2021, 11, 502. [Google Scholar] [CrossRef]
  27. Okita, R.; Uhiko Shimizu, K.; Nojima, Y.; Yukawa, T.; Maeda, A.; Saisho, S.; Nakata, M. Lapatinib enhances trastuzumab-mediated antibody-dependent cellular cytotoxicity via upregulation of HER2 in malignant mesothelioma cells. Oncol. Rep. 2015, 34, 2864–2870. [Google Scholar] [CrossRef] [Green Version]
  28. Chiang, G.G.; Abraham, R.T. Phosphorylation of mammalian target of rapamycin (mTOR) at Ser-2448 is mediated by p70S6 kinase. J. Biol. Chem. 2005, 280, 25485–25490. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  29. Soares, M.; Ribeiro, R.; Carvalho, S.; Peleteiro, M.; Correia, J.; Ferreira, F. Ki-67 as a Prognostic Factor in Feline Mammary Carcinoma: What Is the Optimal Cutoff Value? Vet. Pathol. 2016, 53, 37–43. [Google Scholar] [CrossRef] [Green Version]
  30. Elston, C.W.; Ellis, I.O. Assessment of Histological Grade. Syst. Pathol. 1998, 3, 365–384. [Google Scholar]
  31. Santos, S.; Sá, D.; Bastos, E.; Guedes-Pinto, H.; Gut, I.; Gärtner, F.; Chaves, R. An efficient protocol for genomic DNA extraction from formalin-fixed paraffin-embedded tissues. Res. Vet. Sci. 2009, 86, 421–426. [Google Scholar] [CrossRef] [PubMed]
  32. Ferreira, D.; Soares, M.; Correia, J.; Adega, F.; Ferreira, F.; Chaves, R. Assessment of ERRB2 and TOP2α gene status and expression profile in feline mammary tumors: Findings and guidelines. Aging 2019, 11, 4688. [Google Scholar] [CrossRef] [PubMed]
  33. Nascimento, C.; Urbano, A.C.; Gameiro, A.; Correia, J.; Ferreira, F. Serum PD-1/PD-L1 Levels, Tumor Expression and PD-L1 Somatic Mutations in HER2-Positive and Triple Negative Normal-Like Feline Mammary Carcinoma Subtypes. Cancers 2020, 12, 1386. [Google Scholar] [CrossRef]
  34. Stucky, B.J. Seqtrace: A graphical tool for rapidly processing DNA sequencing chromatograms. J. Biomol. Tech. 2012, 23, 90–93. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Soares, M.; Correia, J.; Peleteiro, M.C.; Ferreira, F. St Gallen molecular subtypes in feline mammary carcinoma and paired metastases—disease progression and clinical implications from a 3-year follow-up study. Tumor Biol. 2016, 37, 4053–4064. [Google Scholar] [CrossRef]
  36. Opdam, F.L.; Guchelaar, H.; Beijnen, J.H.; Schellens, J.H.M. Lapatinib for Advanced or Metastatic Breast Cancer. Oncologist 2012, 17, 536–542. [Google Scholar] [CrossRef] [Green Version]
  37. Frenel, J.S.; Bourbouloux, E.; Berton-Rigaud, D.; Sadot-Lebouvier, S.; Zanetti, A.; Campone, M. Lapatinib in metastatic breast cancer. Women’s Health 2009, 5, 603–612. [Google Scholar] [CrossRef] [Green Version]
  38. Segovia-Mendoza, M.; González-González, M.E.; Barrera, D.; Díaz, L.; García-Becerra, R. Efficacy and mechanism of action of the tyrosine kinase inhibitors gefitinib, lapatinib and neratinib in the treatment of her2-positive breast cancer: Preclinical and clinical evidence. Am. J. Cancer Res. 2015, 5, 2531–2561. [Google Scholar]
  39. Scaltriti, M.; Verma, C.; Guzman, M.; Jimenez, J.; Parra, J.L.; Pedersen, K.; Smith, D.J.; Landolfi, S.; Ramon y Cajal, S.; Arribas, J.; et al. Lapatinib, a HER2 tyrosine kinase inhibitor, induces stabilization and accumulation of HER2 and potentiates trastuzumab-dependent cell cytotoxicity. Oncogene 2009, 28, 803–814. [Google Scholar] [CrossRef] [Green Version]
  40. Formisano, L.; Nappi, L.; Rosa, R.; Marciano, R.; D’Amato, C.; D’Amato, V.; Damiano, V.; Raimondo, L.; Iommelli, F.; Scorziello, A.; et al. Epidermal growth factor-receptor activation modulates Src-dependent resistance to lapatinib in breast cancer models. Breast Cancer Res. 2014, 16, 1–15. [Google Scholar] [CrossRef] [Green Version]
  41. Matsumoto, A.; Hayashida, T.; Takahashi, M.; Jinno, H.; Kitagawa, Y. Antitumor effect of lapatinib and cytotoxic agents by suppression of E2F1 in HER2-positive breast cancer. Mol. Med. Rep. 2018, 18, 958–964. [Google Scholar] [CrossRef]
  42. Hegde, P.S.; Rusnak, D.; Bertiaux, M.; Alligood, K.; Strum, J.; Gagnon, R.; Gilmer, T.M. Delineation of molecular mechanisms of sensitivity to lapatinib in breast cancer cell lines using global gene expression profiles. Mol. Cancer Ther. 2007, 6, 1629–1640. [Google Scholar] [CrossRef] [Green Version]
  43. Chen, Y.J.; Yeh, M.H.; Yu, M.C.; Wei, Y.L.; Chen, W.S.; Chen, J.Y.; Shih, C.Y.; Tu, C.Y.; Chen, C.H.; Hsia, T.C.; et al. Lapatinib-induced NF-kappaB activation sensitizes triple-negative breast cancer cells to proteasome inhibitors. Breast Cancer Res. 2013, 15. [Google Scholar] [CrossRef] [Green Version]
  44. Widatalla, S.E.; Korolkova, O.Y.; Whalen, D.S.; Goodwin, J.S.; Williams, K.P.; Ochieng, J.; Sakwe, A.M. Lapatinib-induced annexin A6 upregulation as an adaptive response of triple-negative breast cancer cells to EGFR tyrosine kinase inhibitors. Carcinogenesis 2019, 40, 998–1009. [Google Scholar] [CrossRef] [Green Version]
  45. Liu, C.Y.; Hu, M.H.; Hsu, C.J.; Huang, C.T.; Wang, D.S.; Tsai, W.C.; Chen, Y.T.; Lee, C.H.; Chu, P.Y.; Hsu, C.C.; et al. Lapatinib inhibits CIP2A/PP2A/p-Akt signaling and induces apoptosis in triple negative breast cancer cells. Oncotarget 2016, 7, 9135–9149. [Google Scholar] [CrossRef] [Green Version]
  46. Nielsen, T.O.; Hsu, F.D.; Jensen, K.; Cheang, M.; Karaca, G.; Hu, Z.; Hernandez-Boussard, T.; Livasy, C.; Cowan, D.; Dressler, L.; et al. Immunohistochemical and clinical characterization of the basal-like subtype of invasive breast carcinoma. Clin. Cancer Res. 2004, 10, 5367–5374. [Google Scholar] [CrossRef] [Green Version]
  47. Bouchalova, K.; Cizkova, M.; Cwiertka, K.; Trojanec, R.; Hajduch, M. Triple negative breast cancer—Current status and prospective targeted treatment based on her1 (EGFR), TOP2A and C-MYC gene assessment. Biomed. Pap. 2009, 153, 13–18. [Google Scholar] [CrossRef] [PubMed]
  48. Manning, B.D.; Toker, A. AKT/PKB Signaling: Navigating the Network. Cell 2017, 169, 381–405. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  49. Appert-Collin, A.; Hubert, P.; Crémel, G.; Bennasroune, A. Role of ErbB receptors in cancer cell migration and invasion. Front. Pharmacol. 2015, 6, 1–10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  50. Ma, Z.; Parris, A.B.; Xiao, Z.; Howard, E.W.; Kosanke, S.D.; Feng, X.; Yang, X. Short-term early exposure to lapatinib confers lifelong protection from mammary tumor development in MMTV-ERBB-2 transgenic mice. J. Exp. Clin. Cancer Res. 2017, 36, 1–13. [Google Scholar] [CrossRef] [Green Version]
  51. Xia, W.; Mullin, R.J.; Keith, B.R.; Liu, L.H.; Ma, H.; Rusnak, D.W.; Owens, G.; Alligood, K.J.; Spector, N.L. Anti-tumor activity of GW572016: A dual tyrosine kinase inhibitor blocks EGF activation of EGFR/erbB2 and downstream Erk1/2 and AKT pathways. Oncogene 2002, 21, 6255–6263. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  52. Tanizaki, J.; Okamoto, I.; Fumita, S.; Okamoto, W.; Nishio, K.; Nakagawa, K. Roles of BIM induction and survivin downregulation in lapatinib-induced apoptosis in breast cancer cells with HER2 amplification. Oncogene 2011, 30, 4097–4106. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  53. Maccario, H.; Perera, N.M.; Davidson, L.; Downes, C.P.; Leslie, N.R. PTEN is destabilized by phosphorylation on Thr366. Biochem. J. 2007, 405, 439–444. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  54. Zhang, Y.; Zhang, J.; Liu, C.; Du, S.; Feng, L.; Luan, X.; Zhang, Y.; Shi, Y.; Wang, T.; Wu, Y.; et al. Neratinib induces ErbB2 ubiquitylation and endocytic degradation via HSP90 dissociation in breast cancer cells. Cancer Lett. 2016, 382, 176–185. [Google Scholar] [CrossRef] [PubMed]
  55. Zhao, X.-Q.; Xie, J.-D.; Chen, X.-G.; Sim, H.M.; Zhang, X.; Liang, Y.-J.; Singh, S.; Talele, T.T.; Sun, Y.; Ambudkar, S.V.; et al. Neratinib Reverses ATP-Binding Cassette B1-Mediated Chemotherapeutic Drug Resistance In Vitro, In Vivo, and Ex Vivo. Mol. Pharmacol. 2012, 82, 47–58. [Google Scholar] [CrossRef] [Green Version]
  56. McGowan, P.M.; Mullooly, M.; Caiazza, F.; Sukor, S.; Madden, S.F.; Maguire, A.A.; Pierce, A.; McDermott, E.W.; Crown, J.; O’Donovan, N.; et al. ADAM-17: A novel therapeutic target for triple negative breast cancer. Ann. Oncol. 2013, 24, 362–369. [Google Scholar] [CrossRef]
  57. Mullooly, M.; Conklin, D.; McGowan, P.M.; O’Brien, N.A.; O’Donovan, N.; Slamon, D.J.; Crown, J.; Finn, R.S.; Duffy, M.J. Neratinib to inhibit the growth of triple-negative breast cancer cells. J. Clin. Oncol. 2015, 33, 1099. [Google Scholar] [CrossRef]
  58. Collins, D.M.; Conlon, N.T.; Kannan, S.; Verma, C.S.; Eli, L.D.; Lalani, A.S.; Crown, J. Preclinical characteristics of the irreversible pan-her kinase inhibitor neratinib compared with lapatinib: Implications for the treatment of HER2-positive and HER2-mutated breast cancer. Cancers 2019, 11, 737. [Google Scholar] [CrossRef] [Green Version]
  59. Crown, J.; O’Shaughnessy, J.; Gullo, G. Emerging targeted therapies in triple-negative breast cancer. Ann. Oncol. 2012, 23, vi56–vi65. [Google Scholar] [CrossRef]
  60. Rani, S.; Corcoran, C.; Shiels, L.; Germano, S.; Breslin, S.; Madden, S.; McDermott, M.S.; Browne, B.C.; O’Donovan, N.; Crown, J.; et al. Neuromedin U: A candidate biomarker and therapeutic target to predict and overcome resistance to HER-tyrosine kinase inhibitors. Cancer Res. 2014, 74, 3821–3833. [Google Scholar] [CrossRef] [Green Version]
  61. Garczyk, S.; Klotz, N.; Szczepanski, S.; Denecke, B.; Antonopoulos, W.; von Stillfried, S.; Knüchel, R.; Rose, M.; Dahl, E. Oncogenic features of neuromedin U in breast cancer are associated with NMUR2 expression involving crosstalk with members of the WNT signaling pathway. Oncotarget 2017, 8, 36246–36265. [Google Scholar] [CrossRef] [Green Version]
  62. Breslin, S.; Lowry, M.C.; O’Driscoll, L. Neratinib resistance and cross-resistance to other HER2-targeted drugs due to increased activity of metabolism enzyme cytochrome P4503A4. Br. J. Cancer 2017, 116, 620–625. [Google Scholar] [CrossRef]
  63. Rabindran, S.K.; Discafani, C.M.; Rosfjord, E.C.; Baxter, M.; Floyd, M.B.; Golas, J.; Hallett, W.A.; Johnson, B.D.; Nilakantan, R.; Overbeek, E.; et al. Antitumor activity of HKI-272, an orally active, irreversible inhibitor of the HER-2 tyrosine kinase. Cancer Res. 2004, 64, 3958–3965. [Google Scholar] [CrossRef] [Green Version]
  64. Watanabe, R.; Wei, L.; Huang, J. mTOR Signaling, Function, Novel Inhibitors, and Therapeutic Targets. J. Nucl. Med. 2011, 52, 497–501. [Google Scholar] [CrossRef] [Green Version]
  65. Maniscalco, L.; Millan, Y.; Iussich, S.; Denina, M.; Sanchez-Cespedes, R.; Gattino, F.; Biolatti, B.; Sasaki, N.; Nakagawa, T.; Di Renzo, M.F.; et al. Activation of mammalian target of rapamycin (mTOR) in triple negative feline mammary carcinomas. BMC Vet. Res. 2013, 9, 80. [Google Scholar] [CrossRef] [Green Version]
  66. Zheng, J.; Zou, X.; Yao, J. The Antitumor Effect of GDC-0941 Alone and in Combination with Rapamycin in Breast Cancer Cells. Chemotherapy 2012, 58, 273–281. [Google Scholar] [CrossRef] [PubMed]
  67. Walsh, S.; Flanagan, L.; Quinn, C.; Evoy, D.; McDermott, E.W.; Pierce, A.; Duffy, M.J. MTOR in breast cancer: Differential expression in triple-negative and non-triple-negative tumors. Breast 2012, 21, 178–182. [Google Scholar] [CrossRef] [PubMed]
  68. Wang, J.; Yang, D.H.; Yang, Y.; Wang, J.Q.; Cai, C.Y.; Lei, Z.N.; Teng, Q.X.; Wu, Z.X.; Zhao, L.; Chen, Z.S. Overexpression of ABCB1 transporter confers resistance to mTOR inhibitor WYE-354 in cancer cells. Int. J. Mol. Sci. 2020, 21, 1387. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  69. Liu, B.; Fan, Z.; Edgerton, S.M.; Yang, X.; Lind, S.E.; Thor, A.D. Potent anti-proliferative effects of metformin on trastuzumab-resistant breast cancer cells via inhibition of ErbB2/IGF-1 receptor interactions. Cell Cycle 2011, 10, 2959–2966. [Google Scholar] [CrossRef] [Green Version]
  70. Zhang, J.W.; Zhao, F.; Sun, Q. Metformin synergizes with rapamycin to inhibit the growth of pancreatic cancer in vitro and in vivo. Oncol. Lett. 2018, 15, 1811–1816. [Google Scholar] [CrossRef]
  71. Liu, T.; Yacoub, R.; Taliaferro-Smith, L.D.; Sun, S.-Y.; Graham, T.R.; Dolan, R.; Lobo, C.; Tighiouart, M.; Yang, L.; Adams, A.; et al. Combinatorial Effects of Lapatinib and Rapamycin in Triple-Negative Breast Cancer Cells. Mol. Cancer Ther. 2011, 10, 1460–1469. [Google Scholar] [CrossRef] [Green Version]
  72. Ruprecht, B.; Zaal, E.A.; Zecha, J.; Wu, W.; Berkers, C.R.; Kuster, B.; Lemeer, S. Lapatinib Resistance in Breast Cancer Cells Is Accompanied by Phosphorylation-Mediated Reprogramming of Glycolysis. Cancer Res. 2017, 77, 1842–1854. [Google Scholar] [CrossRef] [Green Version]
  73. Liu, L.; Greger, J.; Shi, H.; Liu, Y.; Greshock, J.; Annan, R.; Halsey, W.; Sathe, G.M.; Martin, A.M.; Gilmer, T.M. Novel mechanism of lapatinib resistance in HER2-positive breast tumor cells: Activation of AXL. Cancer Res. 2009, 69, 6871–6878. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  74. Takeda, T.; Yamamoto, H.; Suzawa, K.; Tomida, S.; Miyauchi, S.; Araki, K.; Nakata, K.; Miura, A.; Namba, K.; Shien, K.; et al. YES1 activation induces acquired resistance to neratinib in HER2-amplified breast and lung cancers. Cancer Sci. 2020, 111, 849–856. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  75. Mishra, R.; Hanker, A.B.; Garrett, J.T. Genomic alterations of ERBB receptors in cancer: Clinical implications. Oncotarget 2017, 8, 114371–114392. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  76. Diederichs, S.; Bartsch, L.; Berkmann, J.C.; Fröse, K.; Heitmann, J.; Hoppe, C.; Iggena, D.; Jazmati, D.; Karschnia, P.; Linsenmeier, M.; et al. The dark matter of the cancer genome: Aberrations in regulatory elements, untranslated regions, splice sites, non-coding RNA and synonymous mutations. EMBO Mol. Med. 2016, 8, 442–457. [Google Scholar] [CrossRef]
  77. Santos, S.; Bastos, E.; Baptista, C.S.; Sá, D.; Caloustian, C.; Guedes-Pinto, H.; Gärtner, F.; Gut, I.G.; Chaves, R. Sequence variants and haplotype analysis of cat ERBB2 gene: A survey on spontaneous cat mammary neoplastic and non-neoplastic lesions. Int. J. Mol. Sci. 2012, 13, 2783–2800. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  78. Høberg-Vetti, H.; Ognedal, E.; Buisson, A.; Vamre, T.B.A.; Ariansen, S.; Hoover, J.M.; Eide, G.E.; Houge, G.; Fiskerstrand, T.; Haukanes, B.I.; et al. The intronic BRCA1 c.5407-25T>A variant causing partly skipping of exon 23—A likely pathogenic variant with reduced penetrance? Eur. J. Hum. Genet. 2020, 28, 1078–1086. [Google Scholar] [CrossRef]
  79. Castagnoli, L.; Ladomery, M.; Tagliabue, E.; Pupa, S.M. The d16HER2 splice variant: A friend or foe of HER2-positive cancers? Cancers 2019, 11, 902. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  80. Anczuków, O.; Buisson, M.; Léońe, M.; Coutanson, C.; Lasset, C.; Calender, A.; Sinilnikova, O.M.; Mazoyer, S. BRCA2 deep intronic mutation causing activation of a cryptic exon: Opening toward a new preventive therapeutic strategy. Clin. Cancer Res. 2012, 18, 4903–4909. [Google Scholar] [CrossRef] [Green Version]
  81. Sun, Z. Analysis of different HER-2 mutations in breast cancer progression and drug resistance The HER-2 mutations and variants. J. Cell. Mol. Med. 2015, 19, 2691–2701. [Google Scholar] [CrossRef] [PubMed]
  82. Wang, S.E.; Narasanna, A.; Perez-Torres, M.; Xiang, B.; Wu, F.Y.; Yang, S.; Carpenter, G.; Gazdar, A.F.; Muthuswamy, S.K.; Arteaga, C.L. HER2 kinase domain mutation results in constitutive phosphorylation and activation of HER2 and EGFR and resistance to EGFR tyrosine kinase inhibitors. Cancer Cell 2006, 10, 25–38. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  83. Xu, X.; De Angelis, C.; Burke, K.A.; Nardone, A.; Hu, H.; Qin, L.; Veeraraghavan, J.; Sethunath, V.; Heiser, L.M.; Wang, N.; et al. HER2 reactivation through acquisition of the HER2 L755S mutation as a mechanism of acquired resistance to HER2-targeted therapy in HER2+breast cancer. Clin. Cancer Res. 2017, 23, 5123–5134. [Google Scholar] [CrossRef] [Green Version]
  84. Kancha, R.K.; von Bubnoff, N.; Bartosch, N.; Peschel, C.; Engh, R.A.; Duyster, J. Differential sensitivity of ERBB2 kinase domain mutations towards lapatinib. PLoS ONE 2011, 6, e26760. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  85. Scott, G.K.; Robles, R.; Park, J.W.; Montgomery, P.A.; Daniel, J.; Holmes, W.E.; Lee, J.; Keller, G.A.; Li, W.L.; Fendly, B.M. A truncated intracellular HER2/neu receptor produced by alternative RNA processing affects growth of human carcinoma cells. Mol. Cell. Biol. 1993, 13, 2247–2257. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Figure 1. Lapatinib and neratinib showed strong cytotoxic effects in feline mammary carcinoma cell lines. (A) CAT-M cell line presented higher cytotoxic effects when incubated with lapatinib (IC50 = 3930 nM ± 49) than with neratinib. (B) FMCp cell line was susceptible to both lapatinib and neratinib (100% and 74.9% of cytotoxicity, respectively; IC50 = 4870 nM ± 100 for lapatinib). (C) FMCm cell line also showed high cytotoxic effects in the presence of lapatinib (IC50 = 17,470 nM ± 100), contrasting with the neratinib. (D) SkBR-3 cells showed a maximum cytotoxic effect of 91.1% (IC50 = 16,220 nM ± 1040) after exposure to lapatinib and 66.0% when exposed to neratinib. For graphical convenience, lapatinib was represented in a µM range, while neratinib was defined in a nM range. The experiments were performed in triplicates, in three independent assays.
Figure 1. Lapatinib and neratinib showed strong cytotoxic effects in feline mammary carcinoma cell lines. (A) CAT-M cell line presented higher cytotoxic effects when incubated with lapatinib (IC50 = 3930 nM ± 49) than with neratinib. (B) FMCp cell line was susceptible to both lapatinib and neratinib (100% and 74.9% of cytotoxicity, respectively; IC50 = 4870 nM ± 100 for lapatinib). (C) FMCm cell line also showed high cytotoxic effects in the presence of lapatinib (IC50 = 17,470 nM ± 100), contrasting with the neratinib. (D) SkBR-3 cells showed a maximum cytotoxic effect of 91.1% (IC50 = 16,220 nM ± 1040) after exposure to lapatinib and 66.0% when exposed to neratinib. For graphical convenience, lapatinib was represented in a µM range, while neratinib was defined in a nM range. The experiments were performed in triplicates, in three independent assays.
Pharmaceutics 13 00346 g001
Figure 2. Feline cell lines presented low HER2 expression, showing altered phosphorylation levels of HER2 and its downstream effectors after TKi exposure. (A) CAT-M and FMCm cell lines presented low HER2 expression levels, with no expression detected in the FMCp cell line. (B) After exposure to lapatinib, the CAT-M cell line showed decreased phosphorylation levels of the HER1 (pY1173), HER2 (pY1221 + Y1222) and of its downstream effectors, AKT1 (pS473) and ERK1/2 (pT202/pY204 + pT185/pY187), coupled in an increased of PTEN phosphorylation at Thr366. Results were less perceptible when cells were exposed to neratinib. (C) TKi exposure, particularly, lapatinib, increased HER2 levels not only in CAT-M cells, but also in (D) FMCp cells. β-actin was used as loading control.
Figure 2. Feline cell lines presented low HER2 expression, showing altered phosphorylation levels of HER2 and its downstream effectors after TKi exposure. (A) CAT-M and FMCm cell lines presented low HER2 expression levels, with no expression detected in the FMCp cell line. (B) After exposure to lapatinib, the CAT-M cell line showed decreased phosphorylation levels of the HER1 (pY1173), HER2 (pY1221 + Y1222) and of its downstream effectors, AKT1 (pS473) and ERK1/2 (pT202/pY204 + pT185/pY187), coupled in an increased of PTEN phosphorylation at Thr366. Results were less perceptible when cells were exposed to neratinib. (C) TKi exposure, particularly, lapatinib, increased HER2 levels not only in CAT-M cells, but also in (D) FMCp cells. β-actin was used as loading control.
Pharmaceutics 13 00346 g002
Figure 3. Rapamycin showed small cytotoxicity in all tested tumor cell lines, although it lead to a decrease in the phosphorylation levels of mTOR at S2448. (A) The most susceptible cell line to rapamycin exposure was FMCp (43.4% of cytotoxicity) followed by the FMCm (41.3% of cytotoxicity) and the CAT-M cell lines (38.7% of cytotoxicity). The human SkBR-3 cell line was used as control, presenting a maximum of 29.6% of cytotoxicity. The experiments were performed in triplicates and repeated three times. (B) Rapamycin reduces the phosphorylation levels of the mTOR at S2448. β-actin was used as loading control.
Figure 3. Rapamycin showed small cytotoxicity in all tested tumor cell lines, although it lead to a decrease in the phosphorylation levels of mTOR at S2448. (A) The most susceptible cell line to rapamycin exposure was FMCp (43.4% of cytotoxicity) followed by the FMCm (41.3% of cytotoxicity) and the CAT-M cell lines (38.7% of cytotoxicity). The human SkBR-3 cell line was used as control, presenting a maximum of 29.6% of cytotoxicity. The experiments were performed in triplicates and repeated three times. (B) Rapamycin reduces the phosphorylation levels of the mTOR at S2448. β-actin was used as loading control.
Pharmaceutics 13 00346 g003
Figure 4. Combinations of TKi and mTOR inhibitor (lapatinib plus rapamycin and neratinib plus rapamycin) showed synergistic antiproliferative effects in feline mammary tumor cell lines. (A) CAT-M cells presented a significantly higher antiproliferative response when exposed to lapatinib at 3125 nM plus rapamycin at 6.25 nM or incubated with neratinib at 12.5 nM plus rapamycin at 6.25 nM (57.5% of cytotoxicity, * p < 0.05; 49.9% of cytotoxicity, ** p < 0.01, respectively). (B) FMCp cells showed significant synergistic effects of conjugations between lapatinib at 780 nM plus rapamycin at 0.196 nM or at 6.25 nM (45.5% of cytotoxicity, ** p < 0.01; 54.4% of cytotoxicity, *** p < 0.001, respectively), and when neratinib at 3.125 nM plus rapamycin at 0.196 nM or at 6.25 nM were used (32.1% of cytotoxicity, * p < 0.05; 44.5% of cytotoxicity, ** p < 0.01, respectively). (C) FMCm cells presented an increased cytotoxic response to the conjugations of lapatinib at 22,650 nM plus rapamycin at 0.196 nM or at 6.25 nM (42.6% of cytotoxicity, ** p < 0.01; 95.2% of cytotoxicity, *** p < 0.001, respectively) and neratinib at 25 nM plus rapamycin at 0.196 nM or at 6.25 nM (67.7% of cytotoxicity, ** p < 0.01; 76.3% of cytotoxicity, *** p < 0.001, respectively). (D) SkBR-3 cells used as control, displayed similar antiproliferative responses to feline cell lines. All the assays were performed in triplicate and repeated a total of three separated times.
Figure 4. Combinations of TKi and mTOR inhibitor (lapatinib plus rapamycin and neratinib plus rapamycin) showed synergistic antiproliferative effects in feline mammary tumor cell lines. (A) CAT-M cells presented a significantly higher antiproliferative response when exposed to lapatinib at 3125 nM plus rapamycin at 6.25 nM or incubated with neratinib at 12.5 nM plus rapamycin at 6.25 nM (57.5% of cytotoxicity, * p < 0.05; 49.9% of cytotoxicity, ** p < 0.01, respectively). (B) FMCp cells showed significant synergistic effects of conjugations between lapatinib at 780 nM plus rapamycin at 0.196 nM or at 6.25 nM (45.5% of cytotoxicity, ** p < 0.01; 54.4% of cytotoxicity, *** p < 0.001, respectively), and when neratinib at 3.125 nM plus rapamycin at 0.196 nM or at 6.25 nM were used (32.1% of cytotoxicity, * p < 0.05; 44.5% of cytotoxicity, ** p < 0.01, respectively). (C) FMCm cells presented an increased cytotoxic response to the conjugations of lapatinib at 22,650 nM plus rapamycin at 0.196 nM or at 6.25 nM (42.6% of cytotoxicity, ** p < 0.01; 95.2% of cytotoxicity, *** p < 0.001, respectively) and neratinib at 25 nM plus rapamycin at 0.196 nM or at 6.25 nM (67.7% of cytotoxicity, ** p < 0.01; 76.3% of cytotoxicity, *** p < 0.001, respectively). (D) SkBR-3 cells used as control, displayed similar antiproliferative responses to feline cell lines. All the assays were performed in triplicate and repeated a total of three separated times.
Pharmaceutics 13 00346 g004
Figure 5. Mutations identified in feline her2 TK domain are not reported to induce therapeutic resistance in woman breast cancer. Most of the detected mutations were localized at intronic regions, although some of them were identified in exons, as a very frequent mutation in the exon 22 (c.20940 T > G; 85%; 34/40). Regarding the exon 20 that encodes for the protein region recognized by TKi, none of the seven identified mutations were reported as being related to therapeutic resistance in woman breast cancer.
Figure 5. Mutations identified in feline her2 TK domain are not reported to induce therapeutic resistance in woman breast cancer. Most of the detected mutations were localized at intronic regions, although some of them were identified in exons, as a very frequent mutation in the exon 22 (c.20940 T > G; 85%; 34/40). Regarding the exon 20 that encodes for the protein region recognized by TKi, none of the seven identified mutations were reported as being related to therapeutic resistance in woman breast cancer.
Pharmaceutics 13 00346 g005
Figure 6. A significant positive correlation was found between the tumor size and the presence of c.19573A > T mutation in exon 18 (* p = 0.045). The mutation c.19573A > T was associated to larger tumor sizes (4.13 cm ± 1.44 vs. 2.64 cm ± 1.13).
Figure 6. A significant positive correlation was found between the tumor size and the presence of c.19573A > T mutation in exon 18 (* p = 0.045). The mutation c.19573A > T was associated to larger tumor sizes (4.13 cm ± 1.44 vs. 2.64 cm ± 1.13).
Pharmaceutics 13 00346 g006
Table 1. Concentrations of lapatinib (nM), neratinib (nM) and rapamycin (nM), used in the cytotoxicity assays. Cells were exposed to drugs for 72 h before cytotoxicity evaluation.
Table 1. Concentrations of lapatinib (nM), neratinib (nM) and rapamycin (nM), used in the cytotoxicity assays. Cells were exposed to drugs for 72 h before cytotoxicity evaluation.
Drug Concentrations for the Cytotoxicity Assays
Lapatinib (nM)Neratinib (nM)Rapamycin (nM)
1950.1950.195
3900.390.39
7800.780.78
15601.561.56
31253.1253.125
62506.256.25
12,50012.512.5
25,0002525
50,0005050
100 × 103100100
250 × 103250250
500 × 103500500
1 × 106750750
10001000
15001500
Table 2. Primary antibodies and their dilutions used for chemoluminescence analysis.
Table 2. Primary antibodies and their dilutions used for chemoluminescence analysis.
Primary Antibody.CloneDilution
β-actinAC-151:5000
HER2CB111:1000
HER2 pY1221 + Y1222Polyclonal1:1000
HER1 pY1173E1241:500
HER4 pY1284Polyclonal1:500
AKT1 pS473EP2109Y1:2000
ERK1/2 pT202/pY204 + pT185/pY187MAPK-YT1:5000
PTEN pT366EP2291:1000
mTOR pS2448EPR426(2)1:10,000
Table 3. Clinicopathological features of female cats with mammary carcinomas enrolled in this study (n = 40).
Table 3. Clinicopathological features of female cats with mammary carcinomas enrolled in this study (n = 40).
Clinicopathological FeatureNumber (%)Clinicopathological FeatureNumber (%)
BreedAge
Indeterminate33 (82.5%)<8years old3 (7.5%)
Siamese4 (10%)≥8 years old37 (92.5%)
Persian2 (5%)
Norwegian Forest1 (2.5%)Tumor size
<2cm9 (22.5%)
2–3cm19 (47.5%)
Spayed; 1 unknown>3cm12 (30%)
Yes19 (47.5%)
No20 (50%)HP * classification
Contraceptives; 7 unknown
Yes23 (57.5%)Tubulopapillary carcinoma8 (20%)
No10 (25%)Solid carcinoma9 (22.5%)
Cribiform carcinoma5 (12.5%)
TreatmentMucinous carcinoma5 (12.5%)
Mastectomy36 (90%)Tubular Carcinoma11 (27.5%)
Mastectomy + Chemo4 (10%)Papillary-cystic carcinoma2 (5%)
Multiple tumorsHP * Malignancy grade
Yes31 (77.5%)I2 (5%)
No9 (22.5%)II5 (12.5%)
Regional lymph node status; 2 unknownIII33 (82.5%)
Positive14 (35%) Tumor necrosis
Negative24 (60%)Yes29 (72.5%)
Stage (TNM classification)No11 (27.5%)
I9 (22.5%)Lymphatic invasion
II7 (17.5%)Yes5 (12.5%)
III21 (52.5%)No35 (87.5%)
IV3 (7.5%)Lymphocytic infiltration
Mammary locationYes27 (67.5%)
M111 (27.5%)No13 (32.5%)
M28 (20%)Tumor ulceration
M314 (35%)Yes3 (7.5%)
M411 (27.5%)No37 (92.5%)
fHER2 statusKi67 index
Positive12 (30%)Low (<14%)30 (75%)
Negative28 (70%)High (≥14%)10 (25%)
ER statusPR status
Positive12 (30%)Positive20 (50%)
Negative28 (70%)Negative20 (50%)
* HP—Histopathological; TNM—Tumor, Node, Metastasis.
Table 4. Primers for genomic DNA amplification and sequencing, covering the feline her2 TK domain, between exon 18 to exon 22.
Table 4. Primers for genomic DNA amplification and sequencing, covering the feline her2 TK domain, between exon 18 to exon 22.
Forward (5′-3’)Reverse (5′-3´)Exons
CTAGTGGAGCCATGCCCAAGGAGGTCCCTCCTGTACTCC18 and 19
AATCTTGGACGTAAGCCCCTCAGGCCCCCTAAGTGCATACC20
CTGACATCCACCGTGCAGTTCGTAGCTCCACACGTCACTC21 and 22
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Gameiro, A.; Almeida, F.; Nascimento, C.; Correia, J.; Ferreira, F. Tyrosine Kinase Inhibitors Are Promising Therapeutic Tools for Cats with HER2-Positive Mammary Carcinoma. Pharmaceutics 2021, 13, 346. https://0-doi-org.brum.beds.ac.uk/10.3390/pharmaceutics13030346

AMA Style

Gameiro A, Almeida F, Nascimento C, Correia J, Ferreira F. Tyrosine Kinase Inhibitors Are Promising Therapeutic Tools for Cats with HER2-Positive Mammary Carcinoma. Pharmaceutics. 2021; 13(3):346. https://0-doi-org.brum.beds.ac.uk/10.3390/pharmaceutics13030346

Chicago/Turabian Style

Gameiro, Andreia, Filipe Almeida, Catarina Nascimento, Jorge Correia, and Fernando Ferreira. 2021. "Tyrosine Kinase Inhibitors Are Promising Therapeutic Tools for Cats with HER2-Positive Mammary Carcinoma" Pharmaceutics 13, no. 3: 346. https://0-doi-org.brum.beds.ac.uk/10.3390/pharmaceutics13030346

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop