Expression Profiles of Genes Encoding Cornified Envelope Proteins in Atopic Dermatitis and Cutaneous T-Cell Lymphomas
Abstract
:1. Introduction
2. Materials and Methods
2.1. Patients and Samples
2.2. Isolation of Total RNA from Skin Fragments
2.3. Relative Quantitative Real-Time RT-PCR Analysis
2.4. Protein Level Determination
2.5. Statistical Analysis
3. Results
3.1. mRNA Level of Cornified Envelop Proteins
3.2. Cornified Envelope Proteins Levels
4. Limitations of This Study
5. Discussion
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
CTCL | cutaneous T-cell lymphomas |
AD | atopic dermatitis |
CE | cornified envelope |
mRNA | messenger ribonucleic acid |
LELP-1 | late cornified envelope-like proline-rich protein-1 |
SPRR1A | small proline-rich proteins 1A |
SPRR1B | small proline-rich proteins 1B |
SPRR3 | small proline-rich proteins 3 |
RPTN | repetin |
CRNN | cornulin |
HRNR | hornerin |
LOR | loricrin |
FLG | filaggrin |
FLG2 | filaggrin 2 |
RT-PCR | real-time polymerase chain reaction |
ELISA | enzyme-linked immunoabsorbent assay |
PBS | phosphate buffered saline |
References
- Willemze, R.; Cerroni, L.; Kempf, W.; Berti, E.; Facchetti, F.; Swerdlow, S.H.; Jaffe, E.S. The 2018 update of the WHO-EORTC classification for primary cutaneous lymphomas. Blood 2019, 133, 1703–1714. [Google Scholar] [CrossRef] [PubMed]
- Wong, H.K.; Mishra, A.; Hake, T.; Porcu, P. Evolving Insights in the pathogenesis and therapy of Cutaneous T-cell lymphoma (Mycosis Fungoides and Sézary Syndrome). Br. J. Haematol. 2011, 155, 150–166. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Siakantari, M. Classification and molecular pathogenesis of CTCL. Melanoma Res. 2010, 20, e20–e21. [Google Scholar] [CrossRef]
- Vonderheid, E.C.; Bigler, R.D.; Hou, J.S. On the possible relationship between staphylococcal superantigens and in- creased Vbeta5.1 usage in cutaneous T-cell lymphoma. Br. J. Haematol. 2005, 152, 825–826. [Google Scholar]
- McGirt, L.Y.; Jia, P.; Baerenwald, D.A.; Duszynski, R.J.; Dahlman, K.B.; Zic, J.A.; Zwerner, J.P.; Hucks, N.; Dave, U.; Zhao, Z.; et al. Whole-genome sequencing reveals oncogenic mutations in mycosis fungoides. Blood 2015, 126, 508–519. [Google Scholar] [CrossRef] [Green Version]
- Almeida, A.C.D.S.; Abate, F.; Khiabanian, H.; Martínez-Escala, E.; Guitart, J.; Tensen, C.P.; Vermeer, M.H.; Rabadan, R.; Ferrando, A.; Palomero, T. The mutational landscape of cutaneous T cell lymphoma and Sézary syndrome. Nat. Genet. 2015, 47, 1465–1470. [Google Scholar] [CrossRef] [Green Version]
- Hoppe, R.T.; Medeiros, L.; A Warnke, R.; Wood, G.S. CD8-positive tumor-infiltrating lymphocytes influence the long-term survival of patients with mycosis fungoides. J. Am. Acad. Dermatol. 1995, 32, 448–453. [Google Scholar] [CrossRef]
- Guenova, E.; Watanabe, R.; Teague, J.E.; DeSimone, J.A.; Jiang, Y.; Dowlatshahi, M.; Schlapbach, C.; Schaekel, K.; Rook, A.H.; Tawa, M.; et al. TH2 cytokines from malignant cells suppress TH1 responses and enforce a global TH2 bias in leukemic cutaneous T-cell lymphoma. Clin. Cancer Res. 2013, 19, 3755–3763. [Google Scholar] [CrossRef] [Green Version]
- Chong, B.F.; Wilson, A.J.; Gibson, H.M.; Hafner, M.S.; Luo, Y.; Hedgcock, C.J.; Wong, H.K. Immune function abnormalities in peripheral blood mononuclear cell cytokine expression differentiates stages of cutaneous T-cell lymphoma/mycosis fungoides. Clin. Cancer Res. 2008, 14, 646–653. [Google Scholar] [CrossRef] [Green Version]
- Miyagaki, T.; Sugaya, M. Erythrodermic cutaneous T-cell lymphoma: How to differentiate this rare disease from atopic dermatitis. J. Dermatol. Sci. 2011, 64, 1–6. [Google Scholar] [CrossRef]
- Suga, H.; Sugaya, M.; Miyagaki, T.; Ohmatsu, H.; Kawaguchi, M.; Takahashi, N.; Fujita, H.; Asano, Y.; Tada, Y.; Kadono, T.; et al. Skin Barrier Dysfunction and Low Antimicrobial Peptide Expression in Cutaneous T-cell Lymphoma. Clin. Cancer Res. 2014, 20, 4339–4348. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Talpur, R.; Bassett, R.; Duvic, M. Prevalence and treatment of Staphylococcus aureus colonization in patients with mycosis fungoides and Sézary syndrome. Br. J. Dermatol. 2008, 159, 105–112. [Google Scholar] [CrossRef] [PubMed]
- Thode, C.; Woetmann, A.; Wandall, H.H.; Carlsson, M.C.; Qvortrup, K.; Kauczok, C.S.; Wobser, M.; Printzlau, A.; Ødum, N.; Dabelsteen, S. Malignant T cells secrete galectins and induce epidermal hyperproliferation and disorga-nized stratification in a skin model of cutane- ous T-cell lymphoma. J. Investig. Dermatol. 2015, 135, 238–246. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mirvish, E.D.; Pomerantz, R.G.; Geskin, L.J. Infectious agents in cutaneous T-cell lymphoma. J. Am. Acad. Dermatol. 2010, 64, 423–431. [Google Scholar] [CrossRef] [Green Version]
- Trzeciak, M.; Sakowicz-Burkiewicz, M.; Wesserling, M.; Dobaczewska, D.; Gleń, J.; Nowicki, R.; Pawelczyk, T. Expression of Cornified Envelope Proteins in Skin and Its Relationship with Atopic Dermatitis Phenotype. Acta Derm. Venereol. 2017, 97, 36–41. [Google Scholar] [CrossRef] [Green Version]
- Trzeciak, M.; Wesserling, M.; Bandurski, T.; Gleń, J.; Nowicki, R.; Pawelczyk, T. Association of a Single Nucleotide Polymorphism in a Late Cornified Envelope-like Proline-rich 1 Gene with Atopic Dermatitis. Acta Derm. Venereol. 2016, 96, 459–463. [Google Scholar] [CrossRef] [Green Version]
- Trzeciak, M.; Sakowicz-Burkiewicz, M.; Wesserling, M.; Dobaczewska, D.; Bandurski, T.; Nowicki, R.; Pawelczyk, T.; Gleń, J. Altered Expression of Genes Encoding Cornulin and Repetin in Atopic Dermatitis. Int. Arch. Allergy Immunol. 2017, 172, 11–19. [Google Scholar] [CrossRef]
- Olsen, E.A.; Vonderheid, E.; Pimpinelli, N.; Willemze, R.; Kim, Y.; Knobler, R.; Zackheim, H.; Duvic, M.; Estrach, T.; Lamberg, S.; et al. Revisions to the staging and classification of mycosis fungoides and Sézary syndrome: A proposal of the International Society for Cutaneous Lymphomas (ISCL) and the cutaneous lymphoma task force of the European Organization of Research and Treatment of Cancer (EORTC). Blood 2007, 110, 1713–1722. [Google Scholar]
- Hanifin, J.M.; Rajka, G. Diagnostic features of atopic dermatitis. Acta Derm Venereol 1980, 59, 44–47. [Google Scholar]
- Chomczynski, P.; Sacchi, N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 1987, 162, 156–159. [Google Scholar] [CrossRef]
- Sugiura, H.; Ebise, H.; Tazawa, T.; Tanaka, K.; Sugiura, Y.; Uehara, M.; Kikuchi, K.; Kimura, T. Large-scale DNA microarray analysis of atopic skin lesions shows overexpression of an epidermal differentiation gene cluster in the alternative pathway and lack of protective gene expression in the cornified envelope. Br. J. Dermatol. 2005, 152, 146–149. [Google Scholar] [CrossRef] [PubMed]
- Pellerin, L.; Henry, J.; Hsu, C.-Y.; Balica, S.; Jean-Decoster, C.; Méchin, M.-C.; Hansmann, B.; Rodríguez, E.; Weindinger, S.; Schmitt, A.-M.; et al. Defects of filaggrin-like proteins in both lesional and nonlesional atopic skin. J. Allergy Clin. Immunol. 2013, 131, 1094–1102. [Google Scholar] [CrossRef] [PubMed]
- Batista, D.I.S.; Perez, L.; Orfali, R.L.; Zaniboni, M.C.; Samorano, L.P.; Pereira, N.V.; Sotto, M.N.; Ishizaki, A.S.; Oliveira, L.M.S.; Sato, M.N.; et al. Profile of skin barrier proteins (filaggrin, claudins 1 and 4) and Th1/Th2/Th17 cytokines in adults with atopic dermatitis. J. Eur. Acad. Dermatol. Venereol. 2015, 29, 1091–1095. [Google Scholar] [CrossRef] [PubMed]
- De Benedetto, A.; Rafaels, N.M.; McGirt, L.Y.; Ivanov, A.I.; Georas, S.N.; Cheadle, C.; Berger, A.E.; Zhang, K.; Vidyasagar, S.; Yoshida, T.; et al. Tight junction defects in patients with atopic dermatitis. J. Allergy Clin. Immunol. 2010, 127, 773–786. [Google Scholar] [CrossRef] [Green Version]
- Kim, B.; Leung, D.; Boguniewicz, M.; Howell, M. Loricrin and Involucrin Expression is Down-Regulated by Th2 Cytokines through STAT-6. J. Allergy Clin. Immunol. 2008, 121, S272. [Google Scholar] [CrossRef]
- Jackow, C.M.; Cather, J.C.; Hearne, V.; Asano, A.T.; Musser, J.M.; Duvic, M. Association of erythrodermic cutaneous T-cell lymphoma, superantigen-positive Staphylococcus aureus, and oligoclonal T-cell receptor V beta gene expansion. Blood 1997, 89, 32–40. [Google Scholar] [CrossRef]
- Fanok, M.H.; Sun, A.; Fogli, L.K.; Narendran, V.; Eckstein, M.; Kannan, K.; Dolgalev, I.; Lazaris, C.; Heguy, A.; Laird, M.E.; et al. Role of Dysregulated Cytokine Signaling and Bacterial Triggers in the Pathogenesis of Cutaneous T-Cell Lymphoma. J. Investig. Dermatol. 2018, 138, 1116–1125. [Google Scholar] [CrossRef] [Green Version]
- Willerslew-Olsen, A.; Krejsgaard, T.; Lindahl, L.M.; Bonefeld, C.M.; A Wasik, M.; Koralov, S.B.; Geisler, C.; Kilian, M.; Iversen, L.; Woetmann, A.; et al. Bacterial Toxins Fuel Disease Progression in Cutaneous T-Cell Lymphoma. Toxins 2013, 5, 1402–1421. [Google Scholar] [CrossRef] [Green Version]
- Lindahl, L.M.; Willerslev-Olsen, A.; Gjerdrum, L.M.R.; Nielsen, P.R.; Blümel, E.; Rittig, A.H.; Celis, P.; Herpers, B.; Becker, J.C.; Stausbøl-Grøn, B.; et al. Antibiotics inhibit tumor and disease activity in cutaneous T-cell lymphoma. Blood 2019, 134, 1072–1083. [Google Scholar] [CrossRef]
- Kelsell, D.; Byrne, C. SNPing at the Epidermal Barrier. J. Investig. Dermatol. 2011, 131, 1593–1595. [Google Scholar] [CrossRef] [Green Version]
- Simpson, E.L.; Chalmers, J.; Hanifin, J.M.; Thomas, K.S.; Cork, M.; McLean, W.I.; Brown, S.; Chen, Z.; Chen, Y.; Williams, H.C. Emollient enhancement of the skin barrier from birth offers effective atopic dermatitis prevention. J. Allergy Clin. Immunol. 2014, 134, 818–823. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Narbutt, J.; Lesiak, A. I-modulia® w badaniach klinicznych–zastosowanie emolientów u chorych na atopowe zapalenie skóry. Forum Dermatol. 2016, 2, 139–143. [Google Scholar]
- Elias, P.M. Barrier-repair therapy for atopic dermatitis: Corrective lipid biochemical therapy. Expert Rev. Dermatol. 2008, 3, 441–452. [Google Scholar] [CrossRef]
Gene Transcript | Primers | TaqMan Probe | Transcript of Reference Gene |
---|---|---|---|
FLG NM_002016.1 | (F) ggactctgagaggcgatctg (R) tgctcccgagaagatccat | Universal ProbeLibrary Probe #38 (Roche) | Universal ProbeLibrary Reference Gene Assay Roche, Human TBP Gene Assay |
FLG2 NM_001014342.2 | (F) tgactatggcctgcaacaa (R) ctttgaccctgaagctttgc | Universal ProbeLibrary Probe #73 (Roche) | Universal ProbeLibrary Reference Gene Assay Roche, Human G6PD Gene Assay |
LELP1 NM_001010857.1 | (F) cccaagtgtgaacaaaagtg (R) ttcgaaacagcgttgcag | Universal ProbeLibrary Probe #26 | Universal ProbeLibrary Reference Gene Assay Roche, Human ACTB Gene Assay |
SPRR1Avar.1 NM_001199828.1 | (F) tcgggtgcatttgaggat (R) aaggaagactagggatggttca | Universal ProbeLibrary Probe #60 (Roche) | Universal ProbeLibrary Reference Gene Assay Roche, Human ACTB Gene Assay |
SPRR1B NM_003125.2 | (F) gagagacttaagatgaaagcaatga (R) tgaaagtgaatttaatgggggta | Universal ProbeLibrary Probe #24 (Roche) | Universal ProbeLibrary Reference Gene Assay Roche, Human ACTB Gene Assay |
SPRR3var.1 NM_005416.2 | (F) tcaggagcttagaggattcttca (R) ttctgctggtaagaactcatgc | Universal ProbeLibrary Probe #89 (Roche) | Universal ProbeLibrary Reference Gene Assay Roche, Human ACTB Gene Assay |
RPTN NM_001122965.1 | (F) gctcttggctgagtttggag (R) aggttcaagatggtttccaca | Universal ProbeLibrary Probe #65 (Roche) | Universal ProbeLibrary Reference Gene Assay Roche, Human TBP Gene |
HRNR NM_001009931.2 | (F) caggggcaagatgggtattc (R) ccagaacttccccctcat | Universal ProbeLibrary Probe #69 (Roche) | Universal ProbeLibrary Reference Gene Assay Roche, Human TBP Gene Assay |
CRNN NM_016190.2 | (F) tggtcaaagatggatgcaag (R) cctgtcctcccggtactgt | Universal ProbeLibrary Probe #51 (Roche) | Universal ProbeLibrary Reference Gene Assay Roche, Human G6PD Gene |
LOR NM_000427.2 | (F) ctcacccttcctggtgctt (R) gaggtcttcacgcagtcca | Universal ProbeLibrary Probe #12 (Roche) | Universal ProbeLibrary Reference Gene Assay Roche, Human ACTB Gene Assay |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Trzeciak, M.; Olszewska, B.; Sakowicz-Burkiewicz, M.; Sokołowska-Wojdyło, M.; Jankau, J.; Nowicki, R.J.; Pawełczyk, T. Expression Profiles of Genes Encoding Cornified Envelope Proteins in Atopic Dermatitis and Cutaneous T-Cell Lymphomas. Nutrients 2020, 12, 862. https://0-doi-org.brum.beds.ac.uk/10.3390/nu12030862
Trzeciak M, Olszewska B, Sakowicz-Burkiewicz M, Sokołowska-Wojdyło M, Jankau J, Nowicki RJ, Pawełczyk T. Expression Profiles of Genes Encoding Cornified Envelope Proteins in Atopic Dermatitis and Cutaneous T-Cell Lymphomas. Nutrients. 2020; 12(3):862. https://0-doi-org.brum.beds.ac.uk/10.3390/nu12030862
Chicago/Turabian StyleTrzeciak, Magdalena, Berenika Olszewska, Monika Sakowicz-Burkiewicz, Małgorzata Sokołowska-Wojdyło, Jerzy Jankau, Roman Janusz Nowicki, and Tadeusz Pawełczyk. 2020. "Expression Profiles of Genes Encoding Cornified Envelope Proteins in Atopic Dermatitis and Cutaneous T-Cell Lymphomas" Nutrients 12, no. 3: 862. https://0-doi-org.brum.beds.ac.uk/10.3390/nu12030862