Chinese Olive (Canarium album L.) Fruit Extract Attenuates Metabolic Dysfunction in Diabetic Rats
Abstract
:1. Introduction
2. Materials and Methods
2.1. Preparation of Chinese Olive Fruit Extract
2.2. Animals and Diets
2.3. Biochemical Analysis
2.4. Quantification of Hepatic Triglyceride and Cholesterol Levels
2.5. Measurement of Hepatic Antioxidant Status and TBARS Levels
2.6. Histological Analysis
2.7. Quantitative Reverse Transcription Polymerase Chain Reaction (RT-qPCR)
2.8. Western Blotting
2.9. Statistical Analysis
3. Results
3.1. High Performance Liquid Chromatography (HPLC) Analysis of CO-EtOAc
3.2. The Effect of CO-EtOAc on Body Weight, Food Intake and Biochemical Parameters
3.3. The Effect of CO-EtOAc on Hepatic Antioxidant Enzyme Activities and TBARS Levels
3.4. The Effect of CO-EtOAc on the Regulation of Insulin Signaling
3.5. The Effect of CO-EtOAc on Hepatic Lipid Accumulation
3.6. The Effect of CO-EtOAc on Hepatic Cholesterol levels and Gene Expression
3.7. The Effect of CO-EtOAc on Expression of Inflammatory Cytokines
4. Discussion
5. Conclusions
Supplementary Materials
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Beagley, J.; Guariguata, L.; Weil, C.; Motala, A.A. Global estimates of undiagnosed diabetes in adults. Diabetes Res. Clin. Pract. 2014, 103, 150–160. [Google Scholar] [CrossRef] [PubMed]
- American Diabetes Association. 2. Classification and diagnosis of diabetes. Diabetes Care 2015, 38, S8–S16. [Google Scholar]
- Jung, U.J.; Choi, M.S. Obesity and its metabolic complications: The role of adipokines and the relationship between obesity, inflammation, insulin resistance, dyslipidemia and nonalcoholic fatty liver disease. Int. J. Mol. Sci. 2014, 15, 6184–6223. [Google Scholar] [CrossRef] [PubMed]
- Bitzur, R.; Cohen, H.; Kamari, Y.; Shaish, A.; Harats, D. Triglycerides and hdl cholesterol: Stars or second leads in diabetes? Diabetes Care 2009, 32 (Suppl. 2), S373–S377. [Google Scholar] [CrossRef] [PubMed]
- Ghosh, J.; Das, J.; Manna, P.; Sil, P.C. The protective role of arjunolic acid against doxorubicin induced intracellular ROS dependent JNK-p38 and p53-mediated cardiac apoptosis. Biomaterials 2011, 32, 4857–4866. [Google Scholar] [CrossRef] [PubMed]
- Lee, M.-S.; Kim, K.-A. NF-κB pathway in metabolic/endocrine diseases. J. Korean Endocr. Soc. 2006, 21, 352–363. [Google Scholar] [CrossRef]
- Hazel-Fernandez, L.; Xu, Y.; Moretz, C.; Meah, Y.; Baltz, J.; Lian, J.; Kimball, E.; Bouchard, J. Historical cohort analysis of treatment patterns for patients with type 2 diabetes initiating metformin monotherapy. Curr. Med. Res. Opin. 2015, 31, 1703–1716. [Google Scholar] [CrossRef] [PubMed]
- Alfa, R.W.; Kim, S.K. Using drosophila to discover mechanisms underlying type 2 diabetes. Dis. Mod. Mech. 2016, 9, 365–376. [Google Scholar] [CrossRef] [PubMed]
- Gual, P.; Le Marchand-Brustel, Y.; Tanti, J.F. Positive and negative regulation of insulin signaling through IRS-1 phosphorylation. Biochimie 2005, 87, 99–109. [Google Scholar] [CrossRef] [PubMed]
- Cai, D.; Yuan, M.; Frantz, D.F.; Melendez, P.A.; Hansen, L.; Lee, J.; Shoelson, S.E. Local and systemic insulin resistance resulting from hepatic activation of IKK-beta and Nf-kappaB. Nat. Med. 2005, 11, 183–190. [Google Scholar] [CrossRef] [PubMed]
- Sharma, A.K.; Bharti, S.; Kumar, R.; Krishnamurthy, B.; Bhatia, J.; Kumari, S.; Arya, D.S. Syzygium cumini ameliorates insulin resistance and beta-cell dysfunction via modulation of PPAR, dyslipidemia, oxidative stress, and Tnf-alpha in type 2 diabetic rats. J. Pharmacol. Sci. 2012, 119, 205–213. [Google Scholar] [CrossRef] [PubMed]
- Bajaj, S.; Khan, A. Antioxidants and diabetes. Indian J. Endocrinol. Metab. 2012, 16, S267–S271. [Google Scholar] [PubMed]
- Sabitha, K.; Venugopal, B.; Rafi, M.; Ramana, K. Role of antioxidant enzymes in glucose and lipid metabolism in association with obesityand type 2 diabetes. Am. J. Med. Sci. 2014, 2, 21–24. [Google Scholar] [CrossRef]
- Wright, E., Jr.; Scism-Bacon, J.L.; Glass, L.C. Oxidative stress in type 2 diabetes: The role of fasting and postprandial glycaemia. Int. J. Clin. Practice 2006, 60, 308–314. [Google Scholar] [CrossRef] [PubMed]
- Maiese, K. New insights for oxidative stress and diabetes mellitus. Oxid. Med. Cell. Longev. 2015, 2015, 875961. [Google Scholar] [CrossRef] [PubMed]
- Ioannou, G.N. The role of cholesterol in the pathogenesis of NASH. Trends Endocrinol. Metab. 2016, 27, 84–95. [Google Scholar] [CrossRef] [PubMed]
- Cruz, P.M.; Mo, H.; McConathy, W.J.; Sabnis, N.; Lacko, A.G. The role of cholesterol metabolism and cholesterol transport in carcinogenesis: A review of scientific findings, relevant to future cancer therapeutics. Front Pharmacol. 2013, 4, 119. [Google Scholar] [CrossRef] [PubMed]
- Ostlund, R.E., Jr. Phytosterols and cholesterol metabolism. Curr. Opin. Lipidol. 2004, 15, 37–41. [Google Scholar] [CrossRef] [PubMed]
- Pandey, K.B.; Rizvi, S.I. Plant polyphenols as dietary antioxidants in human health and disease. Oxid. Med. Cell. Longev. 2009, 2, 270–278. [Google Scholar] [CrossRef] [PubMed]
- Bahadoran, Z.; Mirmiran, P.; Azizi, F. Dietary polyphenols as potential nutraceuticals in management of diabetes: A review. J. Diabetes Metab. Disord. 2013, 12, 43. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.Y.; Qiu, N.X.; Ding, H.H.; Yao, R.Q. Polyphenols contents and antioxidant capacity of 68 Chinese herbals suitable for medical or food uses. Food Res. Int. 2008, 41, 363–370. [Google Scholar] [CrossRef]
- Ding, B. Pharmacology of Qingguo pills on relieving cough. China Tradit. Patent Med. 1999, 21, 27–28. [Google Scholar]
- Mogana, R.; Wiart, C. Canarium L.: A phytochemical and pharmacological review. J. Pharm. Res. 2011, 4, 2482–2489. [Google Scholar]
- Srinivasan, K.; Patole, P.S.; Kaul, C.L.; Ramarao, P. Reversal of glucose intolerance by by pioglitazone in high fat diet-fed rats. Methods Find Exp. Clin. Pharmacol. 2004, 26, 327–333. [Google Scholar] [CrossRef] [PubMed]
- Hsieh, S.-C.; Hsieh, W.-J.; Chiang, A.-N.; Su, N.-W.; Yeh, Y.-T.; Liao, Y.-C. The methanol-ethyl acetate partitioned fraction from chinese olive fruits inhibits cancer cell proliferation and tumor growth by promoting apoptosis through the suppression of the Nf-κB signaling pathway. Food Funct. 2016, 7, 4797–4803. [Google Scholar] [CrossRef] [PubMed]
- Srinivasan, K.; Viswanad, B.; Asrat, L.; Kaul, C.L.; Ramarao, P. Combination of high-fat diet-fed and low-dose streptozotocin-treated rat: A model for type 2 diabetes and pharmacological screening. Pharmacol. Res. 2005, 52, 313–320. [Google Scholar] [CrossRef] [PubMed]
- Qi, M.Y.; Kai, C.; Liu, H.R.; Su, Y.H.; Yu, S.Q. Protective effect of icariin on the early stage of experimental diabetic nephropathy induced by streptozotocin via modulating transforming growth factor beta1 and type IV collagen expression in rats. J. Ethnopharmacol. 2011, 138, 731–736. [Google Scholar] [CrossRef] [PubMed]
- Folch, J.; Lees, M.; Sloane Stanley, G.H. A simple method for the isolation and purification of total lipides from animal tissues. J. Biol. Chem. 1957, 226, 497–509. [Google Scholar] [PubMed]
- Garcimartin, A.; Lopez-Oliva, M.E.; Santos-Lopez, J.A.; Garcia-Fernandez, R.A.; Macho-Gonzalez, A.; Bastida, S.; Benedi, J.; Sanchez-Muniz, F.J. Silicon alleviates nonalcoholic steatohepatitis by reducing apoptosis in aged wistar rats fed a high-saturated fat, high-cholesterol diet. J. Nutr. 2017, 147, 1104–1112. [Google Scholar] [CrossRef] [PubMed]
- Kleiner, D.E.; Brunt, E.M.; Van Natta, M.; Behling, C.; Contos, M.J.; Cummings, O.W.; Ferrell, L.D.; Liu, Y.C.; Torbenson, M.S.; Unalp-Arida, A.; et al. Design and validation of a histological scoring system for nonalcoholic fatty liver disease. Hepatology 2005, 41, 1313–1321. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-δδ C(T)) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Boucher, J.; Kleinridders, A.; Kahn, C.R. Insulin receptor signaling in normal and insulin-resistant states. Cold Spring Harb. Perspect. Biol. 2014, 6, a009191. [Google Scholar] [CrossRef] [PubMed]
- Emanuela, F.; Grazia, M.; Marco, D.R.; Maria Paola, L.; Giorgio, F.; Marco, B. Inflammation as a link between obesity and metabolic syndrome. J. Nutr. Metab. 2012, 2012, 476380. [Google Scholar] [CrossRef] [PubMed]
- Barter, P.J. The causes and consequences of low levels of high density lipoproteins in patients with diabetes. Diabetes Metab. 2011, 35, 101–106. [Google Scholar] [CrossRef] [PubMed]
- Bak, E.J.; Kim, J.; Jang, S.; Woo, G.H.; Yoon, H.G.; Yoo, Y.J.; Cha, J.H. Gallic acid improves glucose tolerance and triglyceride concentration in diet-induced obesity mice. Scand. J. Clin. Lab. Investig. 2013, 73, 607–614. [Google Scholar] [CrossRef] [PubMed]
- Chao, J.; Huo, T.I.; Cheng, H.Y.; Tsai, J.C.; Liao, J.W.; Lee, M.S.; Qin, X.M.; Hsieh, M.T.; Pao, L.H.; Peng, W.H. Gallic acid ameliorated impaired glucose and lipid homeostasis in high fat diet-induced nafld mice. PLoS ONE 2014, 9, e96969. [Google Scholar] [CrossRef] [PubMed]
- Gandhi, G.R.; Jothi, G.; Antony, P.J.; Balakrishna, K.; Paulraj, M.G.; Ignacimuthu, S.; Stalin, A.; Al-Dhabi, N.A. Gallic acid attenuates high-fat diet fed-streptozotocin-induced insulin resistance via partial agonism of PPARγ in experimental type 2 diabetic rats and enhances glucose uptake through translocation and activation of GLUT4 in PI3K/p-AKT signaling pathway. Eur. J. Pharmacol. 2014, 745, 201–216. [Google Scholar] [CrossRef] [PubMed]
- Malini, P.; Kanchana, G.; Rajadurai, M. Antibiabetic efficacy of ellagic acid in streptozotocin-induced diabetes mellitus in albino wistar rats. Asian J. Pharm. Clin. Res. 2011, 4, 124–128. [Google Scholar]
- Panchal, S.K.; Ward, L.; Brown, L. Ellagic acid attenuates high-carbohydrate, high-fat diet-induced metabolic syndrome in rats. Eur. J. Nutr. 2013, 52, 559–568. [Google Scholar] [CrossRef] [PubMed]
- Park, S.H.; Kim, J.L.; Lee, E.S.; Han, S.Y.; Gong, J.H.; Kang, M.K.; Kang, Y.H. Dietary ellagic acid attenuates oxidized LDL uptake and stimulates cholesterol efflux in murine macrophages. J. Nutr. 2011, 141, 1931–1937. [Google Scholar] [CrossRef] [PubMed]
- Poulose, N.; Prasad, V.; Haridas, P.N.; Gopalakrishnapillai, A. Ellagic acid stimulates glucose transport in 3T3-L1 adipocytes and C2C12 myotubes by amp activated protein kinase mediated pathway. FASEB J. 2011, 25, lb85. [Google Scholar]
- Samuel, V.T.; Shulman, G.I. Mechanisms for insulin resistance: Common threads and missing links. Cell 2012, 148, 852–871. [Google Scholar] [CrossRef] [PubMed]
- Gregor, M.F.; Hotamisligil, G.S. Inflammatory mechanisms in obesity. Annu. Rev. Immunol. 2011, 29, 415–445. [Google Scholar] [CrossRef] [PubMed]
- Johnson, A.M.; Olefsky, J.M. The origins and drivers of insulin resistance. Cell 2013, 152, 673–684. [Google Scholar] [CrossRef] [PubMed]
- Hariri, N.; Thibault, L. High-fat diet-induced obesity in animal models. Nutr. Res. Rev. 2010, 23, 270–299. [Google Scholar] [CrossRef] [PubMed]
- Reed, M.J.; Meszaros, K.; Entes, L.J.; Claypool, M.D.; Pinkett, J.G.; Gadbois, T.M.; Reaven, G.M. A new rat model of type 2 diabetes: The fat-fed, streptozotocin-treated rat. Metabolism 2000, 49, 1390–1394. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M.; Lv, X.Y.; Li, J.; Xu, Z.G.; Chen, L. The characterization of high-fat diet and multiple low-dose streptozotocin induced type 2 diabetes rat model. Exp. Diabetes Res. 2008, 2008, 704045. [Google Scholar] [CrossRef] [PubMed]
- Shah, S.M.; Shah, S.M. Phytochemicals, antioxidant, antinociceptive and anti-inflammatory potential of the aqueous extract of Teucrium stocksianum bioss. BMC Complement. Altern. Med. 2015, 15, 351. [Google Scholar] [CrossRef] [PubMed]
- Iwu, M.M. Handbook of African Medicinal Plants; CRC Press: Boca Raton, FL, USA, 2014. [Google Scholar]
- McArdle, M.A.; Finucane, O.M.; Connaughton, R.M.; McMorrow, A.M.; Roche, H.M. Mechanisms of obesity-induced inflammation and insulin resistance: Insights into the emerging role of nutritional strategies. Front. Endocrinol. 2013, 4, 52. [Google Scholar] [CrossRef] [PubMed]
- Wellen, K.E.; Hotamisligil, G.S. Inflammation, stress, and diabetes. J. Clin. Investig. 2005, 115, 1111–1119. [Google Scholar] [CrossRef] [PubMed]
- Mirza, S.; Hossain, M.; Mathews, C.; Martinez, P.; Pino, P.; Gay, J.L.; Rentfro, A.; McCormick, J.B.; Fisher-Hoch, S.P. Type 2-diabetes is associated with elevated levels of TNF-alpha, IL-6 and adiponectin and low levels of leptin in a population of Mexican Americans: A cross-sectional study. Cytokine 2012, 57, 136–142. [Google Scholar] [CrossRef] [PubMed]
- Alexandraki, K.; Piperi, C.; Kalofoutis, C.; Singh, J.; Alaveras, A.; Kalofoutis, A. Inflammatory process in type 2 diabetes: The role of cytokines. Ann. N. Y. Acad. Sci. 2006, 1084, 89–117. [Google Scholar] [CrossRef] [PubMed]
- Olefsky, J.M.; Glass, C.K. Macrophages, inflammation, and insulin resistance. Annu. Rev. Physiol. 2010, 72, 219–246. [Google Scholar] [CrossRef] [PubMed]
- DeFronzo, R.A. Pharmacologic therapy for type 2 diabetes mellitus. Ann. Intern. Med. 1999, 131, 281–303. [Google Scholar] [CrossRef] [PubMed]
- Van der Heijden, R.A.; Sheedfar, F.; Morrison, M.C.; Hommelberg, P.P.; Kor, D.; Kloosterhuis, N.J.; Gruben, N.; Youssef, S.A.; de Bruin, A.; Hofker, M.H.; et al. High-fat diet induced obesity primes inflammation in adipose tissue prior to liver in C57BL/6j mice. Aging 2015, 7, 256–268. [Google Scholar] [CrossRef] [PubMed]
- Deqiu, Z.; Kang, L.; Jiali, Y.; Baolin, L.; Gaolin, L. Luteolin inhibits inflammatory response and improves insulin sensitivity in the endothelium. Biochimie 2011, 93, 506–512. [Google Scholar] [CrossRef] [PubMed]
- Feinstein, R.; Kanety, H.; Papa, M.Z.; Lunenfeld, B.; Karasik, A. Tumor necrosis factor-alpha suppresses insulin-induced tyrosine phosphorylation of insulin receptor and its substrates. J. Biol. Chem. 1993, 268, 26055–26058. [Google Scholar] [PubMed]
- Taniguchi, C.M.; Ueki, K.; Kahn, R. Complementary roles of IRS-1 and IRS-2 in the hepatic regulation of metabolism. J. Clin. Investig. 2005, 115, 718–727. [Google Scholar] [CrossRef] [PubMed]
- Nie, X.Q.; Chen, H.H.; Zhang, J.Y.; Zhang, Y.J.; Yang, J.W.; Pan, H.J.; Song, W.X.; Murad, F.; He, Y.Q.; Bian, K. Rutaecarpine ameliorates hyperlipidemia and hyperglycemia in fat-fed, streptozotocin-treated rats via regulating the IRS-1/PI3K/Akt and AMPK/ACC2 signaling pathways. Acta Pharmacol. Sin. 2016, 37, 483–496. [Google Scholar] [CrossRef] [PubMed]
- Huang, D.W.; Chang, W.C.; Wu, J.S.; Shih, R.W.; Shen, S.C. Gallic acid ameliorates hyperglycemia and improves hepatic carbohydrate metabolism in rats fed a high-fructose diet. Nutr. Res. 2016, 36, 150–160. [Google Scholar] [CrossRef] [PubMed]
- Liou, W.; Chang, L.Y.; Geuze, H.J.; Strous, G.J.; Crapo, J.D.; Slot, J.W. Distribution of cuzn superoxide dismutase in rat liver. Free Radic. Biol. Med. 1993, 14, 201–207. [Google Scholar] [CrossRef]
- Mehta, K.; Van Thiel, D.H.; Shah, N.; Mobarhan, S. Nonalcoholic fatty liver disease: Pathogenesis and the role of antioxidants. Nutr. Rev. 2002, 60, 289–293. [Google Scholar] [CrossRef] [PubMed]
- Aksoy, N.; Vural, H.; Sabuncu, T.; Aksoy, S. Effects of melatonin on oxidative-antioxidative status of tissues in streptozotocin-induced diabetic rats. Cell Biochem. Funct. 2003, 21, 121–125. [Google Scholar] [CrossRef] [PubMed]
- Prakash, J.; Gupta, S.K.; Kochupillai, V.; Singh, N.; Gupta, Y.K.; Joshi, S. Chemopreventive activity of Withania somnifera in experimentally induced fibrosarcoma tumours in Swiss albino mice. Phytother. Res. 2001, 15, 240–244. [Google Scholar] [CrossRef] [PubMed]
- Hsu, C.L.; Yen, G.C. Effect of gallic acid on high fat diet-induced dyslipidaemia, hepatosteatosis and oxidative stress in rats. Br. J. Nutr. 2007, 98, 727–735. [Google Scholar] [CrossRef] [PubMed]
- Li, T.; Matozel, M.; Boehme, S.; Kong, B.; Nilsson, L.M.; Guo, G.; Ellis, E.; Chiang, J.Y. Overexpression of cholesterol 7alpha-hydroxylase promotes hepatic bile acid synthesis and secretion and maintains cholesterol homeostasis. Hepatology 2011, 53, 996–1006. [Google Scholar] [CrossRef] [PubMed]
- Wu, N.; Sarna, L.K.; Hwang, S.Y.; Zhu, Q.; Wang, P.; Siow, Y.L.; O, K. Activation of 3-hydroxy-3-methylglutaryl coenzyme a (HMG-CoA) reductase during high fat diet feeding. Biochim. Biophys. Acta 2013, 1832, 1560–1568. [Google Scholar] [CrossRef] [PubMed]
- Raz, I.; Eldor, R.; Cernea, S.; Shafrir, E. Diabetes: Insulin resistance and derangements in lipid metabolism. Cure through intervention in fat transport and storage. Metab. Res. Rev. 2005, 21, 3–14. [Google Scholar] [CrossRef] [PubMed]
- Ikonen, E. Cellular cholesterol trafficking and compartmentalization. Nat. Rev. Mol. Cell Biol. 2008, 9, 125–138. [Google Scholar] [CrossRef] [PubMed]
- Ji, A.; Wroblewski, J.M.; Cai, L.; de Beer, M.C.; Webb, N.R.; van der Westhuyzen, D.R. Nascent HDL formation in hepatocytes and role of ABCA1, ABCG1, and SR-BI. J. Lipid Res. 2012, 53, 446–455. [Google Scholar] [CrossRef] [PubMed]
- Soumian, S.; Albrecht, C.; Davies, A.H.; Gibbs, R.G. ABCA1 and atherosclerosis. Vasc. Med. 2005, 10, 109–119. [Google Scholar] [CrossRef] [PubMed]
- Singaraja, R.R.; Bocher, V.; James, E.R.; Clee, S.M.; Zhang, L.H.; Leavitt, B.R.; Tan, B.; Brooks-Wilson, A.; Kwok, A.; Bissada, N.; et al. Human ABCA1 BAC transgenic mice show increased high density lipoprotein cholesterol and ApoAI-dependent efflux stimulated by an internal promoter containing liver X receptor response elements in intron 1. J. Biol. Chem. 2001, 276, 33969–33979. [Google Scholar] [CrossRef] [PubMed]
- Uehara, Y.; Engel, T.; Li, Z.; Goepfert, C.; Rust, S.; Zhou, X.; Langer, C.; Schachtrup, C.; Wiekowski, J.; Lorkowski, S.; et al. Polyunsaturated fatty acids and acetoacetate downregulate the expression of the ATP-binding cassette transporter A1. Diabetes 2002, 51, 2922–2928. [Google Scholar] [CrossRef] [PubMed]
- Kim, M.; Lim, S.J.; Lee, H.J.; Kim, S.Y.; Nho, C.W. Gomisin J inhibits oleic acid-induced hepatic lipogenesis by activation of the AMPK-dependent pathway and inhibition of the hepatokine fetuin-A in HepG2 cells. J. Agric. Food Chem. 2015, 63, 9729–9739. [Google Scholar] [CrossRef] [PubMed]
- Chiang, J.Y. Bile acids: Regulation of synthesis. J. Lipid Res. 2009, 50, 1955–1966. [Google Scholar] [CrossRef] [PubMed]
- Pozzo, L.; Vornoli, A.; Coppola, I.; Croce, C.M.; Giorgetti, L.; Gervasi, P.G.; Longo, V. Effect of HFD/STZ on expression of genes involved in lipid, cholesterol and glucose metabolism in rats. Life Sci. 2016, 166, 149–156. [Google Scholar] [CrossRef] [PubMed]
Genes | Sequence of Forward and Reverse Primers (5′ to 3′) | Annealing Temperature (°C) | Accession No. |
---|---|---|---|
SREBP-2 | FP: AGACTTGGTCATGGGGACAG RP:GGGGAGACATCAGAAGGACA | 60 °C | NM_001033694 |
HMG-CoAR | FP: CCCAGCCTACAAACTGGAAA RP:CCATTGGCACCTGGTACTCT | 55 °C | NM_013134 |
LDLR | FP: CAGCTCTGTGTGAACCTGGA RP:TTCTTCAGGTTGGGGATCAG | 55 °C | NM_175762 |
SR-B1 | FP: TGCCCCAGGTTCTTCACTAC RP:CCCTACAGCTTGGCTTCTTG | 60 °C | NM_031541 |
ABCA1 | FP: GTACCCAGCGTCCTTTGTGT RP:CCCAAGAGAGTGGAGAGACG | 58 °C | NM_178095 |
ABCG1 | FP: CTGCAAGAGAGGGATGAAGG RP:ACAGGAGGGTTGTTGACCAG | 58 °C | NM_178095 |
CYP7A1 | FP: CACCATTCCTGCAACCTTTT RP:GTACCGGCAGGTCATTCAGT | 60 °C | NM_012942 |
TNF-α | FP: AAATGGGCTCCCTCTCATCAG RP:TTCTCTGCTTGGTGGTTTGCTACGAC | 58 °C | NM_012675 |
IL-6 | FP: TCTCTCCGCAAGAGACTTCCA RP:ATACTGGTCTGTTGTGGGTGG | 60 °C | NM_012589.2 |
GAPDH | FP: AGACAGCCGCATCTTCTTGT RP:CTTGCCGTGGGTAGAGTCAT | 60 °C | NM_017008 |
Measurements | Control | DC | DC + CO-EtOAc (50 mg/kg) | DC + CO-EtOAc (150 mg/kg) |
---|---|---|---|---|
Body weight | ||||
Wk-0 BW (g) | 153.42 ± 6.52 a | 151.87 ± 4.67 a | 159.01 ± 3.55 a | 154.33 ± 5.64 a |
Wk-2 BW (g) | 271.13 ± 9.33 b | 308.72 ± 10.33 a | 309.69 ± 11.65 a | 297.45 ± 7.65 a |
Wk-8 BW (g) | 414.43 ± 9.74 b | 448.62 ± 15.68 a | 440.11 ± 23.19 a | 411.55 ± 13.95 b |
Body weight gain (g) | 143.30 ± 0.41 b | 139.90 ± 5.35 a | 130.42 ±11.54 a | 114.10 ± 6.30 c |
Food intake (g/d) | 27.61 ± 2.05 a | 25.64 ± 3.72 a | 24.76 ± 4.63 a | 25.76 ± 3.68 a |
EAT weight (g) | 4.51 ± 0.27 c | 7.54 ± 1.71 a | 5.92 ± 1.33 b | 5.02 ± 0.22 b |
BG (mg/dL) | 102.75 ± 7.95 d | 309.3 ± 10.56 a | 174.42 ± 10.56 c | 252.55 ±12.10 b |
Serum | ||||
Insulin (ng/mL) | 1.25 ± 0.24 b | 0.60 ± 0.18 a | 0.55 ± 0.19 a | 0.53 ± 0.12 a |
TC (mg/dL) | 50.43 ± 8.50 b | 71.04 ± 7.01 a | 49.53 ± 12.60 b | 42.88 ± 10.32 b |
HDL-C (mg/dL) | 27.38 ± 0.91 b | 22.13 ± 1.16 b | 28.13 ± 0.81 a | 33.88 ± 2.61 a |
BA (mg/dL) | 30.53 ± 4.93 c | 50.48 ± 6.55 a | 41.25 ± 5.85 b | 35.75 ± 7.22 b,c |
TG (mg/dL) | 75.25 ± 7.51 c | 145.42 ± 18.61 b | 92.45 ± 10.14 a | 72.22 ± 9.22 a |
TNF-α (pg/mL) | 4.52 ± 0.25 c | 7.83 ± 1.66 a | 5.27 ± 0.48 b | 4.84 ± 0.80 c |
AST (IU/L) | 38.57 ± 4.41 b | 71.30 ± 16.42 a | 40.83 ± 9.46 b | 33.14 ± 7.41 b |
ALT (IU/L) | 20.57 ± 7.88 b | 47.30 ± 12.30 a | 25.83 ± 6.46 b | 23.14 ± 4.35 b |
Measurements | Control | DC | DC + CO-EtOAc (50 mg/kg) | DC + CO-EtOAc (150 mg/kg) |
---|---|---|---|---|
SOD (U mg protein−1) | 83.33 ± 8.88 a | 59.37 ± 11.96 b | 65.37 ± 12.45 ab | 85.37 ± 10.23 a |
GSH (μmol mg protein−1) | 32.55 ± 3.72 a | 17.72 ± 2.86 b | 28.64 ± 4.41 ab | 36.72 ± 4.86 a |
GPx (nmol mg protein−1) | 101.51 ± 10.37 a | 60.5 ± 8.69 b | 76.5 ± 6.43 ab | 92.5 ± 4.69 a |
CAT (U mg protein−1) | 59.32 ± 6.52 a | 21.5 ± 4.43 cd | 28.5 ± 2.43 c | 50.5 ± 4.38 b |
TBARS (nmol mg protein−1) | 1.13 ± 0.71 c | 3.12 ± 0.73 a | 1.82 ± 0.35 b | 1.54 ± 0.27 b |
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yeh, Y.-T.; Chiang, A.-N.; Hsieh, S.-C. Chinese Olive (Canarium album L.) Fruit Extract Attenuates Metabolic Dysfunction in Diabetic Rats. Nutrients 2017, 9, 1123. https://0-doi-org.brum.beds.ac.uk/10.3390/nu9101123
Yeh Y-T, Chiang A-N, Hsieh S-C. Chinese Olive (Canarium album L.) Fruit Extract Attenuates Metabolic Dysfunction in Diabetic Rats. Nutrients. 2017; 9(10):1123. https://0-doi-org.brum.beds.ac.uk/10.3390/nu9101123
Chicago/Turabian StyleYeh, Yu-Te, An-Na Chiang, and Shu-Chen Hsieh. 2017. "Chinese Olive (Canarium album L.) Fruit Extract Attenuates Metabolic Dysfunction in Diabetic Rats" Nutrients 9, no. 10: 1123. https://0-doi-org.brum.beds.ac.uk/10.3390/nu9101123