Next Article in Journal
Comparative Analysis of Microcystin Prevalence in Michigan Lakes by Online Concentration LC/MS/MS and ELISA
Next Article in Special Issue
Grape Seed Proanthocyanidin Extract Alleviates AflatoxinB1-Induced Immunotoxicity and Oxidative Stress via Modulation of NF-κB and Nrf2 Signaling Pathways in Broilers
Previous Article in Journal
In Vitro and in Field Response of Different Fungicides against Aspergillus flavus and Fusarium Species Causing Ear Rot Disease of Maize
Previous Article in Special Issue
Optimization of Storage Conditions of the Medicinal Herb Ilex asprella against the Sterigmatocystin Producer Aspergillus versicolor Using Response Surface Methodology
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effect of Compound Probiotics and Mycotoxin Degradation Enzymes on Alleviating Cytotoxicity of Swine Jejunal Epithelial Cells Induced by Aflatoxin B1 and Zearalenone

1
College of Animal Science and Veterinary Medicine, Henan Agricultural University, Zhengzhou 450002, China
2
Henan Guangan Biotechnology Co., Ltd., Zhengzhou 450001, China
3
Henan Delin Biological Product Co. Ltd., Xinxiang 453000, China
4
Henan Puai Feed Co. Ltd., Zhoukou 466000, China
*
Author to whom correspondence should be addressed.
Submission received: 1 October 2018 / Revised: 19 December 2018 / Accepted: 24 December 2018 / Published: 10 January 2019

Abstract

:
Zearalenone (ZEA) and aflatoxin B1 (AFB1) are two main kinds of mycotoxins widely existing in grain and animal feed that cause a lot of economic loss and health problems for animals and humans. In order to alleviate the cytotoxic effects of AFB1 and ZEA on swine jejunal epithelial cells (IPEC-J2), the combination of a cell-free supernatant of compound probiotics (CFSCP) with mycotoxin degradation enzymes (MDEs) from Aspergillus oryzae was tested. The results demonstrated that coexistence of AFB1 and ZEA had synergetic toxic effects on cell viability. The cell viability was decreased with mycotoxin concentrations increasing, but increased with incubation time extension. The necrotic cell rates were increased when 40 µg/L AFB1 and/or 500 µg/L ZEA were added, but the addition of CFSCP + MDE suppressed the necrotic effects of AFB1 + ZEA. The viable cell rates were decreased when AFB1 and/or ZEA were added: However, the addition of CFSCP + MDE recovered them. The relative mRNA abundances of Bcl-2, occludin, and ZO-1 genes were significantly upregulated, while Bax, caspase-3, GLUT2, ASCT2, PepT1, and IL6 genes were significantly downregulated by CFSCP + MDE addition, compared to the groups containing 40 µg/L AFB1 and 500 µg/L ZEA. This research provided an effective strategy in alleviating mycotoxin cytotoxicity and keeping normal intestinal cell structure and animal health.
Key Contribution: The combination of mycotoxin degradation enzymes and compound probiotics can alleviate swine jejunal epithelial cell damage induced by aflatoxin B1 and zearalenone through mycotoxin biodegradation and gut protection.

1. Introduction

Mycotoxins are ubiquitous and accessible in grain, feedstuffs, human foods, animal products, and soil, and are the secondary metabolites of molds such as Aspergillus, Penicillium, and Fusarium. Presently, about 300 fungal metabolites from more than 100 species of fungi have been reported to have toxigenic potential [1]. Mycotoxins bring a critical threat to food safety due to their adverse impacts on human and animal health [2]. Among many kinds of mycotoxins, aflatoxin B1 (AFB1) and zearalenone (ZEA) are recognized as the common and major mycotoxin contaminants in agricultural products and their byproducts. AFB1 is the most lethal mycotoxin, demonstrating mutagenic, hepatotoxic, carcinogenic, and teratogenic impacts on many kinds of animals: Therefore, it is classified as the top carcinogen [3]. ZEA has been regarded as a kind of nonsteroidal estrogenic compound, causing anabolic activity and hyperestrogenism in the reproductive organs of animals [4]. ZEA is regularly found in corn and its derived byproducts, secreted by Fusarium graminearum and other microbes, and has a macrocyclic lactone to bind affinity to estrogen receptors for causing estrogenic effects on pigs [5]. It has also been regarded as a causative agent of infertility in decreasing milk production in cattle [6]. Therefore, mycotoxin contamination is a major health concern for animals and human beings. The current problem is that health risk assessments usually depend on one single mycotoxin, which may neglect the superimposition or competitive interactions among the coexisting mycotoxins [7]. It should be noted that more than one kind of mycotoxin may occur in a given sample. The reasons are that one species of molds may produce more than one kind of mycotoxins or the different samples from different places may contain different kinds of mycotoxins. Thus, the study of the synchronous degradation of both AFB1 and ZEA has become more and more important.
Mycotoxin contamination in food and feed samples is a serious recurring problem around the world. A survey was conducted to detect the coexistence of AFB1 and ZEA in animal and agriculture products: The detection rates of AFB1/ZEA were 65%/49%, 8%/52%, and 50%/19% in Southeast Asia, North America, and Southern Europe, respectively [8]. According to the estimates conducted by the Food and Agriculture Organization, about 25% of worldwide crops are contaminated by mycotoxins, causing economic losses of up to billions of dollars [9]. Therefore, it is important to master mycotoxin levels in feed ingredients to keep animal health and ensure human food safety [10].
In order to degrade mycotoxins, many physical and chemical detoxification methods have been developed to inhibit mycotoxigenic fungal growth or remove mycotoxin contamination, but few methods can meet the requirements due to biosafety risks, high costs, or limited binding capacity. It is necessary to find optimal biological detoxification methods to guarantee food safety for animals and human beings [11]. Many species of bacteria, molds, and yeasts have shown the capability to biodegrade mycotoxins. For example, Mycobacterium fluoranthenivorans, Rhodococcus erythropolis, and other microbes have been reported to pose the aflatoxin detoxifizyme or to have potential for aflatoxin degradation [12,13,14,15,16]. Other research has indicated that Pseudomonas sp., Rhodococcus pyridinivorans, and Saccharomyces cerevisiae are able to degrade ZEA [17,18,19]. Zuo et al. reported that the cooperation of both AFB1 degradation enzyme and probiotics could degrade AFB1 effectively [20]. Our previous research showed that the combination of mycotoxin degradation enzymes and probiotics were effective for AFB1 and ZEA synchronous degradations [21].
Interest in biological detoxification of AFB1 or ZEA has greatly increased during the past decade. It was reported that Lactobacillus plantarum could alleviate disturbances in intestinal DNA fragmentation and gene expressions in mice treated with AFB1 or AFM1 [22]. Several studies have revealed that lactic acid bacteria and Bifidobacteria are able to bind mycotoxins and reduce their toxicity [23,24]. Therefore, the use of probiotics is beneficial to human beings and animals chronically exposed to mycotoxins.
Generally, the intestine acts as the first physical barrier in regulating nutrient and water uptake and excluding potential pathogens and toxicants [25,26,27]. The small intestine usually contacts and absorbs ZEA and AFB1 first: Consequently, it is exposed to high mycotoxin concentrations, which certainly affect intestinal health [28]. It has been proven that epithelial cell functions and integrity are disrupted by ZEA [29]. However, studies of inflammatory response, barrier function, and nutrient absorption in the intestinal tract induced by the individual or superimposed cytotoxicity of ZEA and AFB1 are still limited.
IPEC-J2, a jejunal epithelial cell line of porcine, is a good model to study the human intestinal immune system and toxin interactions with gut mucosa [30,31]. It has also been used as an initial tool to screen potential probiotic microorganisms for their adhesiveness and anti-inflammatory properties [32]. Intestinal epithelial cells allow nutrient absorption and prevent the passage of pathogens and toxins into systemic circulation. Previous research has indicated that probiotics can protect intestinal epithelial barrier from pathogenic bacteria and mycotoxins [33]. However, the molecular mechanisms of probiotics and the mycotoxin degradation enzymes involved in mycotoxin biodegradation and gastrointestinal tract protection against mycotoxin attacks are unknown.
The objective of this research was to determine the combinatorial toxicity of AFB1 and ZEA in vitro, and to reveal the effect of the combination of a cell-free supernatant of compound probiotics (CFSCP) with mycotoxin degradation enzymes (MDEs) on alleviating IPEC-J2 damage induced by ZEA and AFB1.

2. Results

2.1. The Preliminary Reaction Time, Concentrations, and Relationship of AFB1 and ZEA Determined by the Exposed IPEC-J2 Cell Viability

Table 1 demonstrates that there were superimposition interactions between AFB1 and ZEA in inhibiting cell viability, which was higher than the individual mycotoxin (p < 0.05). The relative cell viability was reduced by 7.89% when ZEA + AFB1 concentrations were increased from 500 + 40 µg/L to 1000 + 80 µg/L after 24 h reaction (p < 0.05): However, it was increased by 16.71% when the reaction time was extended from 6 h to 48 h with ZEA + AFB1 concentrations at 500 + 40 µg/L (p < 0.05). Single CFSCP + MDE addition had no significant effect on relative cell viability from 6 h to 48 h incubation (p > 0.05). After considering the above results and international standards of mycotoxin thresholds in feedstuffs, the optimal reaction conditions for the further cytotoxic experiment were confirmed as 40 µg/L AFB1 and 500 µg/L ZEA with 24 h reaction.

2.2. Effects of CFSCP + MDE on Alleviating Cell Necrosis and Apoptosis Induced by AFB1 and ZEA

Table 2 shows that the necrotic cell rates (Q1), the late apoptotic cell rates (Q2), the early apoptotic cell rates (Q3), and the viable cell rates (Q4) in AFB1 and/or ZEA, single CFSCP + MDE, and AFB1 + ZEA + CFSCP + MDE groups were significantly different, compared to the control group (p < 0.05). The early and late apoptotic cell rates in the A40, Z500 + A40, single CFSCP + MDE, and Z500 + A40 + CFSCP + MDE groups were higher than Z500 and the control groups (p < 0.05). It was also found that single CFSCP + MDE addition without mycotoxins could increase necrotic and apoptotic cell rates (p < 0.05) and decrease viable cell rates (p < 0.05) compared to the control group. However, CFSCP + MDE addition together with AFB1 + ZEA were able to decrease necrotic cell rates by 42.69% (p < 0.05) and increase viable cell rates by 3.11% (p < 0.05) compared to the AFB1 + ZEA group without the CFSCP + MDE addition. It could be summarized that a CFSCP + MDE addition in Z500 + A40 had the ability to alleviate mycotoxin cytotoxicity and make necrotic and viable cell rates recover to the same levels as the single CFSCP + MDE addition group.

2.3. Effects of CFSCP + MDE on Inflammation, Apoptosis, Tight Junction (TJ) Proteins, and Nutrient Transport Gene mRNA Abundances of IPEC-J2 Cells Induced By AFB1 And ZEA

Compared to the Z500 + A40 group, the relative mRNA abundance of B-cell lymphoma-2 (Bcl-2) was significantly upregulated, while Bax and cysteinyl aspartate specific protease (caspase-3) were downregulated in Z500 + A40 + CFSCP + MDE and single CFSCP + MDE groups (p < 0.05), indicating that CFSCP + MDE was able to alleviate mycotoxin cytotoxicity through decreasing cell apoptosis. The relative mRNA abundances of Bax and caspase-3 were significantly upregulated, while the relative mRNA abundances of Bcl-2 were downregulated in the A40 and Z500 + A40 groups, compared to other groups (p < 0.05) (see Figure 1).
Figure 2 shows that the relative mRNA abundances of occludin and ZO-1 in the Z500 + A40 + CFSCP + MDE group were upregulated (p < 0.05) compared to other groups. The relative mRNA abundance of occludin in the A40 group was significantly lower than the Z500 + A40 and Z500 + A40 + CFSCP + MDE groups (p < 0.05). The relative mRNA abundances of ZO-1 in the A40 and Z500 + A40 groups were significantly lower than those in the other three groups, except for the Z500 group (p < 0.05). This implied that a CFSCP + MDE addition could make cell structure tight and protect intestinal cells from mycotoxin attack, especially when mycotoxins existed.
Figure 3 shows that mRNA abundances of ASC amino acid transporter 2 (ASCT2) in the Z500 + A40 + CFSCP + MDE group was significantly downregulated compared to the other groups (p < 0.05). The mRNA abundance of facilitated glucose transporter (GLUT2) was significantly upregulated by Z500 + A40 and downregulated by the single CFSCP + MDE addition (p < 0.05): However, Z500 + A40 + CFSCP + MDE could adjust GLUT2 to the normal level as the control group to keep regular nutrient transportation. The mRNA abundances of peptide transporter 1 (PepT1) in the three AFB1-containing groups were significantly lower than the control and single CFSCP + MDE addition groups (p < 0.05). CFSCP + MDE addition in Z500 + A40 could upregulate PepT1 mRNA abundance, compared to the Z500 + A40 group (p < 0.05). There were no significant differences for sodium-dependent glucose cotransporter 1 (SGLT1) among the six groups (p > 0.05).
Figure 4 indicates that AFB1 and ZEA alone or together significantly upregulated the interleukin-6 (IL6) mRNA expression level (p < 0.05): However, single CFSCP + MDE or CFSCP + MDE Z500 + A40 significantly downregulated the IL6 mRNA expression level (p < 0.05). This led to a hypothesis that CFSCP + MDE could alleviate mycotoxin cytotoxicity to decrease inflammation and cell apoptosis.

3. Discussion

Table 1 shows that the coexistence of AFB1 and ZEA was more toxic than the individual mycotoxin in inhibiting cell viability at different reaction times and different mycotoxin concentrations. The reason was due to the toxic superimposition of AFB1 and ZEA, in agreement with a previous report in which it was proven that the combined cytotoxic effects for kidney, liver, and other cell lines appeared when more than one kind of mycotoxin coexisted [34]. Of course, cell viability is affected by many factors, such as cell type, exposure period, mycotoxin doses and kinds, and metabolites [35]. Why is cell viability increased with reaction time extension? The main reason may be due to the increasing adaptability of intestinal cells under long-time exposure to mycotoxins [35].
When AFB1 and/or ZEA was added, the necrotic cell rates were increased, and viable cell rates were decreased. However, a CFSCP + MDE addition could alleviate the toxicity of AFB1 and ZEA, which may be from mycotoxin biodegradation [21]. A relevant report indicated that Lactobacillus acidophilus and Lactobacillus reuteri could inhibit ochratoxin A (OTA) effects on IL-10 and TNF-α secretion and apoptotic induction in the mononuclear cells of human peripheral blood [36]. The early and late apoptotic cell rates were significantly enhanced in the groups containing individual AFB1 or AFB1 + ZEA, but only ZEA could not induce cell apoptosis, indicating that AFB1 is more toxic than ZEA for inducing cell apoptosis. This result corresponds with previous research in which 10–40 μM ZEA could not induce apoptosis in porcine kidney 15 cells [34], but is inconsistent with another research project in which 120 μM (approximately 38.20 μg/mL) ZEA induced a 61.8% apoptotic rate of porcine granulosa cells [37]. The different mycotoxin cytotoxicity may be related to different mycotoxin concentrations and cell types, since the different kinds of mycotoxins have different effects on the various organs [36,38].
Generally, cell apoptosis is inhibited by Bcl-2 and promoted by Bax and caspase-3 gene expressions. A previous report showed that probiotics could upregulate anti-apoptotic genes such as Bcl-2 and downregulate apoptotic genes such as Bax and caspase-3 [39]. An AFB1 or AFB1 + ZEA addition in this study upregulated caspase-3 and Bax mRNA abundance. Caspase-3 is an important apoptotic biomarker that can be enhanced by various stress-inducing factors [40], indicating that mycotoxins cause cell apoptosis. It was found that the single CFSCP + MDE addition or CFSCP + MDE + A40 + Z500 could upregulate Bcl-2 mRNA abundance and downregulate Bax and caspase-3 mRNA abundances: It can be inferred that CFSCP + MDE was able to decrease cell apoptosis, consistent with the result measured by the fluoresceine isothiocyanate (FITC) method in this research.
SGLT1 plays an important role in the small intestine in active glucose uptake, while GLUT2 helps to diffusively transport intracellular glucose into the bloodstream. GLUT2 mRNA abundance was upregulated by 500 µg/L ZEA plus 40 µg/L AFB1, but it was downregulated to the normal level by CFSCP + MDE addition, indicating that CFSCP + MDE could regulate GLUT2 gene expression in keeping regular nutrient transport and absorption in the intestines. It has been reported that deoxynivalenol and other mycotoxins affect nutrient absorption in human and mouse intestinal epithelial cells [41,42], in agreement with the mRNA abundance change of the relative gene induced by mycotoxins in this study. ASCT2 is an amino acid transporter, and is highly expressed in cancer cells [43]: The downregulation of the ASCT2 gene by a CFSCP + MDE addition will help to alleviate cytotoxicity induced by AFB1 and ZEA. PepT1 is a peptide carrier [44], and the downregulation of the PepT1 gene by an A40 + Z500 addition may affect peptide metabolism in the intestine. A CFSCP + MDE addition in A40 + Z500 can upregulate the PepT1 gene to recover normal peptide metabolism.
TJ proteins that are multiprotein complexes mainly sustain the intestinal epithelial barrier [45]. Intestinal tight junctions are the therapeutic target for the modulation of intestinal barrier function and the prevention of various gastrointestinal diseases, including the symposiums caused by mycotoxins. TJ proteins include ZO-1, occludin, and claudin [46]. This result showed that a CFSCP + MDE addition in A40 + Z500 could upregulate the relative mRNA abundances of ZO-1 and occludin in protecting the gut mucosal barrier from damage induced by mycotoxins. The reason may be due to probiotic functions in protecting the intestine from mycotoxin damage. Previous research has reported that ZO-1 expression of IPEC-J2 cells treated with Bacillus subtilis was upregulated against deoxynivalenol-induced damage [47], and that a probiotic mixture could protect the epithelial barrier of mice by maintaining tight junction protein expression and preventing cell apoptosis [48], corresponding with this research. Compared to the single CFSCP + MDE addition, Z500 + A40 + CFSCP + MDE significantly upregulated ZO-1 and occludin mRNA abundances, maybe due to the stimulating response from mycotoxins.
Cytokines are the key signals in the intestinal immune system and play pivotal roles in host defense, inflammatory responses, and autoimmune disease. IL-6 is a main signal factor of the gut immune and inflammatory response, and is excreted by different stimulators, such as mycotoxins, microbial infections, and other factors [49]. AFB1 and ZEA alone or together led to an upregulation of IL-6 mRNA abundance, indicating that inflammation was triggered by mycotoxins. However, single CFSCP + MDE addition or Z500 + A40 + CFSCP + MDE could downregulate IL-6 mRNA abundance: It could be inferred that the combination of probiotics and mycotoxin degradation enzymes was able to alleviate the cytotoxicity of mycotoxins.

4. Conclusions

This study demonstrated that the combination of compound probiotics and mycotoxin degradation enzymes could alleviate cell damage, necrosis, inflammatory responses of IPEC-J2 cells induced by ZEA and AFB1 through positively regulating gene expressions relative to intestinal cell inflammation, apoptosis, TJ proteins, nutrient transport, and absorption. It provided a new method for alleviating mycotoxin cytotoxicity in protecting intestinal cells from mycotoxin attack.

5. Materials and Methods

5.1. Chemicals and Cell Culture

AFB1 and ZEA were purchased from Sigma-Aldrich (St. Louis, MO, U.S.) and dissolved in dimethyl sulfoxide (DMSO) (Shanghai Solarbio Biotechnology Co., Ltd. Shanghai, China) and 99.6% ethanol to prepare the concentrations of 1 mg/mL and 10 mg/mL as stock solutions, respectively. Work solutions were diluted with Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12 at 1/1) (Hyclone, Logan, UT, U.S.) without serum and antibiotics. Phosphate-buffered saline (PBS) and thiazolyl blue tetrazolium bromide (MTT) were purchased from Solarbio (Shanghai Solarbio Biotechnology Co., Ltd. Shanghai, China). The final concentrations of DMSO and ethanol used as solvents in the cell culture medium were less than 0.1%. IPEC-J2 cells for subculture use were cultured in DMEM/F12 added with 10% fetal bovine serum (Biological Industries, Kibbutz Beit-Haemek, Israel) without antibiotics. The cells were routinely seeded at a density of 5 × 105 in plastic tissue culture flasks (25 cm2), kept in a humidified incubator at 37 °C with 5% CO2, and passaged twice weekly.

5.2. Microbial Preparation

B. subtilis, Lactobacillus casein (L. casein), Candida utilis (C. utilis), and Aspergillus oryzae (A. oryzae) were obtained from China General Microbiological Culture Collection Center (CGMCC). B. subtilis, L. casein, and C. utilis were inoculated in LB, MRS, and YPD media, respectively, and incubated according to the previous report [21]. The above microbes were harvested after 24 h culture for further use. The visible microbial counts were respectively adjusted to 1.0 × 107 count-formed units (cfu)/mL with DMEM/F12. CFSCP was prepared by the following: The compound probiotics were mixed at a ratio of 1:1:1 [21], centrifuged at 4 °C and 12000× g for 10 min, and filtered through 0.22 μm Minisart high-flow filter (Sartorius Stedim Biotech Gmbh, Goettingen, Germany) to remove the microbes.
The mycotoxin degradation enzymes for AFB1 and ZEA detoxification were extracted from solid-state fermentation of A. oryzae according to the following process: The solid-state fermentation was conducted in 250-mL Erlenmeyer flasks containing 15 g of medium, which consisted of corn meal, soybean meal, and wheat bran at a ratio of 1:2:7 (w/w). After 9 mL distilled water was added, they were homogeneously mixed and autoclaved. About 2 mL of A. oryzae at 1 × 108 spores/mL was added to the sterilized medium, mixed, and incubated at 30 °C for 7 d. In order to extract the crud enzymes, the fermented stuffs were mixed with 75 mL DMEM/F12 (w/v) in a flask, shaken at 30 °C and 150 rpm for 1 h on a rotor wheel, and then stood for 1 h. The mixture was filtered by eight-layer gauze, followed by filtering through Whatman No.4 filter paper (20–25 μm pore diameters), and was centrifuged for 15 min at 3,000× g to remove the residue. The crude enzymes were obtained by filtering through a 0.22-μm Minisart high-flow filter to remove the microbes. At last, the MDE from A. oryzae was diluted by 320 folds with DMEM/F12 and stored at 4 °C for further use. AFB1-degrading enzyme activity (284.3 U/L) was measured with the previous protocol [50] and modified as the following: One unit of enzyme activity was defined to degrade 1 ng AFB1 per min at 37 °C and pH 8.0. The ZEA-degrading enzyme activity (31.0 U/L) was measured using the above method modified with ZEA as the substrate.

5.3. Experimental Design

In order to determine the effect of CFSCP + MDE on alleviating IPEC-J2 cell damage induced by AFB1 and ZEA, the experimental design was as following:
(1)
Control group;
(2)
CFSCP + MDE;
(3)
Toxin group added with 500 or 1000 µg/L ZEA (Z500 or Z1000);
(4)
Toxin group added with 40 or 80 µg/L AFB1 (A40 or A80);
(5)
Toxin group added with 500 µg/L ZEA and 40 µg/L AFB1 or 1000 µg/L ZEA and 80 µg/L AFB1 (Z500 + A40 or Z1000 + A80);
(6)
Toxin group added with 500 µg/L ZEA and 40 µg/L AFB1 plus CFSCP + MDE (Z500 + A40 + CFSCP + MDE).
About 3 µL CFSCP and 2 µL MDE were added into the total 100 µL reaction volume at a ratio of 3:2, as in our previous report [21].

5.4. Cell Viability Determination

Cell viability was determined by the previous MTT assay [51]. IPEC-J2 cells were seeded at 4000 cells/well in 96-well tissue culture plates (COSTAR, Corning, NY, U.S.) in the cytotoxic experiment. After the cells were adhered for 24 h at 37 °C and 5% CO2, the supernatants were discarded. The cells were washed with PBS 3 times, and then 100 μL DMEM/F12 containing the different ingredients without serum and antibiotics in 6 groups was added to the plates according to the above design. The cells were exposed to ZEA (500 and 1000 µg/L) and/or AFB1 (40 and 80 µg/L) for 24 h. At the end of the treatments, each well was added with 10 μL MTT solution (5 mg/mL in PBS), and 4 h later the medium was discarded. Thereafter, 150 μL DMSO was added to each well, and the plates were shaken for 10 min to dissolve the purple formazan crystals. Absorbance (A) was measured at 490 nm (A490) and 630 nm (A630) by using an ELx 800 microplate reader (BIO-TEK Instruments Inc., Winooski, VT, U.S.). Cell counting was conducted using a hemacytometer. The relative viability of the IPEC-J2 cells treated with mycotoxins was expressed as the ratio of optical density (OD), compared to the control group.

5.5. Determination of Cell Status

IPEC-J2 cells were incubated with AFB1 and/or ZEA for 24 h with or without CFSCP and MDE addition, and then harvested. Each well was washed twice with 1 mL PBS for removing the dead cells caused by the trypsin (without EDTA) treatment or cultivation process. Thereafter, 100 μL aliquots (105 cells) of the solutions were put into 1-mL centrifuge tubes and centrifuged at 800 rpm and 4 °C for 5 min to remove the mycotoxins and cellular debris, and the pellets were suspended in 1 mL PBS again. Then, 10 μL propidium iodide (PI) and 5 μL Annexin V–fluorescein isothiocyanate (FITC) were added into the tubes and gently rotated. The cells were incubated at room temperature in the dark for 15 min, and then 400 μL of binding buffer was added to each tube. At last, the cells were measured with flow cytometry (Em 530 nm, Ex 488 nm, Becton Dickinson Company, NJ, U.S.). Cell status was analyzed by dual staining method with Annexin V–FITC and PI, allowing the discrimination of necrotic (FITC+/PI+), apoptotic (FITC+/PI), late apoptotic, or viable cells (FITC/PI).

5.6. qRT-PCR Analysis of Cytokine Genes

IPEC-J2 cells were seeded with a density of 3 × 105 cells per well in 6-well culture plates (Costar, Corning, NY, U.S.) and allowed to adhere for 24 h. Then, the cells were washed with PBS and treated with AFB1 and/or ZEA in serum-free medium for 24 h. Total RNA was extracted by using Trizol (Invitrogen, Carlsbad, CA, U.S.) according to the manufacturer’s instructions. The RNA pellets were dissolved in 30 μL RNase-free water and stored at −80 °C. The RNA concentration was determined using a NanoDrop ND-1000 Spectrophotometer (Nano-Drop Technologies, Wilmington, DE, U.S.) with purity ascertained (A260/A280) between 1.8 and 2.1. About 1 μg total RNA from each sample was converted into cDNA by using TB GREEN (TaKaRa, Dalin, China) for qRT-PCR analysis according to the manufacturer’s instruction. The qPCR was performed to quantify the target genes, such as IL6, caspase-3, tight junction (TJ) proteins (occludin and zonula occludens 1 (ZO-1)), and the others (see Table 3). The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was used as the housekeeping gene. The relative changes in gene expression levels of cytokines in IPEC-J2 cells normalized against GAPDH in response to mycotoxin treatments were determined by using the 2−ΔΔCT method [52].

5.7. Data Analyses

All experiments were conducted with six replicates for each treatment. Data are presented as means ± SD, and one-way analysis of variance (ANOVA) with SPSS 20.0 (Sishu software (Shanghai) Co., Ltd. Shanghai, China) was applied. The Duncan test was used in this experiment. Differences were considered statistically significant at p < 0.05.

Author Contributions

W.H. and Q.Y. conceived and designed the experiments; W.H., C.L., T.G. and X.D. performed the experiments; J.C. and P.W. analyzed the data; A.S. and F.L. contributed reagents/materials/analysis tools; W.H. and Q.Y. wrote the paper.

Funding

This research was financed by the Natural Science Foundation of Henan Province (182300410029) and the Henan Key Scientific and Technological Project (171100110500).

Conflicts of Interest

The authors declare that there are no conflicts of interest associated with this research.

References

  1. Paterson, R.R.M.; Lima, N. How will change affect mycotoxins in food. Food Res. Int. 2010, 42, 1902–1914. [Google Scholar] [CrossRef]
  2. Wild, C.P.; Miller, J.D.; Groopman, J.D. Mycotoxin Control in Low- and Middle-Income Countries; IARC Working Group Reports; International Agency for Research on Cancer: Lyon, France, 2015. [Google Scholar]
  3. Rawal, S.; Kim, J.E.; Coulombe, J.R. Aflatoxin B1 in poultry: Toxicology, metabolism and prevention. Res. Vet. Sci. 2010, 89, 325–331. [Google Scholar] [CrossRef] [PubMed]
  4. Kuiper-Goodman, T.; Scott, P.M.; Watanabe, H. Risk assessment of the mycotoxin zearalenone. Regul. Toxicol. Pharmacol. 1987, 7, 253–306. [Google Scholar] [CrossRef]
  5. Diekman, M.A.; Green, M.L. Mycotoxins and reproduction in domestic livestock. J. Animal Sci. 1992, 70, 1615–1627. [Google Scholar] [CrossRef]
  6. D’Mello, J.P.F.; Mac Donald, A.M.C. Mycotoxins. Anim. Feed Sci. Tech. 1997, 69, 155–166. [Google Scholar] [CrossRef]
  7. Yang, Y.X.; Yu, S.; Tan, Y.; Liu, N.; Wu, A. Individual and combined cytotoxic effects of co-cccurring deoxynivalenol family mycotoxins on human gastric epithelial cells. Toxins 2017, 9, 96. [Google Scholar] [CrossRef]
  8. Rodriguez-Carrasco, Y.; Jose Ruiz, M.; Font, G.; Berrada, H. Exposure estimates to Fusarium mycotoxins through cereals intake. Chemosphere 2013, 93, 2297–2303. [Google Scholar] [CrossRef]
  9. FAO. Manual on the Application of the HACCP System in Mycotoxin Prevention and Control; Joint FAO/WHO Food Standards Programme FAO: Rome, Italy, 2002. [Google Scholar]
  10. San’Ana, A.S.; Rosenthal, A.; De Massaguer, P.R. The fate of patulin in apple juice processing: A review. Food Res. Int. 2008, 41, 441–453. [Google Scholar] [CrossRef]
  11. Walter, P.P.; Tunde, P.; Istvan, P. Mycotoxins-prevention and decontamination by yeast. J. Basic Microbiol. 2015, 55, 805–818. [Google Scholar]
  12. Teniola, O.D.; Addo, P.A.; Brost, I.M.; Färber, P.; Jany, K.D.; Alberts, J.F.; Holzapfel, W.H. Degradation of aflatoxin B1 by cell-free extracts of Rhodococcus erythropolis and Mycobacterium fluoranthenivorans sp. nov. DSM44556T. Int. J. Food Microbiol. 2005, 105, 111–117. [Google Scholar] [CrossRef]
  13. Cserháti, M.; Kriszt, B.; Krifaton, C.; Szoboszlay, S.; Háhn, J.; Toth, S.; Nagy, I.; Kukolya, J. Mycotoxin-degradation profile of Rhodococcus strains. Int. J. Food Microbiol. 2013, 166, 176–185. [Google Scholar] [CrossRef]
  14. Krifaton, C.; Kriszt, B.; Szoboszlay, S.; Cserháti, M.; Szǔcs, Á.; Kukolya, J. Analysis of aflatoxin B1-degrading microbes by use of a combined toxicity-profiling method. Mutat. Res./Genet. Toxicol. Environ. Mutagen. 2011, 726, 1–7. [Google Scholar] [CrossRef] [PubMed]
  15. Liu, D.L.; Yao, D.S.; Liang, L.; Ma, L.; Cheng, W.Q.; Gu, L.Q. Detoxification of Aflatoxin B1 by enzymes isolated from Armillariel latabescans. Food Chem. Toxicol. 1998, 36, 563–574. [Google Scholar] [CrossRef]
  16. Liang, Z.H.; Li, J.X.; He, Y.L.; Guan, S.; Wang, N.; Ji, C.; Niu, T.G. AFB1 biodegradation by a new strain-Stenotrophomonas sp. Agric. Sci. China 2008, 7, 1433–1437. [Google Scholar] [CrossRef]
  17. Altalhi, A.D. Plasmid-inediated detoxification of mycotoxin zearalenone in Pseudomonas sp. ZEA-1. Am. J. Biotechnol. Biochem. 2007, 3, 150–158. [Google Scholar] [CrossRef]
  18. Kriszt, R.; Krifaton, C.; Szoboszlay, S.; Cserháti, M.; Kriszt, B.; Kukolya, J.; Czéh, Á.; Fehér-Tóth, S.Z.; Török, L.; Szöke, Z.S.; et al. A new zearalenone biodegradation atrategy using non-pathogenic. Rhodococcus pyridinivorans K408 strain. PLoS ONE 2012, 9, e43608. [Google Scholar]
  19. Zhang, H.Y.; Dong, M.J.; Yang, Q.Y.; Apaliya, M.T.; Li, J.; Zhang, X.Y. Biodegradation of zearalenone by Saccharomyces cerevisiae: Possible involvement of ZEN responsive proteins of the yeast. J. Proteom. 2016, 143, 416–423. [Google Scholar] [CrossRef]
  20. Zuo, R.Y.; Chang, J.; Yin, Q.Q.; Wang, P.; Yang, Y.R.; Wang, X.; Wang, G.Q.; Zheng, Q.H. Effect of the combined probiotics with aflatoxin B1-degrading enzyme on aflatoxin detoxification, broiler production performance and hepatic enzyme gene expression. Food Chem. Toxicol. 2013, 59, 470–475. [Google Scholar] [CrossRef]
  21. Huang, W.W.; Chang, J.; Wang, P.; Liu, C.Q.; Yin, Q.Q.; Zhu, Q.; Lu, F.S.; Gao, T.Z. Effect of the combined compound probiotics with mycotoxin-degradation enzyme on detoxifying aflatoxin B1 and zearalenone. J. Toxicol. Sci. 2018, 43, 377–385. [Google Scholar] [CrossRef]
  22. Jebali, R.; Ben Salah-Abbes, J.; Abbes, S.; Hassan, A.M.; Abdel-Aziem, S.H.; El-Nekeety, A.A.; Oueslati, R.; Abdel-Wahhab, M.A. Lactobacillus plantarum alleviate aflatoxins (B1 and M1) induced disturbances in the intestinal genes expression and DNA fragmentation in mice. Toxicon 2018, 146, 13–23. [Google Scholar] [CrossRef]
  23. El-Nezami, H.; Haskard, C.; Salminen, E.; Mykkanen, A.; Ahokas, J.; Salminen, S. Lactic acid bacteria and bifidobacteria can reduce dietary exposure to aflatoxins. Br. J. Nutr. 2002, 88, 115–116. [Google Scholar]
  24. Niderkorn, V.; Morgavi, D.P.; Pujos, E.; Tissandier, A.; Boudra, H. Screening of fermentative bacteria for their ability to bind and biotransform deoxynivalenol, zearalenone and fumonisins in an in vitro simulated corn silage model. Food Addit. Contam. 2007, 24, 406–415. [Google Scholar] [CrossRef] [PubMed]
  25. Bouhet, S.; Oswald, I.P. The effects of mycotoxins, fungal food contaminants, on the intestinal epithelial cell derived innate immune response. Vet. Immunol. Immunopathol. 2005, 108, 199–209. [Google Scholar] [CrossRef] [PubMed]
  26. Bouhet, S.; Oswald, I.P. The intestine as a possible target for fumonisin toxicity. Mol. Nutr. Food Res. 2007, 51, 925–931. [Google Scholar] [CrossRef] [PubMed]
  27. Oswald, I.P. Role of intestinal epithelial cells in the innate immune defence of pig intestine. Vet Res. 2006, 37, 359–368. [Google Scholar] [CrossRef] [PubMed]
  28. Pinton, P.; Oswald, I.P. Effect of deoxynivalenol and other type B trichothecenes on the intestine: A review. Toxins 2014, 6, 1615–1643. [Google Scholar] [CrossRef] [PubMed]
  29. Robert, H.; Payros, D.; Pinton, P.; Théodorou, V.; Mercier-Bonin, M.; Oswald, I.P. Impact of mycotoxins on the intestine: Are mucus and microbiota new targets? J. Toxicol. Environ. Health Part B Crit. Rev. 2017, 280, 1–27. [Google Scholar] [CrossRef] [PubMed]
  30. Liu, F.; Li, G.; Wen, K.; Bui, T.; Cao, D.; Zhang, Y. Porcine small intestinal epithelial cell line (IPEC-J2) of rotavirus infection as a new model for the study of innate immune responses to rotaviruses and probiotics. Viral Immunol. 2010, 23, 135–149. [Google Scholar] [CrossRef]
  31. Arce, C.; Ramírez-Boo, M.; Lucena, C.; Garrido, J.J. Innate immune activation of swine intestinal epithelial cell lines (IPEC-J2 and IPI-2I) in response to LPS from Salmonella typhimurium. Comp. Immunol. Microb. 2010, 33, 161–174. [Google Scholar] [CrossRef]
  32. Brosnahan, A.J.; Brown, D.R. Porcine IPEC-J2 intestinal epithelial cells in microbiological investigations. Vet. Microbiol. 2012, 156, 229–237. [Google Scholar] [CrossRef] [Green Version]
  33. Wu, Y.P.; Zhu, C.; Chen, Z.; Chen, Z.J.; Zhang, W.N.; Ma, X.Y.; Wang, L.; Yang, X.F.; Jiang, Z.Y. Protective effects of Lactobacillus plantarum on epithelial barrier disruption caused by enterotoxigenic Escherchia coli in intestinal porcine epithelial cells. Vet. Immunol. Immunop. 2016, 172, 55–63. [Google Scholar] [CrossRef] [PubMed]
  34. Lei, M.Y.; Zhang, N.Y.; Qi, D.S. In vitro investigation of individual and combined cytotoxic effects of aflatoxin B1 and other selected mycotoxins on the cell line porcine kidney 15. Exp. Toxicol. Pathol. 2013, 65, 1149–1157. [Google Scholar] [CrossRef] [PubMed]
  35. Tatay, E.; Meca, G.; Font, G.; Ruiz, M.J. Interactive effects of zearalenone and its metabolites on cytotoxicity and metabolization in ovarian CHO-K1 cells. Toxicol. In Vitro 2014, 28, 95–103. [Google Scholar] [CrossRef] [PubMed]
  36. Mechoud, M.A.; Juarez, G.E.; de Valdez, G.F.; Rodriguez, A.V. Lactobacillus reuteri CRL 1098 and Lactobacillus acidophilus CRL 1014 differently reduce in vitro immunotoxic effect induced by ochratoxin A. Food Chem. Toxicol. 2012, 50, 4310–4315. [Google Scholar] [CrossRef] [PubMed]
  37. Zhu, L.; Yuan, H.; Guo, C.; Lu, Y.; Deng, S.; Yang, Y. Zearalenone induces apoptosis and necrosis in porcine granulosa cells via a caspase-3- and caspase-9-dependent mitochondrial signaling pathway. J. Cell Physiol. 2012, 227, 1814–1820. [Google Scholar] [CrossRef] [PubMed]
  38. Zain, M.E. Impact of mycotoxins on humans and animals. J. Saudi Chem. Soc. 2011, 15, 129–144. [Google Scholar] [CrossRef]
  39. Xiao, Z.; Liu, L.; Tao, W.; Pei, X.; Wang, G.; Wang, M. Clostridium tyrobutyricum protect intestinal barrier function from LPS-induced apoptosis via P38/JNK signaling pathway in IPEC-J2 cells. Cell Physiol. Biochem. 2018, 46, 1779–1792. [Google Scholar] [CrossRef]
  40. Becker, H.M.; Apladas, A.; Scharl, M.; Fried, M.; Rogler, G. Probiotic Escherichia coli Nissle 1917 and commensal E. coli K12 differentially affect the inflammasome in intestinal epithelial cells. Digestion 2014, 89, 110–118. [Google Scholar] [CrossRef]
  41. Maresca, M.; Mahfoud, R.; Garmy, N.; Fantini, J. The mycotoxin deoxynivalenol affects nutrient absorption in human intestinal epithelial cells. J. Nutr. 2002, 132, 2723–2731. [Google Scholar] [CrossRef]
  42. Hunder, G.; Schumann, K.; Strugala, G.; Gropp, J.; Fichtl, B.; Forth, W. Influence of subchronic exposure to low dietary deoxynivalenol, a trichothecene mycotoxin, on intestinal absorption of nutrients in mice. Food Chem. Toxicol. 1991, 29, 809–814. [Google Scholar] [CrossRef]
  43. Scalise, M.; Pochini, L.; Console, L.; Losso, M.A.; Indiveri, C. The human SLC1A5 (ASCT2) amino acid transporter: From function to structure and role in cell biology. Front. Cell Dev. Biol. 2018, 6, 96. [Google Scholar] [CrossRef] [PubMed]
  44. Mertl, M.; Daniel, H.; Kottra, G. Substrate-induced changes in the density of peptide transporter PEPT1 expressed in Xenopus oocytes. Am. J. Physiol. Cell Physiol. 2008, 295, C1332–C1343. [Google Scholar] [CrossRef] [PubMed]
  45. Ashida, H.; Ogawa, M.; Kim, M.; Mimuro, H.; Sesakawa, C. Bacteria and host interactions in the gut epithelial barrier. Nat. Chem. Biol. 2012, 8, 36–45. [Google Scholar] [CrossRef] [PubMed]
  46. Bertrand, G.; Todd, J.A. Modulation of intestinal functions following mycotoxin ingestion: Meta-analysis of published experiments in animals. Toxins 2013, 5, 396–430. [Google Scholar]
  47. Gu, M.J.; Song, S.K.; Park, S.M.; Lee, I.K.; Yun, C.H. Bacillus subtilis protects porcine intestinal barrier from deoxynivalenol via improved zonula occludens-1 expression. Asian Australas. J. Anim. Sci. 2013, 27, 580–586. [Google Scholar] [CrossRef] [PubMed]
  48. Mennigen, R.; Nolte, K.; Rijcken, E.; Utech, M.; Loeffler, B.; Senninger, N.; Bruewer, M. Probiotic mixture VSL#3 protects the epithelial barrier by maintaining tight junction protein expression and preventing apoptosis in a murine model of colitis. Am. J. Physiol. Gastrointest. Liver Physiol. 2009, 296, G1140–G1149. [Google Scholar]
  49. Huang, S.; Zheng, N.; Fan, C.; Cheng, M.; Wang, S.; Jabar, A.; Wang, J.; Cheng, J. Effects of aflatoxin B1 combined with ochratoxin A and/or zearalenone on metabolism, immune function, and antioxidant status in lactating dairy goats. Asian-Australas. J. Anim. Sci. 2018, 31, 505–513. [Google Scholar] [CrossRef] [Green Version]
  50. Gao, X.; Ma, Q.G.; Zhao, H.L.; Lei, Y.P.; Shan, Y.J.; Ji, C. Isolation of Bacillus subtilis: Screening for aflatoxins B1, M1 and G1 detoxification. Eur. Food Res. Technol. 2011, 232, 957–962. [Google Scholar] [CrossRef]
  51. Fotakis, G.; Timbrell, J.A. In vitro cytotoxicity assays: Comparison of LDH, neutral red, MTT and protein assay in hepatoma cell lines following exposure to cadmium chloride. Toxicol. Lett. 2006, 160, 171–177. [Google Scholar] [CrossRef]
  52. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Figure 1. Effects of CFSCP + MDE on mRNA abundances of caspase-3, Bcl-2, and Bax of IPEC-J2 cells induced by AFB1 and ZEA for 24 h. Note: The marked different letters on the bars significantly differ from each other (p < 0.05), while the same letters insignificantly differ from each other (p > 0.05) (the same as below).
Figure 1. Effects of CFSCP + MDE on mRNA abundances of caspase-3, Bcl-2, and Bax of IPEC-J2 cells induced by AFB1 and ZEA for 24 h. Note: The marked different letters on the bars significantly differ from each other (p < 0.05), while the same letters insignificantly differ from each other (p > 0.05) (the same as below).
Toxins 11 00012 g001
Figure 2. Effects of CFSCP + MDE on relative mRNA abundances of occludin and ZO-1 in IPEC-J2 cells induced by AFB1 and ZEA for 24 h. Note: The marked different letters on the bars significantly differ from each other (p < 0.05), while the same letters insignificantly differ from each other (p > 0.05) (the same as below).
Figure 2. Effects of CFSCP + MDE on relative mRNA abundances of occludin and ZO-1 in IPEC-J2 cells induced by AFB1 and ZEA for 24 h. Note: The marked different letters on the bars significantly differ from each other (p < 0.05), while the same letters insignificantly differ from each other (p > 0.05) (the same as below).
Toxins 11 00012 g002
Figure 3. Effects of CFSCP + MDE on mRNA abundances of SGLT1, GLUT2, ASCT2, and PepT1 of IPEC-J2 cells induced by AFB1 and ZEA for 24 h. Note: The marked different letters on the bars significantly differ from each other (p < 0.05), while the same letters insignificantly differ from each other (p > 0.05) (the same as below).
Figure 3. Effects of CFSCP + MDE on mRNA abundances of SGLT1, GLUT2, ASCT2, and PepT1 of IPEC-J2 cells induced by AFB1 and ZEA for 24 h. Note: The marked different letters on the bars significantly differ from each other (p < 0.05), while the same letters insignificantly differ from each other (p > 0.05) (the same as below).
Toxins 11 00012 g003
Figure 4. Effects of CFSCP + MDE on interleukin-6 (IL6) mRNA abundances of IPEC-J2 cells induced by AFB1 and ZEA for 24 h. Note: The marked different letters on the bars significantly differ from each other (p < 0.05), while the same letters insignificantly differ from each other (p > 0.05) (the same as below).
Figure 4. Effects of CFSCP + MDE on interleukin-6 (IL6) mRNA abundances of IPEC-J2 cells induced by AFB1 and ZEA for 24 h. Note: The marked different letters on the bars significantly differ from each other (p < 0.05), while the same letters insignificantly differ from each other (p > 0.05) (the same as below).
Toxins 11 00012 g004
Table 1. Dose time interacting effect of mycotoxins on relative cell viability (%). CFSCP: Cell-free supernatant of compound probiotics; MDE: Mycotoxin degradation enzyme.
Table 1. Dose time interacting effect of mycotoxins on relative cell viability (%). CFSCP: Cell-free supernatant of compound probiotics; MDE: Mycotoxin degradation enzyme.
Groups6 h12 h18 h24 h48 h
Z50083.48 ± 4.26Cb101.79 ± 6.60Aa94.18 ± 6.39Bab90.15 ± 6.21Bc103.72 ± 3.35Aa
A4082.83 ± 3.48Cbc95.04 ± 3.04Bb94.94 ± 3.98Bab97.72 ± 2.35Ba103.48 ± 3.33Aa
Z500 + A4081.02 ± 4.02Ccd85.70 ± 5.77BCc87.24 ± 6.62BCcd88.63 ± 4.27ABbc94.56 ± 4.21Abc
Z100079.40 ± 3.67Bcd92.02 ± 5.61Ab93.50 ± 3.69Aab91.45 ± 6.47Ab94.91 ± 5.90Abc
A8081.58 ± 3.37Cbc92.30 ± 3.21ABb91.73 ± 3.63Bbc95.84 ± 4.66ABa97.27 ± 5.90Ab
Z1000 + A8075.45 ± 5.81Cd85.35 ± 7.28ABc83.99 ± 4.44Bd81.64 ± 2.72Bd90.96 ± 3.78Ac
CFSCP + MDE98.56 ± 0.45Aa99.12 ± 0.67Aa98.36 ± 0.06Aa98.96 ± 0.43Aa98.15 ± 0.55Ab
Note: Data with different lowercase letters in the same column significantly differ from each other (p < 0.05), while data with the same lowercase letter in the same column insignificantly differ from each other (p > 0.05). Data with different capital letters in the same row significantly differ from each other (p < 0.05), while data with the same capital letter in the same row insignificantly differ from each other (p > 0.05). The relative viability of IPEC-J2 cells (%) = (A490 in treated group - A630 in treated group)/(A490 in control group - A630 in control group) × 100. Z500 and Z1000 mean 500 and 1000 µg/L zearalenone (ZEA); A40 and A80 mean 40 and 80 µg/L aflatoxin B1 (AFB1).
Table 2. Effects of CFSCP + MDE on cell status induced by AFB1 and ZEA (%).
Table 2. Effects of CFSCP + MDE on cell status induced by AFB1 and ZEA (%).
GroupsQ1Q2Q3Q4
Control group1.66 ± 0.09d0.96 ± 0.24b0.75 ± 0.30c96.63 ± 0.38a
CFSCP + MDE2.44 ± 0.24c2.44 ± 0.42a2.14 ± 0.36b92.97 ± 1.00b
Z5005.36 ± 0.45a0.90 ± 0.39b0.89 ± 0.14c92.86 ± 0.56b
A404.19 ± 0.30b2.33 ± 0.37a2.94 ± 0.09a90.54 ± 0.57c
Z500 + A405.13 ± 0.84a2.85 ± 0.68a2.50 ± 0.25b89.52 ± 0.09c
Z500 + A40 + CFSCP + MDE2.94 ± 0.32c2.56 ± 0.43a2.20 ± 0.25b92.30 ± 1.00b
Note: Data with different lowercase letters in the same column significantly differ from each other (p < 0.05), while data with the same lowercase letter in the same column insignificantly differ from each other (p > 0.05). Q1, Q2, Q3, and Q4 represent necrotic, late apoptotic, early apoptotic, and viable cell rates, respectively.
Table 3. Primer sequences of some genes for RT-PCR.
Table 3. Primer sequences of some genes for RT-PCR.
GenePrimer Sequence (5′-3′)Accession NumberSize (bp)
GAPDHF: ATGACCACAGTCCATGCCATCXM-004387206.1271
R: CCTGCTTCACCACCTTCTTG
Cell apoptosis genes
Bcl-2F: AGAGCCGTTTCGTCCCTTTCXM-003122573.2270
R: GCACGTTTCCTAGCGAGCAT
BaxF: ATGATCGCAGCCGTGGACACGXM-003355975.1296
R: ACGAAGATGGTCACCGTCTGC
Caspase-3F:TTGGACTGTGGGATTGAGACGNM-214131.1165
R: CGCTGCACAAAGTGACTGGA
Cytokines gene
IL-6F: GCTCTCTGTGAGGCTGCAGTTCNM_213867.1107
R: AAGGTGTGGAATGCGTATTTATGC
Barrier function genes
ZO-1F: CCTGAGTTTGATAGTGGCGTTGAXM-003353439.2269
R: AAATAGATTTCCTGCCCAATTCC
OccludinF: ACCCAGCAACGACATANM_001163647.2155
R: TCACGATAACGAGCATA
Nutrient transporter genes
SGLT1F: TCATCATCGTCCTGGTCGTCTCM34044.1144
R: CTTCTGGGGCTTCTTGAATGTC
GLUT2F: ATTGTCACAGGCATTCTTGTTAGTCANM_001097417.1273
R: TTCACTTGATGCTTCTTCCCTTTC
PepT1F: CAGACTTCGACCACAACGGANM_214347.199
R: TTATCCCGCCAGTACCCAGA
ASCT2F: CTGGTCTCCTGGATCATGTGGDQ231578.1172
R: CAGGAAGCGGTAGGGGTTTT

Share and Cite

MDPI and ACS Style

Huang, W.; Chang, J.; Wang, P.; Liu, C.; Yin, Q.; Song, A.; Gao, T.; Dang, X.; Lu, F. Effect of Compound Probiotics and Mycotoxin Degradation Enzymes on Alleviating Cytotoxicity of Swine Jejunal Epithelial Cells Induced by Aflatoxin B1 and Zearalenone. Toxins 2019, 11, 12. https://0-doi-org.brum.beds.ac.uk/10.3390/toxins11010012

AMA Style

Huang W, Chang J, Wang P, Liu C, Yin Q, Song A, Gao T, Dang X, Lu F. Effect of Compound Probiotics and Mycotoxin Degradation Enzymes on Alleviating Cytotoxicity of Swine Jejunal Epithelial Cells Induced by Aflatoxin B1 and Zearalenone. Toxins. 2019; 11(1):12. https://0-doi-org.brum.beds.ac.uk/10.3390/toxins11010012

Chicago/Turabian Style

Huang, Weiwei, Juan Chang, Ping Wang, Chaoqi Liu, Qingqiang Yin, Andong Song, Tianzeng Gao, Xiaowei Dang, and Fushan Lu. 2019. "Effect of Compound Probiotics and Mycotoxin Degradation Enzymes on Alleviating Cytotoxicity of Swine Jejunal Epithelial Cells Induced by Aflatoxin B1 and Zearalenone" Toxins 11, no. 1: 12. https://0-doi-org.brum.beds.ac.uk/10.3390/toxins11010012

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop