Next Article in Journal
Pharmaceutical Assessment Suggests Locomotion Hyperactivity in Zebrafish Triggered by Arecoline Might Be Associated with Multiple Muscarinic Acetylcholine Receptors Activation
Next Article in Special Issue
Is the Cyanobacterial Bloom Composition Shifting Due to Climate Forcing or Nutrient Changes? Example of a Shallow Eutrophic Reservoir
Previous Article in Journal
Composition and Acute Inflammatory Response from Tetraponera rufonigra Venom on RAW 264.7 Macrophage Cells
Previous Article in Special Issue
Potentially Toxic Planktic and Benthic Cyanobacteria in Slovenian Freshwater Bodies: Detection by Quantitative PCR
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Toxins
Volume 13
Issue 4
10.3390/toxins13040258
toxins-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Cyanotoxin Screening in BACA Culture Collection: Identification of New Cylindrospermopsin Producing Cyanobacteria

by
Rita Cordeiro
1,2,*,
Joana Azevedo
3,
Rúben Luz
1,2,
Vitor Vasconcelos
3,4,
Vítor Gonçalves
1,2 and
Amélia Fonseca
1,2
1
CIBIO, Centro de Investigação em Biodiversidade e Recursos Genéticos, InBIO Laboratório Associado, Pólo dos Açores, Universidade dos Açores, 9500-321 Ponta Delgada, Portugal
2
Faculdade de Ciências e Tecnologia, Universidade dos Açores, 9500-321 Ponta Delgada, Portugal
3
Interdisciplinary Centre of Marine and Environmental Research—CIIMAR/CIMAR, University of Porto, Terminal de Cruzeiros do Porto de Leixões, Av. General Norton de Matos s/n, 4450-208 Matosinhos, Portugal
4
Department of Biology, Faculty of Sciences, University of Porto, 4069-007 Porto, Portugal
*
Author to whom correspondence should be addressed.
Toxins 2021, 13(4), 258; https://0-doi-org.brum.beds.ac.uk/10.3390/toxins13040258
Submission received: 8 February 2021 / Revised: 1 April 2021 / Accepted: 1 April 2021 / Published: 3 April 2021
(This article belongs to the Special Issue Cyanotoxins in Bloom: Ever-Increasing Occurrence and Global Distribution of Freshwater Cyanotoxins from Planktic and Benthic Cyanobacteria)
Browse Figures
Versions Notes

Abstract

:
Microcystins (MCs), Saxitoxins (STXs), and Cylindrospermopsins (CYNs) are some of the more well-known cyanotoxins. Taking into consideration the impacts of cyanotoxins, many studies have focused on the identification of unknown cyanotoxin(s)-producing strains. This study aimed to screen strains from the Azorean Bank of Algae and Cyanobacteria (BACA) for MCs, STX, and CYN production. A total of 157 strains were searched for mcy, sxt, and cyr producing genes by PCR, toxin identification by ESI-LC-MS/MS, and cyanotoxin-producing strains morphological identification and confirmation by 16S rRNA phylogenetic analysis. Cyanotoxin-producing genes were amplified in 13 strains and four were confirmed as toxin producers by ESI-LC-MS/MS. As expected Aphanizomenon gracile BACA0041 was confirmed as an STX producer, with amplification of genes sxtA, sxtG, sxtH, and sxtI, and Microcystis aeruginosa BACA0148 as an MC-LR producer, with amplification of genes mcyC, mcyD, mcyE, and mcyG. Two nostocalean strains, BACA0025 and BACA0031, were positive for both cyrB and cyrC genes and ESI-LC-MS/MS confirmed CYN production. Although these strains morphologically resemble Sphaerospermopsis, the 16S rRNA phylogenetic analysis reveals that they probably belong to a new genus.
Keywords:
microcystin; saxitoxin; cylindrospermopsin; ESI-LC-MS/MS; 16S rRNA phylogeny; Azores
Key Contribution:
16s rRNA phylogenetic analysis revealed evidence for new toxic cyanobacteria taxa, in two identified CYN producing nostocalean strains BACA0025 and BACA0031.

1. Introduction

Due to their impacts on ecosystem degradation, public health risk, and associated economical losses, cyanotoxins are one of the most studied primary and secondary metabolites from cyanobacteria [1,2,3,4]. Microcystins (MCs), Saxitoxins (STXs), and Cylindrospermopsins (CYNs) are some of the more well-known cyanotoxins, for which a high number of studies were done covering different aspects such as their taxonomic distribution, genetic organization, biosynthesis pathways, and mechanisms of action [5,6,7,8,9,10].
Microcystins are hepatotoxins produced by non-ribosomal pathways, and the most common and more well-studied cyanotoxins, with over 240 variants (e.g., MC-LR, MC-LY, MC-RR). Mostly produced by Microcystis aeruginosa [11], MCs are, however, currently known to be produced by over 40 species [12]. The gene cluster responsible for the biosynthesis of MCs (mcy) contains 10 encoding genes organized in two operons (mcyA-C and mcyD-J) in which each gene has a specific function for the toxin synthesis, regulation, and release [13,14]. This hydrophilic peptide has an Adda group in its structure, responsible for its toxicity [15,16]. With over 240 analogs, other groups as ADMAdda have been identified and characterized as responsible for MCs more toxic variants [17].
The alkaloid STX is one of the most potent natural neurotoxin [18] identified in both cyanobacteria and dinoflagellates [19]. In cyanobacteria, STXs have been identified in several species as Aphanizomenon gracile, Cylindrospermum stagnale [20], Dolichospermum circinale [21], and Raphidiopsis raciborskii [22]. The gene cluster sxt encodes 26 genes responsible for the biosynthesis of STXs [19] and its gene organization varies between species, which may indicate gene loss or transfer between species [6,23,24]. This scenario has been observed in the STX gene cluster where the sxtA gene, recognized as the encoding gene for the polyketide synthase-like structure involved in the first step of STXs production [6], was found in both STXs-producing and non-producing A. gracile strains, but all non-producing strains lost at least one of the other genes of the cluster (e.g. sxtG, sxtH, sxtI, or sxtX) [25].
Cylindrospermopsins are cytotoxic alkaloids initially identified in Raphidiopsis raciborskii [26] but also reported to be produced by other species as Aphanizomenon gracile [27] or Chrysosporum ovalisporum [28]. As MCs, CYNs biosynthesis is done by a non-ribosomal pathway, where the gene cluster cyr (15 encoding genes) has been identified as responsible for CYNs synthesis, regulation, and exportation in R. raciborskii [29].
Cyanobacteria have high morphological and ecological variability [30], and due to this, its taxonomical classification is relatively intricate and is in constant change [31]. New cyanobacteria families, genera, and species, as Oculatellaceae and Trichocoleaceae [32], Aliinostoc [33], Halotia [34], and Lusitaniella [35], and Hyella patelloides [35] and Compactonostoc shennongjiaensis [36] have been reported in recent years. These taxonomic redefinitions are challenging for the identification and distribution of toxins in many of the new genera [37], thus increasing the lack of knowledge on toxic strains. Although cyanobacteria are widely distributed through many environments [7,38], most cyanobacteria and cyanotoxins studies are focused on planktonic species from inland freshwater systems [7,20], with less information in extreme environments (e.g., hot springs, caves, hypersaline lakes, polar deserts), especially regarding their toxicity [7,39].
Taking into consideration cyanotoxins impacts, either in environmental or public health, many scientific studies have focused on the identification of unknown cyanotoxin(s)-producing species, usually by a combination of methods as immunoassays (e.g., ELISA—enzyme-linked immunosorbent assay), by targeting biosynthesis encoding genes (PCR—polymerase chain reaction) and/or by analytical methods, as liquid chromatography [40,41]. The liquid chromatography-mass spectrometry (LC-MS) is a highly sensitive and selective method for cyanotoxin detection and identification [40,41]. It can be used for cyanotoxins confirmation even in very low concentrations, as well as analog identification, even without available standards [40].
The main aim of this study was to screen for cyanotoxin-producing cyanobacteria in strains isolated from several environments (freshwater, terrestrial and thermal) from the Azores islands using a polyphasic approach, based on the detection of MCs, STX, and CYN encoding genes, the identification of their production by LC-MS, and the phylogenetic distribution of toxic strains through 16S rRNA molecular identification.

2. Results

2.1. Detection of Cyanotoxin(s)-Producing Cyanobacteria

From the 157 screened cyanobacteria strains, 13 were identified as cyanotoxin(s) potential producers by PCR amplification of the STX, CYN, and/or MC encoding genes, and four were confirmed as toxin producers by ESI-LC-MS/MS (Figures S1–S6; Table 1; Table S2).
STX producing genes were detected in six strains, however, the only strain with amplification of all the searched STX-encoding genes, Aphanizomenon gracile BACA0041, was the only one confirmed as saxitoxin producer by ESI-LC-MS/MS (Table 1).
CYN producing genes were detected in five strains, although only BACA0025 and BACA0031 had amplification of both searched cyrB and cyrC genes. These two strains were also the only ones with CYN detection by ESI-LC-MS/MS. The remaining three strains with positive results for the detection of CYN encoding genes only amplified the cyrB gene (Table 1).
MC-encoding genes were only detected in Microcystis aeruginosa BACA0148 (mcyC, mcyD, mcyE, and mcyG) and Nostoc sp. BACA0091 (mcyE). However, in the ESI-LC-MS/MS analysis, MC-LR ions were identified only in M. aeruginosa BACA0148.

2.2. Phylogenetic Characterization

Strains BACA0025 and BACA0031 had similarities with sequences deposited in the GenBank NCBI between 96 and 97%, which shows the distinctiveness of these strains, while strains BACA0041 and BACA0148 had similarities greater than 98% with Aphanizomenon gracile and Microcystis aeruginosa strains, respectively (Table S3). In the 16S rRNA phylogenetic tree strains BACA0041 and BACA0148 are positioned in clades with strains close to their initial identification, while strains BACA0025 and BACA0031 had high phylogenetic distances from the closest morphological identified strains.
The strain BACA0041, morphologically identified as Aphanizomenon gracile (Figure 1F,G), was positioned near other A. gracile and Aphanizomenon flos-aquae strains, and closer to know STX producing strains as A. gracile PMC638.10 or A. flos-aquae NIES 81 (Figure 2).
Strains BACA0025 (Figure 1A–C) and BACA0031 (Figure 1E), morphologically identified as Sphaerospermopsis sp. are positioned in cluster II between Nostoc spp., Fortiea spp., Desikacharya spp., Trichormus spp., Minunostoc cylindricum, and Desmonostoc spp. strains, however, with significant phylogenetic distance from all these strains (Figure 2).
The strain BACA0148, morphologically identified as Microcystis aeruginosa (Figure 1D), was positioned near other M. aeruginosa strains, and closer to know MC producing strains as M. aeruginosa VN481 (AB666064) or M. bengalensis VN486 (AB666082) (Figure 3).

3. Discussion

The ability to produce cyanotoxins depends on the simultaneous existence of several genes involved in their biosynthesis pathways [42]. As seen in previous studies, the sxt cluster has suffered several modifications and its gene composition and organization varies between taxa [6,43,44,45]. Although the amplification of the sxtA gene and the absence of toxin production in Aphanizomenon strains was seen in other studies [10,25,46,47], in the studied strains only strains with sxtA amplification were able to produce STX (Table 1). Cirés et al. [47] states that the sxtA gene does not allow the distinction between STX-producing and non-producing Anabaena/Aphanizomenon strains, nonetheless the presence of sxtA in non-producing strains could have been due to gene loss/inactivation within the sxt cluster [46]. The presence of sxtG or sxtH amplifications in several non-STX producing genera (Table 1; Table S2; Figure S3) in this study are interesting new results that require further investigation to fully understand sxt gene distribution among cyanobacteria taxa. Nonetheless, to our knowledge, the presence of sxtG, and/or sxtH genes in Kamptonema, Leptodesmis, Anathece minutissima, or Leptolyngbya strains, have not been reported before.
Aphanizomenon gracile BACA0041 was confirmed as an STX producer with amplification of the sxtA, sxtG, sxtH, and sxtI genes. The ESI-LC-MS/MS spectra of A. gracile BACA0041 matched the fragmented pattern of STX standard spectra (Figure S4), with identification of the precursor ion 300 m/z and product ions 282 m/z, 265 m/z, 241 m/z, 240.25 m/z, 204 m/z, and 186 m/z [10]. Phylogenetic analysis confirms Aphanizomenon gracile BACA0041 identification’s, this strain is positioned in a well-supported clade of several STX-producing A. gracile strains (Figure 2), as A. gracile UAM531 [47] and A. gracile PMC 638.10 [10]. In our study, we report another freshwater STX-producing A. gracile strain, the first STX producer identified in the Azores islands.
Strains BACA0025 and BACA0031 are quite similar, these were both initially identified as Sphaerospermopsis sp. (isolated from similar freshwater lakes from the same island; Table S1), with similar BlastN results (Table S3). Strains BACA0025 and BACA0031 were positioned in cluster II in the phylogenetic tree (Figure 2) close to Nostocaceae genera, however with significant phylogenetic distance to conclude that these strains might belong to a new genus. Both were confirmed as CYN producers with detection of both cyrB and cyrC genes (Table 1). The ESI-LC-MS/MS spectra of BACA0025 and BACA0031 both matched the fragmented pattern of CYN standard spectra (Figure S5), with identification of the precursor ion 416 m/z and product ions 336 m/z, 318 m/z, 274 m/z, and 194 m/z [48], confirming these two strains as CYN producers.
The cyrB gene was also amplified in Nostoc sp. BACA0109, and in two thermal Leptolyngbya sp. strains BACA0142 and BACA0146, however without CYN identification in the ESI-LC-MS/MS. Amplification of cyr genes without CYN production confirmation has been reported previously, as is the case of non-CYN producing Chrysosporum bergii and Chrysosporum ovalisporum strains with amplification of cyrA, cyrB, and cyrC genes [49]. Nostoc and Leptolyngbya strains are known to produce cyanotoxins, however, MCs [12,17,50] and not CYN, and as far as we know, the presence of the cyrB and cyrC genes has not been previously reported in Nostoc or Leptolyngbya strains.
Microcystins are the most common and more well-studied cyanotoxins, being MC-LR one of the most prevalent and toxic congeners [51]. Microcystis aeruginosa was the first cyanobacteria species identified as MCs producer and is the most studied species regarding MCs [11]. Our results show that the Azorean strain M. aeruginosa BACA0148 is also an MC-LR producer, with the detection of mcyC, mcyD, mcyE, and mcyG genes. Characteristic MC-LR fragmentation pattern was observed in M. aeruginosa BACA0148 (Figure S6), with identification of precursor ion 995 m/z and product ions 977 m/z, 866 m/z, 599 m/z, and 553 m/z [52]. The mcyE gene amplification in Nostoc sp. BACA0091, despite the absence of MC-LR ions in the ESI-LC-MS/MS, or the absence of the other searched mcy genes (mcyC, mcyD, and mcyG), can be explained due to gene(s) recombination or loss [6,14,53]. As stated by Dittmann et al. [6], the mcy gene cluster has high repetitive sequences, enabling recombination events that ultimately cause changes in the final product, which can be confirmed by the growing reported number of MCs congeners [54,55].
All strains identified as toxin producers (BACA0025, BACA0031, A. gracile BACA0041, and M. aeruginosa BACA0148) were isolated from lakes in Pico and São Miguel islands (Table S1, S2). The presence of toxic strains in these lakes represents environmental and public health hazards. Contrarily, none of the strains isolated from thermal and terrestrial habitats were identified as cyanotoxin producers, although in some of them, cyanotoxin-encoding genes were detected, as in the thermal Leptolyngbya strains BACA0112, BACA0123, BACA0142, BACA0144 and BACA0146, and Coleospermum sp. BACA0119.

4. Conclusions

Within the BACA collection, we identified and reported another MC-LR-producing M. aeruginosa strain (BACA0148) and another STX-producing A. gracile strain (BACA0041). Phylogenetic analysis revealed evidence for new cyanobacteria taxa BACA0025 and BACA0031, confirmed as CYN producers. Further studies are necessary to confirm and describe these new taxa, with morphological characterization and 16S rRNA and ITS analysis.
The identification of new cyanotoxin-producing strains, and unreported toxins, in the Azores, confirms the risk of toxicity and threat to environmental and public health; thus, an appropriate monitoring program should be implemented/updated to search MCs, STX, and CYN. Future efforts should also be made to avoid cyanobacteria blooms and consequently cyanotoxins released in high concentrations.

5. Materials and Methods

5.1. BACA Strains and Growth Conditions

A total of 157 strains, isolated from various environments (Table S1), were retrieved from the Azorean Bank of Algae and Cyanobacteria (BACA) created in the framework of the REBECA project (MAC/1.1a/060). For genetic analysis, 50 mL cultures were prepared without agitation, whereas for toxin extraction, the cultures were scaled up to 1 L, with filtered aeration. All strains were grown in liquid BG-11 media (with or without combined nitrogen) [56], in a climate-controlled room with a 14:10 h light: dark (170 µmol photons m−2 s−1) photoperiod at 25 °C [56,57]. Cyanobacterial cells were harvested by centrifugation (4000× g for 15 min), after 3–5 weeks, and lyophilized. The lyophilized cyanobacteria biomass were stored at −20 °C.

5.2. Cyanotoxins Analysis

5.2.1. Toxin extraction

The lyophilized cyanobacteria, 157 samples in total, were weighed (80–100 mg) to a glass vial and extracted with a 5% methanolic solution (2–10 mL). Solutions were then submitted to ultrasounds for 1–5 min, 60 Hz, in an ice bath, and transferred to falcons to be centrifuged (5000× g, 5 min, 4°C). Pellet was then submitted to a second extraction and left in the dark at 4 °C overnight. Supernatants were pooled together and lyophilized (extraction solvent completely freeze-dried).
Residues were finally dissolved in 200–500 µL 50% methanol LC-MS grade acidified with 0.1% Formic Acid and filtered with a nylon membrane 0.2 µm before analysis (or centrifuged at 10,000× g for 5 min). Samples were protected from light through all the processes and stored at −80 °C until analysis.

5.2.2. ESI-LC-MS/MS analysis

Saxitoxin (CRM-00-STX, Lot 16-001, 99% purity), microcystin-LR (CRM-00-MC-LR, Lot 19-001, 96% purity), and cylindrospermopsin (CRM-03-CYN, Lot 16-001, 99% purity) standards were all supplied by Cifga (Lugo, Spain). Although MC-RR, MC-YR, and MC-LA standards were not used, their mass was searched in the spectra.
All the standards were injected individually and then as a standard mixture with a concentration interval from 10 ppb to 300 ppb. ESI-LC-MS/MS analysis was performed to confirm the presence or absence of these three cyanotoxins in the selected cyanobacteria strains.
Samples were injected in a Liquid Chromatograph Thermo Finnigan Surveyor HPLC System (Thermo Scientific, Waltham, MA, USA), coupled with a Mass Spectrometry LCQ Fleet™ Ion Trap Mass Spectrometer (Thermo Scientific, Waltham, MA, USA), with a column TSKgel® Amide-80 Phase carbamoyl (250 mm× 2 mm i.d., 5 µm) (TOSOH Bioscience-Lot082B, Tokyo, Japan).
The eluents used were methanol (A) and water (B) both acidified with formic acid at 0.1% (v/v). The gradient program started at 10% B (held for 10 min), increasing to 50% B in 5 min, turning back to initial conditions in 5 min, equilibrating more 10 min with 10% B. The injection volume was 10 µL with a flow of 0.2 mL min−1 and column kept at 30 °C.
Mass spectrometry analysis acquisition parameters were as follows: ESI source, positive ionization using collision-induced dissociation (CID). Table S4 resumes analysis parameters for each searched toxin.

5.3. DNA Extraction, PCR Amplification, and Sequencing

Total genomic DNA was extracted with the PureLinkTM Genomic DNA Mini Kit (Invitrogen, Carlsbad, CA, USA), as previously described by Cordeiro et al. [58]. DNA samples were stored at −20 °C.
Genes mcyC, mcyD, mcyE, and mcyG were targeted for MCs production potential, sxtA, sxtG, sxtI, and sxtH for STX, and cyrB and cyrC for CYN, using specific primer pairs available in the literature (Table 2). For the 16S rRNA gene amplification primers 27F [59], CYA359F [60], and 1494R [59] were used, whereas for sequencing it was also used primers CYA781F [60] and CYA781R (Table 2).
PCRs were carried out in a ProFlex™ 3 × 32-well PCR System (Thermo Fischer, Waltham, MA, USA), according to the literature [9,10,25,58,61,62]. The PCR products were visualized by electrophoresis on 1.5% agarose gels stained with SYBR™ SAFE (0.2 g mL−1) and visualized using the transilluminator Molecular Imager® Gel Doc™ XR+ (BioRad, Hercules, CA, USA).
16S rRNA amplification products were purified using the EXTRACTME® DNA clean-up kit (Blirt, Gdańsk, Poland), following the manufacturer’s protocol. Sequencing was done by Macrogen Ltd. (Madrid, Spain). Nucleotide sequences were deposited in the NCBI Genbank under the accession numbers MT176703, MW776414, MT176711, and MT176750.

5.4. Phylogenetic Analysis

Partial 16S sequences were amplified for the four strains with toxin identification by ESI-LC-MS/MS. All the sequences obtained in this study were compared with sequences deposited in the GenBank NCBI by BlastN tool.
The databases were constructed with the 16S rRNA sequences from this study and identified strains with MCs, STX, and CYN production retrieved from the literature [10,17,25,43,63,64,65,66,67] and GenBank. A final database of 267 OTUs (operational taxonomic units) were aligned for Nostocales and 50 OTUs for Chroococcales, using MAFFT v7.475 [68]. The sequence data matrixes with a final length of 1070 bp (Nostocales) and 1324 bp (Chroococcales) were used to infer phylogenetic distances.
The 16S rRNA gene phylogenetic relations were calculated using maximum likelihood (ML) and Bayesian inference (BI). jModelTest 2.1.10 [69] was used to select the best-fit nucleotide model for our database, on which the general time-reversible evolutionary model of substitution with gamma-distributed evolutionary rates and with an estimated proportion of invariable sites (GTR+G+I) was selected. ML was calculated using the IQ-Tree online version v1.6.12 [70] with 1000 ultrafast bootstrap and BI was calculated using MrBayes v3.2.7a [71], applying two separate runs with four chains each and 50,000,000 Markov chain Monte Carlo generations (sampling every 100 generations with a 0.25 burn-in). The tree was drawn with FigTree 1.4.4 (http://tree.bio.ed.ac.uk/software/figtree, accessed on 8 February 2021) and Inkscape 1.0.1 (https://inkscape.org/pt/, accessed on 8 February 2021). Only the ML tree is presented, with bootstrap percentages (ML) and BI probabilities for branch support, since ML and BI methods resulted in similar trees. Only probabilities above 0.9 and bootstrap percentages above 50 are shown at the branch nodes of the phylogenetic distance trees. Gloeobacter violaceus PCC 8105 (AF132791) was used as the out-group.

Supplementary Materials

The following are available online at https://0-www-mdpi-com.brum.beds.ac.uk/article/10.3390/toxins13040258/s1, Figure S1: Electrophoresis gel photos of mcyC (674 bp), mcyD (647 bp), mcyE (755 bp), and mcyG (425 bp) biosynthesis genes amplifications, Figure S2: Electrophoresis gel photos of cyrB (650 bp) and cyrC (597 bp) biosynthesis genes amplifications, Figure S3: Electrophoresis gel photos of sxtA (602 bp), sxtG (893 bp), sxtH (812 bp), and sxtI (910 bp) biosynthesis genes amplifications, Figure S4: Total ion chromatograms and spectra of a STX standard solution (A) and sample Aphanizomenon gracile BACA0041 (B), Figure S5: Total ion chromatograms and spectra of a CYN standard solution (A), sample BACA0025 (B) and sample BACA0031 (C), Figure S6. Total ion chromatograms and spectra of an MC-LR standard solution (A) and sample Microcystis aeruginosa BACA0148 (B), Table S1: Strains information, Table S2: PCR amplifications of MC (mcyC, mcyD, mcyE, mcyG), STX (sxtA, sxtG, sxtH, sxtI) and CYN (cyrB, cyrC) biosynthesis-encoding genes and ESI-LC-MS/MS toxicity confirmation, Table S3: Sequence identity (%) of 16S rRNA gene fragment between BACA strains and other cyanobacterial sequences available in GenBank (NCBI), Table S4: ESI-LC-MS/MS analysis parameters for the identification of CYN, MC-LR, and STX.

Author Contributions

Conceptualization, R.C., V.V., V.G., and A.F.; methodology, R.C., J.A., and R.L.; formal analysis, R.C.; investigation, R.C.; resources, V.V., V.G., and A.F.; writing—original draft preparation, R.C.; writing—review and editing, R.C., J.A., R.L., V.V., V.G., and A.F.; visu-alization, R.C.; supervision, V.V., V.G., and A.F.; project administration, V.G.; funding acquisition, V.V., V.G., and A.F. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by FEDER funds through the Interreg-MAC 2014-2020 program under the projects REBECA—Red de Excelencia en Biotecnología Azul (algas) de la Región Macaronesia (MAC/1.1a/060) and REBECA-CCT—Red de Excelencia en Biotecnología Azul de la Región Macaronésica. Consolidación, Certificación y Transferencia (MAC2/1.1b/269). Rita Cordeiro was supported by a Ph.D. grant (M3.1.a/F/017/2015) from the Fundo Regional da Ciência e Tecnologia (FRCT). CIIMAR acknowledges the project H2020 RISE project EMERTOX—Emergent Marine Toxins in the North Atlantic and the Mediterranean: New Approaches to Assess their Occurrence and Future Scenarios in the Framework of Global Environmental Changes (grant agreement no. 778069), and FCT Projects UIDB/04423/2020 and UIDP/04423/2020. This work was also funded by FEDER funds through the Operational Programme for Competitiveness Factors - COMPETE and by National Funds through FCT - Foundation for Science and Technology under the UID/BIA/50027/2020 and POCI-01-0145-FEDER-006821. The APC was funded by REBECA-CCT (MAC2/1.1b/269).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data is contained within the article or Supplementary Material. The data presented in this study are available in https://0-www-mdpi-com.brum.beds.ac.uk/article/10.3390/toxins13040258/s1.

Acknowledgments

We would like to thank Carmo Barreto from the University of the Azores, for the use of Biochemistry Lab facilities, without it, this work would not be possible.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

References

  1. Hamilton, D.P.; Salmaso, N.; Paerl, H.W. Mitigating harmful cyanobacterial blooms: Strategies for control of nitrogen and phosphorus loads. Aquat. Ecol. 2016, 50, 351–366. [Google Scholar] [CrossRef]
  2. Brooks, B.W.; Lazorchak, J.M.; Howard, M.D.A.; Johnson, M.-V.V.; Morton, S.L.; Perkins, D.A.K.; Reavie, E.D.; Scott, G.I.; Smith, S.A.; Steevens, J.A. Are harmful algal blooms becoming the greatest inland water quality threat to public health and aquatic ecosystems? Environ. Toxicol. Chem. 2016, 35, 6–13. [Google Scholar] [CrossRef] [PubMed]
  3. Holland, A.; Kinnear, S. Interpreting the Possible Ecological Role(s) of Cyanotoxins: Compounds for Competitive Advantage and/or Physiological Aide? Mar. Drugs 2013, 11, 2239–2258. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Chorus, I.; Welker, M. Toxic Cyanobacteria in Water, 2nd ed.; CRC Press, on behalf of the World Health Organization: Boca Raton, CH, Geneva, 2021. [Google Scholar]
  5. Van Apeldoorn, M.E.; Van Egmond, H.P.; Speijers, G.J.A.; Bakker, G.J.I. Toxins of cyanobacteria. Mol. Nutr. Food Res. 2007, 51, 7–60. [Google Scholar] [CrossRef] [PubMed]
  6. Dittmann, E.; Fewer, D.P.; Neilan, B. Cyanobacterial toxins: Biosynthetic routes and evolutionary roots. FEMS Microbiol. Rev. 2013, 37, 23–43. [Google Scholar] [CrossRef] [PubMed]
  7. Cirés, S.; Casero, M.C.; Quesada, A. Toxicity at the edge of life: A review on cyanobacterial toxins from extreme environments. Mar. Drugs 2017, 15, 233. [Google Scholar] [CrossRef] [PubMed]
  8. Quiblier, C.; Wood, S.; Echenique-Subiabre, I.; Heath, M.; Villeneuve, A.; Humbert, J.-F. A review of current knowledge on toxic benthic freshwater cyanobacteria–Ecology, toxin production and risk management. Water Res. 2013, 47, 5464–5479. [Google Scholar] [CrossRef]
  9. Rantala-Ylinen, A.; Känä, S.; Wang, H.; Rouhiainen, L.; Wahlsten, M.; Rizzi, E.; Berg, K.; Gugger, M.; Sivonen, K. Anatoxin-a synthetase gene cluster of the cyanobacterium Anabaena sp. strain 37 and molecular methods to detect potential producers. Appl. Environ. Microbiol. 2011, 77, 7271–7278. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  10. Ledreux, A.; Thomazeau, S.; Catherine, A.; Duval, C.; Yéprémian, C.; Marie, A.; Bernard, C. Evidence for saxitoxins production by the cyanobacterium Aphanizomenon gracile in a French recreational water body. Harmful Algae 2010, 10, 88–97. [Google Scholar] [CrossRef]
  11. Codd, G.A.; Meriluoto, J.; Metcalf, J.S. Introduction: Cyanobacteria, Cyanotoxins, Their Human Impact, and Risk Management. In Handbook of Cyanobacterial Monitoring and Cyanotoxin Analysis; Codd, G.A., Meriluoto, J., Metcalf, J.S., Eds.; John Wiley and Sons, Ltd: Chichester, UK, 2017; pp. 1–8. [Google Scholar]
  12. Bernard, C.; Ballot, A.; Thomazeau, S.; Maloufi, S.; Furey, A.; Mankiewicz-Boczek, J.; Pawlik-Skowrońska, B.; Capelli, C.; Salmaso, N. Appendix 2: Cyanobacteria associated with the production of cyanotoxins. In Handbook of Cyanobacterial Monitoring and Cyanotoxin Analysis; Meriluoto, J., Spoof, L., Codd, G.A., Eds.; John Wiley and Sons, Ltd: Chichester, UK, 2017. [Google Scholar]
  13. Tillett, D.; Dittmann, E.; Erhard, M.; Von Döhren, H.; Börner, T.; Neilan, B.A. Structural organization of microcystin biosynthesis in Microcystis aeruginosa PCC7806: An integrated peptide-polyketide synthetase system. Chem. Biol. 2000, 7, 753–764. [Google Scholar] [CrossRef] [Green Version]
  14. Heck, K.; Alvarenga, D.O.; Shishido, T.K.; Varani, A.M.; Dörr, F.A.; Pinto, E.; Rouhiainen, L.; Jokela, J.; Sivonen, K.; Fiore, M.F. Biosynthesis of microcystin hepatotoxins in the cyanobacterial genus Fischerella. Toxicon 2018, 141, 43–50. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Bláha, L.; Babica, P.; Maršálek, B. Toxins produced in cyanobacterial water blooms–toxicity and risks. Interdiscip. Toxicol. 2009, 2, 10102–10109. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Metcalf, J.S.; Codd, G.A. Cyanotoxins. In Ecology of Cyanobacteria II; Whitton, B., Ed.; Springer: Dordrecht, The Netherlands, 2012; pp. 651–675. [Google Scholar]
  17. Oksanen, I.; Jokela, J.; Fewer, D.P.; Wahlsten, M.; Rikkinen, J.; Sivonen, K. Discovery of rare and highly toxic microcystins from lichen-associated cyanobacterium Nostoc sp. Strain IO-102-I. Appl. Environ. Microbiol. 2004, 70, 5756–5763. [Google Scholar] [CrossRef] [Green Version]
  18. Wiese, M.; D’Agostino, P.M.; Mihali, T.K.; Moffitt, M.C.; Neilan, B. a Neurotoxic alkaloids: Saxitoxin and its analogs. Mar. Drugs 2010, 8, 2185–2211. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  19. Pearson, L.A.; Dittmann, E.; Mazmouz, R.; Ongley, S.E.; D’Agostino, P.M.; Neilan, B.A. The genetics, biosynthesis and regulation of toxic specialized metabolites of cyanobacteria. Harmful Algae 2016, 54, 98–111. [Google Scholar] [CrossRef] [PubMed]
  20. Borges, H.L.F.; Branco, L.H.Z.; Martins, M.D.; Lima, C.S.; Barbosa, P.T.; Lira, G.A.S.; Bittencourt-Oliveira, M.C.; Molica, R.J.R. Cyanotoxin production and phylogeny of benthic cyanobacterial strains isolated from the northeast of Brazil. Harmful Algae 2015, 43, 46–57. [Google Scholar] [CrossRef]
  21. Humpage, A.; Rositano, J.; Bretag, A.; Brown, R.; Baker, P.; Nicholson, B.; Steffensen, D. Paralytic shellfish poisons from Australian cyanobacterial blooms. Mar. Freshw. Res. 1994, 45, 761. [Google Scholar] [CrossRef]
  22. Sivonen, K.; Himberg, K.; Luukkainen, R.; Niemelä, S.I.; Poon, G.K.; Codd, G.A. Preliminary characterization of neurotoxic cyanobacteria blooms and strains from Finland. Toxic. Assess. 1989, 4, 339–352. [Google Scholar] [CrossRef]
  23. Kellmann, R.; Mihali, T.K.; Jeon, Y.J.; Pickford, R.; Pomati, F.; Neilan, B. a Biosynthetic Intermediate Analysis and Functional Homology Reveal a Saxitoxin Gene Cluster in Cyanobacteria. Appl. Environ. Microbiol. 2008, 74, 4044–4053. [Google Scholar] [CrossRef] [Green Version]
  24. Mihali, T.K.; Kellmann, R.; Neilan, B. a Characterisation of the paralytic shellfish toxin biosynthesis gene clusters in Anabaena circinalis AWQC131C and Aphanizomenon sp. NH-5. BMC Biochem. 2009, 10, 8. [Google Scholar] [CrossRef] [Green Version]
  25. Casero, M.C.; Ballot, A.; Agha, R.; Quesada, A.; Cirés, S. Characterization of saxitoxin production and release and phylogeny of sxt genes in paralytic shellfish poisoning toxin-producing Aphanizomenon Gracile. Harmful Algae 2014, 37, 28–37. [Google Scholar] [CrossRef]
  26. Hawkins, P.R.; Runnegar, M.T.C.; Jackson, A.R.B.; Falconer, I.R. Severe hepatotoxicity caused by the tropical cyanobacterium (blue-green alga) Cylindrospermopsis raciborskii (Woloszynska) Seenaya and Subba Raju isolated from a domestic water supply reservoir. Appl. Environ. Microbiol. 1985, 50, 1292–1295. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  27. Kokociński, M.; Mankiewicz-Boczek, J.; Jurczak, T.; Spoof, L.; Meriluoto, J.; Rejmonczyk, E.; Hautala, H.; Vehniäinen, M.; Pawełczyk, J.; Soininen, J. Aphanizomenon gracile (Nostocales), a cylindrospermopsin-producing cyanobacterium in Polish lakes. Environ. Sci. Pollut. Res. 2013, 20, 5243–5264. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  28. Banker, R.; Carmeli, S.; Hadas, O.; Teltsch, B.; Porat, R.; Sukenik, A. Identification of cylindrospermopsin in Aphanizomenon ovalisporum (Cyanophyceae) isolated from lake Kinneret, Israel. J. Phycol. 1997, 33, 613–616. [Google Scholar] [CrossRef]
  29. Mihali, T.K.; Kellmann, R.; Muenchhoff, J.; Barrow, K.D.; Neilan, B.A. Characterization of the gene cluster responsible for cylindrospermopsin biosynthesis. Appl. Environ. Microbiol. 2008, 74, 716–722. [Google Scholar] [CrossRef] [Green Version]
  30. Whitton, B.; Potts, M. Introduction to the Cyanobacteria. In The Ecology of Cyanobacteria II–Their Diversity in Time and Space; Whitton, B.A., Ed.; Springer: Dordrecht, The Netherlands, 2012; pp. 1–13. ISBN 978-94-007-3854-6. [Google Scholar]
  31. Komárek, J.; Kastovsky, J.; Mares, J.; Johansen, J.R. Taxonomic classification of cyanoprokaryotes (cyanobacterial genera) 2014, using a polyphasic approach. Preslia 2014, 86, 295–335. [Google Scholar]
  32. Mai, T.; Johansen, J.R.; Pietrasiak, N.; Bohunická, M.; Martin, M.P. Revision of the Synechococcales (Cyanobacteria) through recognition of four families including Oculatellaceae fam. nov. and Trichocoleaceae fam. nov. and six new genera containing 14 species. Phytotaxa 2018, 365, 1–59. [Google Scholar] [CrossRef] [Green Version]
  33. Bagchi, S.N.; Dubey, N.; Singh, P. Phylogenetically distant clade of Nostoc-like taxa with the description of Aliinostoc gen. nov. and Aliinostoc morphoplasticum sp. nov. Int. J. Syst. Evol. Microbiol. 2017, 67, 3329–3338. [Google Scholar] [CrossRef]
  34. Genuário, D.B.; Vaz, M.G.M.V.; Hentschke, G.S.; Sant’Anna, C.L.; Fiore, M.F. Halotia gen. nov., a phylogenetically and physiologically coherent cyanobacterial genus isolated from marine coastal environments. Int. J. Syst. Evol. Microbiol. 2015, 65, 663–675. [Google Scholar] [CrossRef] [Green Version]
  35. Brito, Â.; Ramos, V.; Mota, R.; Lima, S.; Santos, A.; Vieira, J.; Vieira, C.P.; Kaštovský, J.; Vasconcelos, V.M.; Tamagnini, P. Description of new genera and species of marine cyanobacteria from the Portuguese Atlantic coast. Mol. Phylogenet. Evol. 2017, 111, 18–34. [Google Scholar] [CrossRef]
  36. Cai, F.; Li, X.; Yang, Y.; Jia, N.; Huo, D.; Li, R. Compactonostoc shennongjiaensis gen. & sp. nov. (Nostocales, Cyanobacteria) from a wet rocky wall in China. Phycologia 2019, 58, 200–210. [Google Scholar] [CrossRef]
  37. Österholm, J.; Popin, R.V.; Fewer, D.P.; Sivonen, K. Phylogenomic Analysis of Secondary Metabolism in the Toxic Cyanobacterial Genera Anabaena, Dolichospermum and Aphanizomenon. Toxins 2020, 12, 248. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  38. Humbert, J.-F.; Fastner, J. Ecology of Cyanobacteria. In Handbook of Cyanobacterial Monitoring and Cyanotoxin Analysis; Meriluoto, J., Spoof, L., Codd, G.A., Eds.; John Wiley and Sons, Ltd: Chichester, UK, 2017; pp. 9–18. [Google Scholar]
  39. Cordeiro, R.; Luz, R.; Vasconcelos, V.; Fonseca, A.; Gonçalves, V. A Critical Review of Cyanobacteria Distribution and Cyanotoxins Occurrence in Atlantic Ocean Islands. Cryptogam. Algol. 2020, 41, 73–89. [Google Scholar] [CrossRef]
  40. Moreira, C.; Ramos, V.; Azevedo, J.; Vasconcelos, V. Methods to detect cyanobacteria and their toxins in the environment. Appl. Microbiol. Biotechnol. 2014, 98, 8073–8082. [Google Scholar] [CrossRef] [PubMed]
  41. Sanseverino, I.; António, D.C.; Loos, R.; Lettieri, T. Cyanotoxins: Methods and Approaches for Their Analysis and Detection; Publications Office of the European Union: Luxembourg, 2017. [Google Scholar]
  42. Merel, S.; Walker, D.; Chicana, R.; Snyder, S.; Baurès, E.; Thomas, O. State of knowledge and concerns on cyanobacterial blooms and cyanotoxins. Environ. Int. 2013, 59, 303–327. [Google Scholar] [CrossRef]
  43. Ballot, A.; Cerasino, L.; Hostyeva, V.; Cirés, S. Variability in the sxt Gene Clusters of PSP Toxin Producing Aphanizomenon gracile Strains from Norway, Spain, Germany and North America. PLoS ONE 2016, 11, 0167552. [Google Scholar] [CrossRef]
  44. Murray, S.A.; Mihali, T.K.; Neilan, B.A. Extraordinary Conservation, Gene Loss, and Positive Selection in the Evolution of an Ancient Neurotoxin. Mol. Biol. Evol. 2011, 28, 1173–1182. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. Moustafa, A.; Loram, J.E.; Hackett, J.D.; Anderson, D.M.; Plumley, F.G.; Bhattacharya, D. Origin of saxitoxin biosynthetic genes in cyanobacteria. PLoS ONE 2009, 4, 5758. [Google Scholar] [CrossRef] [Green Version]
  46. Ballot, A.; Fastner, J.; Wiedner, C. Paralytic shellfish poisoning toxin-producing cyanobacterium Aphanizomenon gracile in Northeast Germany. Appl. Environ. Microbiol. 2010, 76, 1173–1180. [Google Scholar] [CrossRef] [Green Version]
  47. Cirés, S.; Wörmer, L.; Ballot, A.; Agha, R.; Wiedner, C.; Velázquez, D.; Casero, M.C.; Quesada, A. Phylogeography of cylindrospermopsin and paralytic shellfish toxin-producing nostocales cyanobacteria from mediterranean europe (Spain). Appl. Environ. Microbiol. 2014, 80, 1359–1370. [Google Scholar] [CrossRef] [Green Version]
  48. Akcaalan, R.; Köker, L.; Oğuz, A.; Spoof, L.; Meriluoto, J.; Albay, M. First report of cylindrospermopsin production by two cyanobacteria (Dolichospermum mendotae and Chrysosporum ovalisporum) in Lake Iznik, Turkey. Toxins 2014, 6, 3173–3186. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  49. Ballot, A.; Ramm, J.; Rundberget, T.; Kaplan-Levy, R.N.; Hadas, O.; Sukenik, A.; Wiedner, C. Occurrence of non-cylindrospermopsin-producing Aphanizomenon ovalisporum and Anabaena bergii in Lake Kinneret (Israel). J. Plankton Res. 2011, 33, 1736–1746. [Google Scholar] [CrossRef]
  50. Gantar, M.; Sekar, R.; Richardson, L.L. Cyanotoxins from black band disease of corals and from other coral reef environments. Microb. Ecol. 2009, 58, 856–864. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  51. Du, X.; Liu, H.; Yuan, L.; Wang, Y.; Ma, Y.; Wang, R.; Chen, X.; Losiewicz, M.D.; Guo, H.; Zhang, H. The diversity of cyanobacterial toxins on structural characterization, distribution and identification: A systematic review. Toxins 2019, 11, 530. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  52. Mayumi, T.; Kato, H.; Imanishi, S.; Kawasaki, Y.; Hasegawa, M.; Harada, K. Structural Characterization of Microcystins by LC/MS/MS under Ion Trap Conditions. J. Antibiot. 2006, 59, 710–719. [Google Scholar] [CrossRef] [Green Version]
  53. Rantala, A.; Fewer, D.P.; Hisbergues, M.; Rouhiainen, L.; Vaitomaa, J.; Börner, T.; Sivonen, K. Phylogenetic evidence for the early evolution of microcystin synthesis. Proc. Natl. Acad. Sci. USA 2004, 101, 568–573. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  54. Meriluoto, J.; Spoof, L.; Codd, G.A. Appendix 3: Tables of Microcystins and Nodularins. In Handbook of Cyanobacterial Monitoring and Cyanotoxin Analysis; Meriluoto, J., Spoof, L., Codd, G.A., Eds.; John Wiley and Sons, Ltd: Chichester, UK, 2017; pp. 526–537. [Google Scholar]
  55. Galetović, A.; Azevedo, J.; Castelo-Branco, R.; Oliveira, F.; Gómez-Silva, B.; Vasconcelos, V. Absence of Cyanotoxins in Llayta, Edible Nostocaceae Colonies from the Andes Highlands. Toxins 2020, 12, 382. [Google Scholar] [CrossRef] [PubMed]
  56. Rippka, R. Isolation and purification of cyanobacteria. In Methods in Enzymology; Elsvier: Amsterdam, The Netherlands, 1988; Volume 167, pp. 3–27. [Google Scholar]
  57. Rippka, R.; Waterbury, J.; Stanier, R. Isolation and Purification of Cyanobacteria: Some General Principles. In The Prokaryotes: A Handbook on Habitats, Isolation and Identification of Bacteria.; Starr, M.P., Stolp, H., Trüper, H.G., Balows, A., Schlegel, H.G., Eds.; Springer: Berlin/Heidelberg, Germany, 1981. [Google Scholar]
  58. Cordeiro, R.; Luz, R.; Vasconcelos, V.; Gonçalves, V.; Fonseca, A. Cyanobacteria Phylogenetic Studies Reveal Evidence for Polyphyletic Genera from Thermal and Freshwater Habitats. Diversity 2020, 12, 298. [Google Scholar] [CrossRef]
  59. Neilan, B.A.; Jacobs, D.; Del Dot, T.; Blackall, L.L.; Hawkins, P.R.; Cox, P.T.; Goodman, A.E. rRNA sequences and evolutionary relationships among toxic and nontoxic cyanobacteria of the genus Microcystis. Int. J. Syst. Bacteriol. 1997, 47, 693–697. [Google Scholar] [CrossRef]
  60. Nübel, U.; Garcia-Pichel, F.; Muyzer, G. PCR primers to amplify 16S rRNA genes from cyanobacteria. Appl. Environ. Microbiol. 1997, 63, 3327–3332. [Google Scholar] [CrossRef] [Green Version]
  61. Ouahid, Y.; Pérez-Silva, G.; Del Campo, F.F. Identification of potentially toxic environmental Microcystis by individual and multiple PCR amplification of specific microcystin synthetase gene regions. Environ. Toxicol. 2005, 20, 235–242. [Google Scholar] [CrossRef] [PubMed]
  62. Schembri, M.A.; Neilan, B.A.; Saint, C.P. Identification of genes implicated in toxin production in the cyanobacterium Cylindrospermosis raciborskii. Environ. Toxicol. 2001, 16, 413–421. [Google Scholar] [CrossRef] [PubMed]
  63. Yilmaz, M.; Foss, A.J.; Selwood, A.I.; Özen, M.; Boundy, M. Paralytic shellfish toxin producing Aphanizomenon gracile strains isolated from Lake Iznik, Turkey. Toxicon 2018, 148, 132–142. [Google Scholar] [CrossRef] [PubMed]
  64. Ballot, A.; Swe, T.; Mjelde, M.; Cerasino, L.; Hostyeva, V.; Miles, C.O. Cylindrospermopsin- and Deoxycylindrospermopsin-Producing Raphidiopsis raciborskii and Microcystin-Producing Microcystis spp. in Meiktila Lake, Myanmar. Toxins 2020, 12, 232. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  65. Stuken, A.; Campbell, R.J.; Quesada, A.; Sukenik, A.; Dadheech, P.K.; Wiedner, C. Genetic and morphologic characterization of four putative cylindrospermopsin producing species of the cyanobacterial genera Anabaena and Aphanizomenon. J. Plankton Res. 2009, 31, 465–480. [Google Scholar] [CrossRef]
  66. Liu, Y.; Chen, W.; Li, D.; Shen, Y.; Liu, Y.; Song, L. Analysis of paralytic shellfish toxins in Aphanizomenon DC-1 from Lake Dianchi, China. Environ. Toxicol. 2006, 21, 289–295. [Google Scholar] [CrossRef] [PubMed]
  67. Lyra, C.; Suomalainen, S.; Gugger, M.; Vezie, C.; Sundman, P.; Paulin, L.; Sivonen, K. Molecular characterization of planktic cyanobacteria of Anabaena, Aphanizomenon, Microcystis and Planktothrix genera. Int. J. Syst. Evol. Microbiol. 2001, 51, 513–526. [Google Scholar] [CrossRef] [Green Version]
  68. Katoh, K.; Standley, D.M. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [Green Version]
  69. Darriba, D.; Taboada, G.L.; Doallo, R.; Posada, D. jModelTest 2: More models, new heuristics and parallel computing. Nat. Methods 2012, 9, 772. [Google Scholar] [CrossRef] [Green Version]
  70. Trifinopoulos, J.; Nguyen, L.-T.; von Haeseler, A.; Minh, B.Q. W-IQ-TREE: A fast online phylogenetic tool for maximum likelihood analysis. Nucleic Acids Res. 2016, 44, 232–235. [Google Scholar] [CrossRef] [Green Version]
  71. Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient Bayesian Phylogenetic Inference and Model Choice Across a Large Model Space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Toxins 13 00258 g001 550
Figure 1. Cyanotoxin-producing strains included in the phylogenetic analysis: BACA0025 (A–C), Microcystis aeruginosa BACA0148 (D), BACA0031 (E), and Aphanizomenon gracile BACA0041 (F,G). Scale bars –10 µm.
Figure 1. Cyanotoxin-producing strains included in the phylogenetic analysis: BACA0025 (A–C), Microcystis aeruginosa BACA0148 (D), BACA0031 (E), and Aphanizomenon gracile BACA0041 (F,G). Scale bars –10 µm.
Toxins 13 00258 g001
Toxins 13 00258 g002 550
Figure 2. Maximum likelihood tree cluster I of partial 16S rRNA gene sequences (1070 bp). Bootstrap (greater than 50%) and probabilities values (greater than 0.9) are presented in front of the pertinent nodes. CYN+: Cylindrospermopsin producing strains; STX+: Saxitoxin producing strains. * Collapsed sequences (NCBI accession numbers): AJ630425, FN691925, FN691926, KC297496, FN691923, FN691907, FM242088, FN691908, AB551474, FN691909, KR154316, KR154314, AB551455, KR154298, FN691922, KR154304, AJ630413, AF092504, HQ407325, LR590627, JQ237770, AY763117, AJ582102, LR590629, LR746263, MG921181, MG921182, HQ730086, KT583658, AY701557, FM161349, FM161350, LC474825, LC474824, KT290381, AJ293110, AJ630428, KT290378, KM019920, KT290326, GU434226, AJ630446, MT294032, MT294033, AY196087, KM245026, MN381942, MN381943, DQ234830, AJ630457, AJ630456, KC346266, KC346265, KC346267, JN385287, AF160256, JF768744, EU076457, FJ234895, EF529489, EF529482, EF529488, EU076457, FJ234884, FJ234885, FJ234890, FJ234897, AB608023, JQ237772, LN997860, AJ133177, AJ781131, AJ781149, AJ781145, KM199731, FM177481, AY038033, AM773306, FR774773, MK503791, KY403996, MK503792, MK503793, MH497064, KJ737427, MN243143, AF334695, KY863521, AP018280, KT336439.2, KT336441, MG970541, MG970549, MG970536, MG970538, JN695681, JN695682, FR822753, AF334690, AF334692, JQ083655, KF017617, KF934181, JX088105, HG970655, AF334701, AF334703, KY508609, KY508610, HG970652, MN626663, MN626664, KM199732, KY508607, KY508612, KY508611, KY508608, HG970653, KF417425, JN385289, JN385292, HQ847564, KM268886, KM268884, KY098849, KM268889, KF934180, KF052614, 125687, KF052599, 114701, GQ287650, KF052617, KF052610, KF052603, KF052605, KU161661, AM711524, HG004586, KT166436, MH497066, MH291266, MF642332, KX787933, KJ566945, KJ566947, KF052607, 125685, KF052616, HE797731, KB235930, MN400069, MN400070, MH598843, MT044191, MT044192, KX638483, KX638487, KX638489, KU161674, KU161676, KU161650, AY577534, MF002129, KM019950, AY785313, HQ847558, HQ847561.
Figure 2. Maximum likelihood tree cluster I of partial 16S rRNA gene sequences (1070 bp). Bootstrap (greater than 50%) and probabilities values (greater than 0.9) are presented in front of the pertinent nodes. CYN+: Cylindrospermopsin producing strains; STX+: Saxitoxin producing strains. * Collapsed sequences (NCBI accession numbers): AJ630425, FN691925, FN691926, KC297496, FN691923, FN691907, FM242088, FN691908, AB551474, FN691909, KR154316, KR154314, AB551455, KR154298, FN691922, KR154304, AJ630413, AF092504, HQ407325, LR590627, JQ237770, AY763117, AJ582102, LR590629, LR746263, MG921181, MG921182, HQ730086, KT583658, AY701557, FM161349, FM161350, LC474825, LC474824, KT290381, AJ293110, AJ630428, KT290378, KM019920, KT290326, GU434226, AJ630446, MT294032, MT294033, AY196087, KM245026, MN381942, MN381943, DQ234830, AJ630457, AJ630456, KC346266, KC346265, KC346267, JN385287, AF160256, JF768744, EU076457, FJ234895, EF529489, EF529482, EF529488, EU076457, FJ234884, FJ234885, FJ234890, FJ234897, AB608023, JQ237772, LN997860, AJ133177, AJ781131, AJ781149, AJ781145, KM199731, FM177481, AY038033, AM773306, FR774773, MK503791, KY403996, MK503792, MK503793, MH497064, KJ737427, MN243143, AF334695, KY863521, AP018280, KT336439.2, KT336441, MG970541, MG970549, MG970536, MG970538, JN695681, JN695682, FR822753, AF334690, AF334692, JQ083655, KF017617, KF934181, JX088105, HG970655, AF334701, AF334703, KY508609, KY508610, HG970652, MN626663, MN626664, KM199732, KY508607, KY508612, KY508611, KY508608, HG970653, KF417425, JN385289, JN385292, HQ847564, KM268886, KM268884, KY098849, KM268889, KF934180, KF052614, 125687, KF052599, 114701, GQ287650, KF052617, KF052610, KF052603, KF052605, KU161661, AM711524, HG004586, KT166436, MH497066, MH291266, MF642332, KX787933, KJ566945, KJ566947, KF052607, 125685, KF052616, HE797731, KB235930, MN400069, MN400070, MH598843, MT044191, MT044192, KX638483, KX638487, KX638489, KU161674, KU161676, KU161650, AY577534, MF002129, KM019950, AY785313, HQ847558, HQ847561.
Toxins 13 00258 g002
Toxins 13 00258 g003 550
Figure 3. Maximum likelihood tree of the partial 16S rRNA gene sequences (1324 bp). Bootstrap (greater than 50%) and probabilities values (greater than 0.9) are presented in front of the pertinent nodes. MC+: Microcystin-producing strains. * Collapsed sequences (NCBI accession numbers): Myxosarcina sp. (AJ344562; AJ344561), Dermocarpella incrassata (AJ344559), Synechocystis pevalekii (KM350249), Gloeocapsopsis crepidinum (KF498710), Foliisarcina bertiogensis (KT731151), Hyella patelloides (HQ832901), Chroococcidiopsis sp. (AJ344557), Xenococcus sp. (AF132783), Stanieria cyanosphaera (112109), Chroococcopsis gigantea (KM019987).
Figure 3. Maximum likelihood tree of the partial 16S rRNA gene sequences (1324 bp). Bootstrap (greater than 50%) and probabilities values (greater than 0.9) are presented in front of the pertinent nodes. MC+: Microcystin-producing strains. * Collapsed sequences (NCBI accession numbers): Myxosarcina sp. (AJ344562; AJ344561), Dermocarpella incrassata (AJ344559), Synechocystis pevalekii (KM350249), Gloeocapsopsis crepidinum (KF498710), Foliisarcina bertiogensis (KT731151), Hyella patelloides (HQ832901), Chroococcidiopsis sp. (AJ344557), Xenococcus sp. (AF132783), Stanieria cyanosphaera (112109), Chroococcopsis gigantea (KM019987).
Toxins 13 00258 g003
Table
Table 1. Detection of genes involved in microcystin, cylindrospermopsin, and saxitoxin production, and ESI-LC-MS/MS analysis on BACA strains. Only strains with positive detection of either the genes or the toxins are shown.
Table 1. Detection of genes involved in microcystin, cylindrospermopsin, and saxitoxin production, and ESI-LC-MS/MS analysis on BACA strains. Only strains with positive detection of either the genes or the toxins are shown.
StrainsHabitatSpeciesPCRESI-LC-MS/MS
SXTCYNMCSXTCYNMC-LR
BACA0007LakeKamptonema sp.G-----
BACA0025Lakeunidentified species-B, CC--+-
BACA0031Lakeunidentified species-B, CC--+-
BACA0041LakeAphanizomenon gracileA, G, H, I--+--
BACA0081LakeCylindrospermum sp.H-----
BACA0091LakeNostoc sp.--E---
BACA0109LakeNostoc sp.-B----
BACA0142ThermalLeptolyngbya sp.-B----
BACA0146ThermalLeptolyngbya sp.-B----
BACA0148LakeMicrocystis aeruginosa--C, D, E, G--+
BACA0203LakeLeptodesmis sp.G, H-----
BACA0204LakeLeptolyngbya sp.G-----
BACA0223LakeAnathece minutissimaG-----
“-“: absence of biosynthesis-encoding genes amplification or absence of toxin in the ESI-LC-MS/MS analysis; C: mcyC, D: mcyD, E: mcyE, G: mcyG, A: sxtA, G: sxtG, H: sxtH, I: sxtI, B: cyrB, CC: cyrC, amplification of respective biosynthesis-encoding genes.
Table
Table 2. Primers used to amplify and/ or sequence cyanotoxins biosynthesis genes and 16S rRNA.
Table 2. Primers used to amplify and/ or sequence cyanotoxins biosynthesis genes and 16S rRNA.
GenePrimerFragment length (bp)Sequence (5’–3’)References
mcyCPSCF1674GCAACATCCCAAGAGCAAAGOuahid et al. [61]
PSCR1CCGACAACATCACAAAGGC
mcyDPKDF1647GACGCTCAAATGATGAAAC
PKDR1GCAACCGATAAAAACTCCC
mcyEPKEF1755CGCAAACCCGATTTACAG
PKER1CCCCTACCATCTTCATCTTC
mcyGPKGF1425ACTCTCAAGTTATCCTCCCTC
PKGR1AATCGCTAAAACGCCACC
sxtAsxtA F602AGGTCTTTGACTTGCATCCAALedreux et al. [10]
sxtA RAACCGGCGACATAGATGATA
sxtGsxtGf893AGGAATTCCCTATCCACCGGAGCasero et al. [25]
sxtGrCGGCGAACATCTAACGTTGCAC
sxtHsxtHf812AAGACCACTGTCCCCACCGAGG
sxtHrCTGTGCAGCGATCTGATGGCAC
sxtIsxtIf910AGCGCTGCCGCTATGGTTGTCG
sxtIrACGCAATTGAGGGCGACACCAC
cyrBM13597GGCAAATTGTGATAGCCACGAGCSchembri et al. [62]
M14GATGGAACATCGCTCACTGGTG
cyrCM4650GAAGCTCTGGAATCCGGTAA
M5AATCCTTACGGGATCCGGTGC
16S rRNA27F AGAGTTTGATCCTGGCTCAGNeilan et al. [59]
CYA359F GGGGAATYTTCCGCAATG GGNubel et al. [60]
1494R TACGGCTACCTTGTTACGACNeilan et al. [59]
CYA781R GACTACTGGGGTATCTAATCCCATTNubel et al. [60]
CYA781F AATGGGATTAGATACCCCAGTAGTCThis study
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Cordeiro, R.; Azevedo, J.; Luz, R.; Vasconcelos, V.; Gonçalves, V.; Fonseca, A. Cyanotoxin Screening in BACA Culture Collection: Identification of New Cylindrospermopsin Producing Cyanobacteria. Toxins 2021, 13, 258. https://0-doi-org.brum.beds.ac.uk/10.3390/toxins13040258

AMA Style

Cordeiro R, Azevedo J, Luz R, Vasconcelos V, Gonçalves V, Fonseca A. Cyanotoxin Screening in BACA Culture Collection: Identification of New Cylindrospermopsin Producing Cyanobacteria. Toxins. 2021; 13(4):258. https://0-doi-org.brum.beds.ac.uk/10.3390/toxins13040258

Chicago/Turabian Style

Cordeiro, Rita, Joana Azevedo, Rúben Luz, Vitor Vasconcelos, Vítor Gonçalves, and Amélia Fonseca. 2021. "Cyanotoxin Screening in BACA Culture Collection: Identification of New Cylindrospermopsin Producing Cyanobacteria" Toxins 13, no. 4: 258. https://0-doi-org.brum.beds.ac.uk/10.3390/toxins13040258

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop