Cytotoxic Effects of Recombinant StxA2-His in the Absence of Its Corresponding B-Subunit
Abstract
:1. Introduction
2. Results
2.1. Purification of Stx2a-His Subunits
2.2. Biochemical Characterization of Stx2a Subunits
2.3. Cytotoxic Effect of StxA2a-His on Different Cell Cultures in the Absence of the B-Subunit
2.4. Cytotoxic Effect of StxA2a-His Is Reduced in Presence of SubB1-His
3. Discussion
4. Conclusions
5. Material and Methods
5.1. Cloning and Expression Tests of Recombinant Stx2a Subunits
5.2. Recombinant Expression and Purification of Toxin Subunits
5.3. Determination of Protein Concentration
5.4. CD Spectroscopy
5.5. Size Exclusion Chromatography
5.6. Gb3 ELISA
5.7. Cytotoxicity Assays
5.8. Microscopic Analysis
5.9. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Fraser, M.E.; Chernaia, M.M.; Kozlov, Y.V.; James, M.N.G. Crystal structure of the holotoxin from Shigella dysenteriae at 2.5 A resolution. Struct. Biol. 1994, 1, 59–64. [Google Scholar] [CrossRef] [PubMed]
- Beddoe, T.; Paton, A.W.; Le Nours, J.; Rossjohn, J.; Paton, J.C. Structure, biological functions and applications of the AB5 toxins. Trends Biochem. Sci. 2010, 35, 411–418. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Karch, H.; Tarr, P.I.; Bielaszewska, M. Enterohaemorrhagic Escherichia coli in human medicine. Int. J. Med. Microbiol. 2005, 295, 405–418. [Google Scholar] [CrossRef] [PubMed]
- Hughes, A.K.; Stricklett, P.K.; Schmid, D.; Kohan, D.E. Cytotoxic effect of Shiga toxin-1 on human glomerular epithelial cells. Kidney Int. 2000, 57, 2350–2359. [Google Scholar] [CrossRef] [Green Version]
- O’Brien, A.D.; LaVeck, G.D.; Thompson, M.R.; Formal, S.B. Production of Shigella dysenteriae Type 1-like cytotoxin by Escherichia coli. J. Infect. Dis. 1982, 146, 763–769. [Google Scholar] [CrossRef] [Green Version]
- Obrig, T.G.; Moran, T.P.; Brownt, J.E. The mode of action of Shiga toxin on peptide elongation of eukaryotic protein synthesis. Biochem. J. 1987, 244, 287–294. [Google Scholar] [CrossRef] [Green Version]
- Shin, I.S.; Ishii, S.; Shin, J.S.; Sung, K.I.; Park, B.S.; Jang, H.Y.; Kim, B.W. Globotriaosylceramide (Gb3) content in HeLa cells is correlated to Shiga toxin-induced cytotoxicity and Gb3 synthase expression. BMB Rep. 2009, 42, 310–314. [Google Scholar] [CrossRef] [Green Version]
- Shimizu, T.; Sato, T.; Kawakami, S.; Ohta, T.; Noda, M.; Hamabata, T. Receptor affinity, stability and binding mode of Shiga toxins are determinants of toxicity. Microb. Pathog. 2007, 43, 88–95. [Google Scholar] [CrossRef]
- Plunkett, G.; Rose, D.J.; Durfee, T.J.; Blattner, F.R. Sequence of Shiga toxin 2 phage 933 W from Escherichia coli O157:H7: Shiga toxin as a phage late-gene product. J. Bacteriol. 1999, 181, 1767–1778. [Google Scholar] [CrossRef] [Green Version]
- Murphy, K.C.; Ritchie, J.M.; Waldor, M.K.; Løbner-Olesen, A.; Marinus, M.G. Dam methyltransferase is required for stable lysogeny of the Shiga toxin (Stx2)-encoding bacteriophage 933W of enterohemorrhagic Escherichia coli O157:H7. J. Bacteriol. 2008, 190, 438–441. [Google Scholar] [CrossRef] [Green Version]
- Boerlin, P.; McEwen, S.A.; Boerlin-Petzold, F.; Wilson, J.B.; Johnson, R.P.; Gyles, C.L. Associations between virulence factors of Shiga toxin-producing Escherichia coli and disease in humans. J. Clin. Microbiol. 1999, 37, 497–503. [Google Scholar] [CrossRef] [Green Version]
- Paton, A.W.; Srimanote, P.; Talbot, U.M.; Wang, H.; Paton, J.C. A new family of potent AB5 cytotoxins produced by Shiga toxigenic Escherichia coli. J. Exp. Med. 2004, 200, 35–46. [Google Scholar] [CrossRef] [Green Version]
- Paton, A.W.; Beddoe, T.; Thorpe, C.M.; Whisstock, J.C.; Wilce, M.C.J.; Rossjohn, J.; Talbot, U.M.; Paton, J.C. AB5 subtilase cytotoxin inactivates the endoplasmic reticulum chaperone BiP. Nature 2006, 443, 548–552. [Google Scholar] [CrossRef]
- Chong, D.C.; Paton, J.C.; Thorpe, C.M.; Paton, A.W. Clathrin-dependent trafficking of subtilase cytotoxin, a novel AB5 toxin that targets the endoplasmic reticulum chaperone BiP. Cell. Microbiol. 2008, 10, 795–806. [Google Scholar] [CrossRef]
- Byres, E.; Paton, A.W.; Paton, J.C.; Löfling, J.C.; Smith, D.F.; Wilce, M.C.J.; Talbot, U.M.; Chong, D.C.; Yu, H.; Huang, S.; et al. Incorporation of a non-human glycan mediates human susceptibility to a bacterial toxin. Nature 2008, 456, 648–652. [Google Scholar] [CrossRef] [Green Version]
- Yamaji, T.; Hanamatsu, H.; Sekizuka, T.; Kuroda, M.; Iwasaki, N.; Ohnishi, M.; Furukawa, J.; Yahiro, K.; Hanada, K. A CRISPR screen using subtilase cytotoxin identifies SLC39A9 as a glycan-regulating factor. iScience 2019, 15, 407–420. [Google Scholar] [CrossRef] [Green Version]
- Krause, M.; Sessler, K.; Kaziales, A.; Grahl, R.; Noettger, S.; Barth, H.; Schmidt, H. Variants of Escherichia coli subtilase cytotoxin subunits show differences in complex formation in vitro. Toxins 2019, 11, 703. [Google Scholar] [CrossRef] [Green Version]
- Fierz, L.; Cernela, N.; Hauser, E.; Nüesch-Inderbinen, M.; Stephan, R. Characteristics of Shiga toxin-producing Escherichia coli strains isolated during 2010–2014 from human infections in Switzerland. Front. Microbiol. 2017, 8, 1471. [Google Scholar] [CrossRef] [Green Version]
- Funk, J.; Stoeber, H.; Hauser, E.; Schmidt, H. Molecular analysis of subtilase cytotoxin genes of food-borne Shiga toxin-producing Escherichia coli reveals a new allelic subAB variant. BMC Microbiol. 2013, 13, 230. [Google Scholar] [CrossRef] [Green Version]
- Tasara, T.; Fierz, L.; Klumpp, J.; Schmidt, H.; Stephan, R. Draft genome sequences of five Shiga toxin-producing Escherichia coli isolates harboring the new and recently described subtilase cytotoxin allelic variant subAB2–3. Genome Announc. 2017, 5, e01582-16. [Google Scholar] [CrossRef] [Green Version]
- Pellino, C.A.; Karve, S.S.; Pradhan, S.; Weiss, A.A. AB5 preassembly is not required for Shiga toxin activity. J. Bacteriol. 2016, 198, 1621–1630. [Google Scholar] [CrossRef] [Green Version]
- Funk, J.; Biber, N.; Schneider, M.; Hauser, E.; Enzenmüller, S.; Förtsch, C.; Barth, H.; Schmidt, H. Cytotoxic and apoptotic effects of recombinant subtilase cytotoxin variants of Shiga toxin-producing Escherichia coli. Infect. Immun. 2015, 83, 2338–2349. [Google Scholar] [CrossRef] [Green Version]
- Slanec, T.; Fruth, A.; Creuzburg, K.; Schmidt, H. Molecular analysis of virulence profiles and Shiga toxin genes in food-borne Shiga toxin-producing Escherichia coli. Appl. Environ. Microbiol. 2009, 75, 6187–6197. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hauser, E.; Bruederle, M.; Reich, C.; Bruckbauer, A.; Funk, J.; Schmidt, H. Subtilase contributes to the cytotoxicity of a Shiga toxin-producing Escherichia coli strain encoding three different toxins. Int. J. Food Microbiol. 2016, 217, 156–161. [Google Scholar] [CrossRef]
- Heinisch, L.; Zoric, K.; Krause, M.; Schmidt, H. Transcription of the subtilase cytotoxin gene subAB1 in Shiga toxin-producing Escherichia coli is dependent on hfq and hns. Appl. Environ. Microbiol. 2019, 85, e01281-19. [Google Scholar] [CrossRef]
- Bowman, C.C.; Clements, J.D. Differential biological and adjuvant activities of cholera toxin and Escherichia coli heat-labile enterotoxin hybrids. Infect. Immun. 2001, 69, 1528–1535. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Smith, M.J.; Carvalho, H.M.; Melton-Celsa, A.R.; O’Brien, A.D. The 13C4 monoclonal antibody that neutralizes Shiga toxin type 1 (Stx1) recognizes three regions on the Stx1 B subunit and prevents Stx1 from binding to its eukaryotic receptor globotriaosylceramide. Infect. Immun. 2006, 74, 6992–6998. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Smith, M.J.; Melton-Celsa, A.R.; Sinclair, J.F.; Carvalho, H.M.; Robinson, C.M.; O’Brien, A.D. Monoclonal antibody 11E10, which neutralizes Shiga toxin type 2 (Stx2), recognizes three regions on the Stx2 A subunit, blocks the enzymatic action of the toxin in vitro, and alters the overall cellular distribution of the toxin. Infect. Immun. 2009, 77, 2730–2740. [Google Scholar] [CrossRef] [Green Version]
- Brandelli, J.; Griener, T.; Laing, A.; Mulvey, G.; Armstrong, G. The effects of Shiga toxin 1, 2 and their subunits on cytokine and chemokine expression by human macrophage-like THP-1 cells. Toxins 2015, 7, 4054–4066. [Google Scholar] [CrossRef] [Green Version]
- Conrady, D.G.; Flagler, M.J.; Friedmann, D.R.; Vander Wielen, B.D.; Kovall, R.A.; Weiss, A.A.; Herr, A.B. Molecular basis of differential B-pentamer stability of Shiga toxins 1 and 2. PLoS ONE 2010, 5, e15153. [Google Scholar] [CrossRef] [Green Version]
- Zumbrun, S.D.; Hanson, L.; Sinclair, J.F.; Freedy, J.; Melton-Celsa, A.R.; Rodriguez-Canales, J.; Hanson, J.C.; O’Brien, A.D. Human intestinal tissue and cultured colonic cells contain globotriaosylceramide synthase mRNA and the alternate Shiga toxin receptor globotetraosylceramide. Infect. Immun. 2010, 78, 4488–4499. [Google Scholar] [CrossRef] [Green Version]
- Brigotti, M.; Orth-Höller, D.; Carnicelli, D.; Porcellini, E.; Galassi, E.; Tazzari, P.L.; Ricci, F.; Manoli, F.; Manet, I.; Talasz, H.; et al. The structure of the Shiga toxin 2a A-subunit dictates the interactions of the toxin with blood components. Cell. Microbiol. 2019, 21. [Google Scholar] [CrossRef] [Green Version]
- He, X.; Quiñones, B.; McMahon, S.; Mandrell, R.E. A single-step purification and molecular characterization of functional Shiga toxin 2 variants from pathogenic Escherichia coli. Toxins 2012, 4, 487–504. [Google Scholar] [CrossRef] [Green Version]
- Rath, A.; Glibowicka, M.; Nadeau, V.G.; Chen, G.; Deber, C.M. Detergent binding explains anomalous SDS-PAGE migration of membrane proteins. Proc. Natl. Acad. Sci. USA. 2009, 106, 1760–1765. [Google Scholar] [CrossRef] [Green Version]
- Ibel, K.; May, R.P.; Kirschner, K.; Szadkowski, H.; Mascher, E.; Lundahl, P. Protein-decorated micelle structure of sodium-dodecyl-sulfate–protein complexes as determined by neutron scattering. Eur. J. Biochem. 1990, 190, 311–318. [Google Scholar] [CrossRef]
- Melton-Celsa, A.R.; O’Brien, A.D. Shiga toxins of Shigella dysenteriae and Escherichia coli. In Bacterial Protein Toxins; Springer: Berlin/Heidelberg, Germany, 2000; pp. 385–406. [Google Scholar]
- Lindgren, S.W.; Samuel, J.E.; Schmitt, C.K.; O’Brien, A.D. The specific activities of Shiga-like toxin type II (SLT-II) and SLT-II-related toxins of enterohemorrhagic Escherichia coli differ when measured by Vero cell cytotoxicity but not by mouse lethality. Infect. Immun. 1994, 62, 623–631. [Google Scholar] [CrossRef] [Green Version]
- Tam, P.; Mahfoud, R.; Nutikka, A.; Khine, A.A.; Binnington, B.; Paroutis, P.; Lingwood, C. Differential intracellular transport and binding of verotoxin 1 and verotoxin 2 to globotriaosylceramide-containing lipid assemblies. J. Cell. Physiol. 2008, 216, 750–763. [Google Scholar] [CrossRef]
- Torgersen, M.L.; Lauvrak, S.U.; Sandvig, K. The A-subunit of surface-bound Shiga toxin stimulates clathrin-dependent uptake of the toxin. FEBS J. 2005, 272, 4103–4113. [Google Scholar] [CrossRef]
- Sessler, K.; Papatheodorou, P.; Wondany, F.; Krause, M.; Noettger, S.; Bernhard, D.; Michaelis, J.; Schmidt, H.; Barth, H. The enzyme subunit SubA of Shiga toxin-producing E. coli strains demonstrates comparable intracellular transport and cytotoxic activity as the holotoxin SubAB in HeLa and HCT116 cells in vitro. Arch. Toxicol. 2021, 95. [Google Scholar] [CrossRef]
- Kolling, G.L.; Matthews, K.R. Export of virulence genes and Shiga toxin by membrane vesicles of Escherichia coli O157:H7. Appl. Environ. Microbiol. 1999, 65, 1843–1848. [Google Scholar] [CrossRef] [Green Version]
- Bauwens, A.; Kunsmann, L.; Marejková, M.; Zhang, W.; Karch, H.; Bielaszewska, M.; Mellmann, A. Intrahost milieu modulates production of outer membrane vesicles, vesicle-associated Shiga toxin 2a and cytotoxicity in Escherichia coli O157:H7 and O104:H4. Environ. Microbiol. Rep. 2017, 9, 626–634. [Google Scholar] [CrossRef] [PubMed]
- Yokoyama, K.; Horii, T.; Yamashino, T.; Hashikawa, S.; Barua, S.; Hasegawa, T.; Watanabe, H.; Ohta, M. Production of Shiga toxin by Escherichia coli measured with reference to the membrane vesicle-associated toxins. FEMS Microbiol. Lett. 2000, 192, 139–144. [Google Scholar] [CrossRef] [PubMed]
- Bielaszewska, M.; Rüter, C.; Bauwens, A.; Greune, L.; Jarosch, K.-A.; Steil, D.; Zhang, W.; He, X.; Lloubes, R.; Fruth, A.; et al. Host cell interactions of outer membrane vesicle-associated virulence factors of enterohemorrhagic Escherichia coli O157: Intracellular delivery, trafficking and mechanisms of cell injury. PLoS Pathog. 2017, 13, e1006159. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.-H.; Lee, S.-R.; Kim, K.-S.; Ko, A.; Kim, E.; Kim, Y.-H.; Chang, K.-T. Shiga toxin A subunit mutant of Escherichia coli O157:H7 releases outer membrane vesicles containing the B-pentameric complex. FEMS Immunol. Med. Microbiol. 2010, 58, 412–420. [Google Scholar] [CrossRef] [Green Version]
- Smith, D.C.; Sillence, D.J.; Falguières, T.; Jarvis, R.M.; Johannes, L.; Lord, J.M.; Platt, F.M.; Roberts, L.M. The association of Shiga-like toxin with detergent resistant membranes is modulated by glucosylceramide and is an essential requirement in the endoplasmic reticulum for a cytotoxic effect. Mol. Biol. Cell 2006, 17, 1375–1387. [Google Scholar] [CrossRef] [Green Version]
- Johansson, K.; Willysson, A.; Kristoffersson, A.-C.; Tontanahal, A.; Gillet, D.; Ståhl, A.; Karpman, D. Shiga toxin-bearing microvesicles exert a cytotoxic effect on recipient cells only when the cells express the toxin receptor. Front. Cell. Infect. Microbiol. 2020, 10, 1–11. [Google Scholar] [CrossRef]
- Schüller, S.; Frankel, G.; Phillips, A.D. Interaction of Shiga toxin from Escherichia coli with human intestinal epithelial cell lines and explants: Stx2 induces epithelial damage in organ culture. Cell. Microbiol. 2004, 6, 289–301. [Google Scholar] [CrossRef]
- Studier, F.W.; Moffatt, B.A. Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes. J. Mol. Biol. 1986, 189, 113–130. [Google Scholar] [CrossRef]
- Miroux, B.; Walker, J.E. Over-production of proteins in Escherichia coli: Mutant hosts that allow synthesis of some membrane proteins and globular proteins at high levels. J. Mol. Biol. 1996, 260, 289–298. [Google Scholar] [CrossRef] [Green Version]
- Sanger, F.; Nicklen, S.; Coulson, A.R. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 1977, 74, 5463–5467. [Google Scholar] [CrossRef] [Green Version]
- Studier, F.W. Protein production by auto-induction in high-density shaking cultures. Protein Expr. Purif. 2005, 41, 207–234. [Google Scholar] [CrossRef]
- Laemmli, U.K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970, 227, 680–685. [Google Scholar] [CrossRef]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
Strain or Plasmid | Relevant Geno- or Phenotype | Reference |
---|---|---|
E. coli DH5α | tonA lacZ∆M15 endA1 recA1 thi-1 supE44 phoA gyrA96 hsdR17 Δ(lacZYA-argF)U169 relA1 | Invitrogen |
E. coli DH5α/933W | DH5α strain carrying the Stx2a-encoding prophage 933W | This study |
E. coli BL21 (DE3) | Expression strain, dcm ompT hsdS(rB−mB−) gal | [49] |
E. coli C41 (DE3) | Expression strain derived from E. coli BL21, T7 promoter driven expression, lacI operon | [50] |
E. coli C43 (DE3) | Expression strain derived from E. coli BL21, T7 promoter driven expression, lacI operon | [50] |
E. coli C43 (DE3)/pKR09 | Expression strain expressing StxA2a-His subunit | This study |
E. coli C41 (DE3)/pKR10 | Expression strain expressing StxB2a-His subunit | This study |
pET22b(+) | AmpR, 6x His-tag | Novagen Inc. |
pKR09 | pET22b(+)-stxA2a, AmpR | This study |
pKR10 | pET22b(+)-stxB2a, AmpR | This study |
Primer Designation | Sequence (5′ to 3′) | Source |
---|---|---|
StxA2a-pET22_for | CGTGCATATGAAGTGTATATTATTTAAATGGGT | This study |
StxA2a-pET22_rev | CCCCTCGAGTTTACCCGTTGTATATAA | This study |
StxB2a-pET22_for | CGTGCATATGAAGAAGATGTTTATGGCGG | This study |
StxB2a-pET22_rev | CCCCTCGAGGTCATTATTAAACTGCAC | This study |
pET-22b-seq-for | GGGTTATGCTAGTTATTGC | This study |
pET-22b-seq-rev | GCGAAATTAATACGACTCAC | This study |
Toxin Subunit | Molecular Weight /kDa | Extinction Coefficient /M−1cm−1 |
---|---|---|
StxA2a-His | 36.8 | 33,140 |
StxB2a-His | 10.9 | 13,980 |
SubA1-His | 36.1 | 41,035 |
SubB1-His | 14.0 | 26,930 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Heinisch, L.; Krause, M.; Roth, A.; Barth, H.; Schmidt, H. Cytotoxic Effects of Recombinant StxA2-His in the Absence of Its Corresponding B-Subunit. Toxins 2021, 13, 307. https://0-doi-org.brum.beds.ac.uk/10.3390/toxins13050307
Heinisch L, Krause M, Roth A, Barth H, Schmidt H. Cytotoxic Effects of Recombinant StxA2-His in the Absence of Its Corresponding B-Subunit. Toxins. 2021; 13(5):307. https://0-doi-org.brum.beds.ac.uk/10.3390/toxins13050307
Chicago/Turabian StyleHeinisch, Laura, Maike Krause, Astrid Roth, Holger Barth, and Herbert Schmidt. 2021. "Cytotoxic Effects of Recombinant StxA2-His in the Absence of Its Corresponding B-Subunit" Toxins 13, no. 5: 307. https://0-doi-org.brum.beds.ac.uk/10.3390/toxins13050307