Next Article in Journal
Interactions between Filter-Feeding Bivalves and Toxic Diatoms: Influence on the Feeding Behavior of Crassostrea gigas and Pecten maximus and on Toxin Production by Pseudo-nitzschia
Previous Article in Journal
A Spider Toxin Exemplifies the Promises and Pitfalls of Cell-Free Protein Production for Venom Biodiscovery
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Toxins
Volume 13
Issue 8
10.3390/toxins13080576
toxins-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Changes of DNA Damage Effect of T-2 or Deoxynivalenol Toxins during Three Weeks Exposure in Common Carp (Cyprinus carpio L.) Revealed by LORD-Q PCR

by
Rubina Tünde Szabó
1,
Mária Kovács-Weber
1,*,
Krisztián Milán Balogh
2,3,
Miklós Mézes
2,3 and
Balázs Kovács
4
1
Institute of Animal Husbandry, Gödöllő Campus, Hungarian University of Agriculture and Life Sciences, H-2100 Gödöllő, Hungary
2
Department of Feed Toxicology, Institute of Physiology and Nutrition, Gödöllő Campus, Hungarian University of Agriculture and Life Sciences, H-2100 Gödöllő, Hungary
3
MTA-KE-SZIE Mycotoxins in the Food Chain Research Group, Department of Physiology and Animal Health, Institute of Physiology and Nutrition, Kaposvár Campus, Hungarian University of Agriculture and Life Sciences, H-7400 Kaposvár, Hungary
4
Department of Molecular Ecology, Institute of Aquaculture and Environmental Safety, Hungarian University of Agriculture and Life Sciences, H-2100 Gödöllő, Hungary
*
Author to whom correspondence should be addressed.
Toxins 2021, 13(8), 576; https://0-doi-org.brum.beds.ac.uk/10.3390/toxins13080576
Submission received: 17 July 2021 / Revised: 9 August 2021 / Accepted: 16 August 2021 / Published: 19 August 2021
(This article belongs to the Section Mycotoxins)
Browse Figures
Review Reports Versions Notes

Abstract

:
The present study aimed to adapt a Long-run Real-time DNA Damage Quantification (LORD-Q) qPCR-based method for the analysis of the mitochondrial genome of Common carp (Cyprinus carpio L.) and detect the DNA damaging effect of T-2 (4.11 mg kg−1) and deoxynivalenol (5.96 mg kg−1) mycotoxins in a 3-week feeding period. One-year-old Common carp were treated in groups (control, T-2 and DON). The mycotoxins were sprayed over the complete pelleted feed, and samples were taken weekly. Following the adaptation of LORD-Q PCR method for the Common carp species, the number of lesions were calculated to determine the amount of DNA damage. In the first and second weeks, the T-2 and the DON treated groups differed significantly from each other; however these differences disappeared in the third week. There was a significant difference in the DNA lesion values between weeks 1 and 3 in the deoxynivalenol-contaminated groups. While in the T-2 treated groups, the DNA lesion values were significantly reduced on weeks 2 and 3 compared to week 1. The results suggested that the trichothecene mycotoxins have a relevant DNA damaging effect.
Keywords:
LORD-Q PCR; DNA damage; trichothecene mycotoxin; Common carp
Key Contribution: This study is the first about DNA lesion quantification in common carp hepatopancreas samples in vivo, measured by LORD-Q PCR.

1. Introduction

Food and feed can be contaminated with different types and amounts of mycotoxins, and they have various damaging effects [1]. T-2 toxin belongs to the group of type A trichothecenes that are produced by the phytopathogenic Fusarium moulds (i.e., Fusarium sporotrichioides, F. poae). It is known that T-2 toxin is the most toxic among the type A toxins (in vivo and in vitro, too) because of the trichothecene structure (epoxy sesquiterpenoid moiety) [2,3]. Deoxynivalenol (DON), as a member of the type B trichothecene group, is the most prevalent mycotoxin in cereal grains worldwide [2,3,4,5].
Cereals are increasingly used for fish feed production because of the growing in-tensification of aquaculture, the rising utilization of artificial feed and the replacement of fishmeal; therefore the risk of mycotoxin contamination has increased [6,7]. Common carp (Cyprinus carpio L.) is one of the most important omnivorous species in freshwater aquaculture, although limited information is available about the effect of T-2 or DON mycotoxins in this species, especially about the DNA damaging effect [6,8]. Long-term treatment with 2.45 mg T-2 kg−1 induced the activity of glutathione redox system in Common carp. The amount of glutathione (GSH) and glutathione peroxidase (GSHPx) were significantly increased on the 7th, 21st and 28th days. The growth rate was reduced but the concentration of the malondialdehyde (MDA) did not change [9]. During a four-week trial, Matejova et al. [6] did not observe mRNA expression changes on stress, detoxification or DNA damage influenced CYP2F2, CYP450, catalase, and HSP60 and HSP70 genes in carp. Although the lipid peroxidation was enhanced, the activity of glutathione S-transferase (GST) was significantly increased by 5.3 mg toxin kg−1. Pelyhe et al. [10] showed that a 4.11 mg T-2 kg−1 dose has an effect on the expression of gpx4 genes in Common carp. gpx4b gene expression was upregulated on days 7, 14 and 21, while gpx4a was downregulated on days 14 and then upregulated on day 21. Considering DON, results of Pietsch et al. [11] showed that 352 μg DON kg−1 raised the catalase concentration and cytotoxicity in Common carp. DON caused damage and apoptosis in liver cells through lipid peroxidation and increased the MDA concentration in the kidney in a dose-dependent way [12]. Elevation of GSH amount was observed on days 7 and 28 at the concentration of 5.96 mg DON kg−1 [10]. The expression of the gpx4b gene was significantly upregulated on days 7, 14, 21 and 28. Comet assay analyses revealed that a significant increase in DNA damage (% tail DNA) occurred by aflatoxin B1 (4 mg/kg, 6 mg/kg) in Common carp [13].
The growing importance of genotoxicity testing and research of caused genetic dys-functions in different diseases requires new and trustful methods for the detection of amino acid injuries [14]. The most widely used methods can detect DNA damage in a global and sequence-independent way, such as the comet assay (single-cell gel electrophoresis), Halo assay or flow cytometry. However, these methods detect only one or a few types of DNA lesions [15]. If the nucleotide modifications disorder or inhibit the DNA polymerase, the DNA-synthesis-based methods can be used for the detection. The PCR-based methods represent more modern and adequate techniques for measuring DNA damage. LORD-Q PCR (Long-run Real-time DNA Damage Quantification PCR) is a highly efficent technique based on the principle that different DNA lesions halt the DNA replication and reduce the amount of PCR product [16]. It is a fast and quantitative analytical method that has many advantages. DNA damage can be measured on long DNA templates (3–4 kb) with a highly sensitive and sequence-specific manner (because this assay is primer-based) and allows the analysis of mitochondrial and nuclear genome [14,16] as well. LORD-Q PCR requires optimization to maximize the efficiency and the specificity of PCR, to get a robust, easy-to-control and high-throughput DNA damage quantification method [17].
Endogenous (i.e., normal cellular metabolism) and exogenous (i.e., genotoxic chemicals, mycotoxins, radiation) agents can cause different DNA modifications in living cells, such as oxidation products, dimers, and single or double-strand breaks [1]. The cell ap-plies numerous mechanisms to repair DNA damages so the integrity of nuclear and mitochondrial DNA can be maintained. If the damage recognition or the repair fails, the accumulation of DNA lesions occurs. The mitochondrial DNA (mtDNA) is susceptible to mutations, mainly because of the mitochondrial production of reactive oxygen species (ROS), which can cause oxidative lesions in the mtDNA. In the case of the mitochondria, the DNA repair capacity is lower than the capacity of the nucleus, and the copy number of mtDNA is much higher [16,18]. These make it more suitable for testing the DNA damage effects.
In the present study, we describe the changes in the DNA damaging effect of T-2 and DON mycotoxins in a 3-week experimental period in Common carp (Cyprinus carpio L.) For this purpose, a new LORD-Q PCR assay was optimized to detect and calculate the number of DNA lesions in mtDNA in vivo. In conclusion, LORD-Q PCR assay is a sensitive, suitable and robust technique to detect sequence-specific DNA damage. DON and T-2 mycotoxins can trigger DNA lesions in a three-week-long period.

2. Results

2.1. Validation of the LORD-Q PCR Assay in Common Carp Species

In order to adapt and develop the LORD-Q PCR quantification method for the common carp species, four precast qPCR mix and components such as DNA polymerases (e.g., RANGER DNA Polymerase, Bioline, London, England or DreamTaq, Fermentase (Waltham, MA, USA)) with different DNA-intercalating dyes (e.g., EvaGreen, Biotium (Fremont, CA, USA), SYBR Green, Roche Molecular Biochemicals, Basel, Switzerland)) and additives (e.g., DMSO, ROX, Sigma, Burlington, MA, USA) were tested (data not shown). Finally, the 5× Hot FirePol® EvaGreen® qPCR Supermix (Solis Biodyne, Tartu, Estonia) reaction mixture was chosen based on test PCR reaction because the preheat incubation of the used Hot FirePol® DNA polymerase inhibits the extension of non-specifically annealed primers and primer-dimers [19]. Seven long and five short primer pair candidates with different amplicon sizes (3401–6876; 88–242) and different template concentrations (0.5–50 ng) were tested according to PCR specificity and efficiencies. The optimal primer pairs were the F2-R4.F with F2-R4.R for short (156 bp amplicon) and F3-R2.F with F3-R2.R for long (3436 bp amplicon) (Table 3). The gel electrophoresis (Figure 1) and melt curve analysis (Figure 2) did not detect unspecific products.

2.2. Mortality and Disorder Results

During the three-week feeding period, elevated mortalities were detected in the DON or T-2 contaminated diets compared to the control group. A high mortality rate was observed in the T-2 group, while the DON group had a lower rate as shown in Table 1. Fish necropsy did not reveal any specific disorder or symptoms; however, all specimen showed moderate liver necrosis and intestine inflammation.

2.3. Lesion Rates by LORD-Q PCR Assay

The LORD-Q analysis revealed that the DNA damage is not constant (Table 2). In the case of both the T-2 and the DON mycotoxins, mitochondrial DNA damage decreased over time. The average lesion value of the first week was significantly different from the second (p = 0.019) and third (p = 0.017) weeks in the T-2 mycotoxin experiment, while the change was not significant between weeks 2 and 3 in DNA damage (p = 0.937).
The decreasing tendency was slightly different at DON. The average lesion value significantly differed between the first and third weeks (p = 0.025), but the decreases were not significant, neither between the first and second (p = 0.476) nor between the second and third weeks (p = 0.191) during the DON treatment.
The T-2 and DON mycotoxin-treated groups significantly differed from each other and from the control group in week 1 (p = 0.026) and week 2 (p = 0.008); this difference was eliminated in week 3 between the mycotoxin groups (p = 0.767) and between the treated and the untreated groups.

3. Discussion

DNA damage is continuously generated by different endogenous and exogenous agents and their metabolites [20]. It is important to be aware of the level of DNA damage and their evolution over time to understand the molecular effects, the mechanism of action and key elements of the process in many agents to connect the knowledge about oxidative stress, DNA structure changes, repair mechanisms and carcinogenesis.
Until now, many methods were developed to measure the level of DNA damages, as comet assay [13], repair assisted damage detection [21], Southern blot analysis [22], high-performance liquid chromatography (HPLC) [23], halo assay [24], and flow and imagecytometry [25]. Nevertheless, the sensitivity of the commonly used and conventional assays is low and measures the DNA damage in a global and sequence-independent way. Another problem is that the results of these methods are not comparable because different assays determine different parameters of DNA damage [15]. All these techniques require huge processing time and/or high amounts of genomic DNA samples. The development or adaptation of a method to quantify the locus-specific DNA damage can help to understand the molecular mechanisms caused by endogenous or exogenous agents. These problems are solved by LORD-Q PCR assay [17,26]. However, it is necessary to adapt this method for all species to produce comparable results.
We successfully adapted the LORD-Q PCR assay for measuring mtDNA damage caused by T-2 or DON mycotoxin in the Common carp species. The sensitivity of the presented LORD-Q PCR is similar to the semi-long run real-time PCR (SLR PCR) [18]. Zhu and Coffmann [18] reported that longer amplicons are more sensitive to low levels of DNA damage, and LORD-Q PCR uses a longer amplicon, in contrast to the SLR PCR. Moreover, Ref. [14] proved that LORD-Q PCR is more sensitive and effective than SLR PCR and comet assay. Even sublethal DNA damage lesion rate caused by concentrations of exogenous agents can be measured. DNA damages (lesions) of mtDNA are caused by a wide range of diseases, drugs and agents [14,27] because of the high copy number, the maternal inheritance and the role of mtDNA (e.g., redox homeostasis, energy metabolism), which is a common and frequently used target in toxicology and ecotoxicology. Considering all this and the assumption of lower or moderate DNA damage effects of the analyzed toxins doses, LORD-Q PCR is a well-founded choice [14].
The toxic effects of different mycotoxins are influenced by sex, age, species, dose and exposition time [28,29,30]. Aflatoxins are less toxic to brine shrimp larvae than trichothecenes. Although DON, nivalenol and 3-acetyl-DON are less toxic than HT-2 toxin, DAS and T-2 mycotoxin [31]. Many studies demonstrated that the acute toxicity of DON is lower than T-2 mycotoxin [29,32,33]. An opposite trend was observed in this long-term study because DON generated higher DNA lesion rates every week than T-2 mycotoxin in the hepatopancreas. The liver is responsible for the detoxification of mycotoxins (DON and T-2 mycotoxins); in this context, previous studies described the histological, morphological, or molecular changes in this organ [34]. Rainbow trout (Oncorhynchus mykiss) is one of the most sensitive species to the exposure of DON mycotoxin; on the other hand, Common carp is also a frequently used toxicology species to screen genotoxic effects by different methods (e.g., fish micronucleus test) [9,31].
Oxidative stress is one of the main reasons for DNA damage. The increased production of ROS (reactive oxygen species) leads to oxidatively induced DNA damage in cells [35,36]. Correlations were found between oxidative stress biomarkers (lipidperoxidation parameters such as MDA, glutathione peroxidase, superoxide dismutase and antioxidant capacity) and DNA damage level [37]. T-2 toxin treatment (0.1, 0.15, 0.2 and 0.3 µmol/L) significantly increased the amount of ROS in zebrafish embryos at 24 h [38]. Oxidative stress, as an effect of trichothecenes, was demonstrated during a long-term (4 weeks) feeding trial of T-2 and HT-2 toxins in Common carps. Ref. [9] observed the elevation of reactive oxygen metabolite concentration in the T-2 (2.45 mg kg−1 feed) + HT-2 (0.52 mg kg−1 feed) treated groups during the first and second weeks. GSH concentration and GSHPx activity decreased compared to the control group only at the second week. MDA concentration was significantly reduced at the third week. Therefore, the antioxidant system was able to eliminate the harmful effect of T-2 toxin in Common carp liver. These trends were confirmed by our study with higher mycotoxin concentration. The DNA lesion rate significantly decreased at the second and third weeks compared to the first week in the T-2 toxin-treated group. However, Ref. [6] represented a controversial finding by investigating oxidative stress indicator and detoxifying enzymes. In that study, after a four-week-long trial, catalase, GST and TBARS parameters were enhanced significantly; however, the used toxin concentration was higher (5.34 mg T-2 kg−1 feed) than in this experiment (4.11 mg T-2 kg−1 feed).
This study found that the DNA lesion rate was significantly higher in the DON treated group in the first and second weeks compared to the T-2 mycotoxin-contaminated groups. MDA as a main oxidative stress marker can indicate the presence of stress, which could be one of the reasons for DNA damage. Ref. [12] demonstrated that MDA value was significantly increased by DON treatment at the concentration of 953 µg kg−1 after four weeks, but a lower concentration (352 µg kg−1, 619 µg kg−1) was not different from the control group. At a lower DON concentration (5.96 mg kg−1), the DNA lesion rate significantly declined in the third week in the present study. With the same toxin concentration as in this experiment, Ref. [10] did not find effects on the MDA and GST values during the four weeks; on the other hand, a significant amount of DNA lesions can arise, as measured in this long-term trial. In our study, the presented mycotoxins (T-2 mycotoxin 5-fold, DON 3-fold) caused high mortality, and Ref. [10] found the same trend. The mortality may be related to liver necrosis and the inflammatory effect of T-2 or DON, but these mycotoxins can inhibit the DNA and protein synthesis too.
In conclusion, this study demonstrated a sensitive and suitable PCR method (LORD-Q PCR) for DNA damage quantification in Common carp hepatopancreas samples in vivo. This technique is a valuable, cost-effective and robust tool to detect sequence-specific DNA damage effects [14,16] and therefore allows valuable application in the field of toxicology and ecotoxicology. T-2 and DON mycotoxins triggered DNA lesions. However, DON induced significantly more lesions in the first and second weeks than T-2 toxin. Trichothecenes, especially DON, are a common contaminant of grain, feed and food [29], and little is known about the ecotoxicological impact and consequence of these mycotoxins; hence, further investigations are needed.

4. Materials and Methods

4.1. Mycotoxin Production and Analysis

T-2 toxin was produced by Fusarium sporotrichioides (NRRL 3299) and DON by Fusarium graminearum (NRRL 5883) strains on corn substrate by the methods of [39]. T-2 and HT-2 content of feed was measured based on the method of [40], and DON and 15-acetyl DON concentration was determined by HPLC after immunoaffinity cleanup according to the method of [41].

4.2. Animal and Experimental Design

One-year-old Szarvasi P34 hybrid Common carps (Cyprinus carpio L.) (n = 108) were obtained from a commercial fish farm (ÖKO 2000 Ltd., Akasztó, Hungary). After one week of acclimatization, carps were sorted randomly into control and two experimental groups (T-2 and DON) into six aquaria (150 L each). Each of six aquariums was used in a semi-static system with dechlorinated (water was aerated for at least 1 day before use, and then the aeration was continuous) tap water. The water change ratio was 50% on every second day. The light regimen was 12:12 h light/dark period, and the water temperature was 18 ± 1 °C. The dissolved oxygen concentration was 8 ± 1.1 mg L−1, the pH was between 7.2 and 7.5 and the average total ammonia level was 0.2 ± 0.03 mg L−1 during the experiment. These parameters were continuously inspected: temperature, daily with laboratory thermometer (±0.1 °C); pH and dissolved oxygen with HACH HQ30d Portable Multi-Parameter Meter and total ammonia level with HANNA HI 83203 Multiparameter Photometer. The bodyweight of carps was 23.26 ± 6.86 g at the start of the experiment. The animals were fed with extruded, slowly sinking growth feed for carp (GARANT Aqua Classic™, Garant-Tiernahrung GmbH, Pechlor, The Republic of Austria). The nutrient content (on dry matter basis) of the diet was 51.5% nitrogen-free extract, 30% crude protein, 7.5% crude ash, 7% crude fat and 5% crude fiber. Mycotoxin-containing fungal culture was dissolved in 50 mL ethanol for T-2 toxin and in 150 mL water for DON and sprayed over 3 kg of complete pelleted feed. The forage was kept at 50 °C overnight to eliminate the ethanol or the water content. The control diet was sham-treated with 25 mL ethanol and 75 mL water and prepared than the two mycotoxin treated diets. The control diet had <0.02 mg kg−1 T-2, <0.02 mg kg−1 HT-2, <0.02 mg kg−1 DON and <0.02 mg kg−1 15-acetyl DON mycotoxin concentrations. The first experimental diet contained 4.11 mg T-2 kg−1 + 0.49 mg HT-2 kg−1 and the second 5.96 mg DON kg−1 + 0.33 mg 15-acetyl DON kg−1. The carps were fed two times a day (at 8 a.m. and 4 p.m.) with two equal portions. The feeding intensity was 1% of the bodyweight, which was determined weekly. The mortality was recorded every day at the same time. The feeding experiment was lasted for 3 weeks.

4.3. Sampling and DNS Isolation

Six randomly chosen carps were weighed and exterminated from the three groups weekly. All fish were over-anaesthetized with clove oil (Syzygium aromaticum) and decapitated before the sample collection. Hepatopancreas samples were taken into 1.5 mL collection tubes, frozen in liquid nitrogen immediately and stored at −80 °C until DNA isolation. Total DNA was purified using MagAttract® HMW DNA Kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer’s protocol. The DNA quantity and quality of the samples were verified by agarose gel electrophoresis and by NanoPhotometer (Implen GmbH, Munich, Germany) measurements. The isolated DNA showed a high purity (A260/A280 > 1.8) and was stored at −20 °C.

4.4. LORD-Q PCR Assay

The LORD-Q PCR for DNA damage quantification was carried out in a StepOnePlus™ Real Time PCR System (Thermo Fisher Scientific, San Jose, CA, USA) in low-profile, clear PCR tubes and caps (Axygen, New York, NY, USA). The PCR conditions for the different primers and fragments were optimized to get specific products, which were verified by melting curve analysis (StepOne™/StepOnePlus™ Software v 2.2) and agarose gel electrophoresis (Figure 1). The PCR amplification was monitored by real-time measurement of the intercalation of the fluorescent dye EvaGreen into the double-stranded DNA. The PCR reaction mix consisted of 5× Hot FirePol® EvaGreen® qPCR Supermix reaction mixture (Solis BioDyne, Tartu, Estonia), 3.3 pM/µL primers (specific for the short or the long fragment) and 10 ng of template DNA in a total volume of 10 µL per well. All primers for the PCR assay were designed by Primer3Plus [42] based on the reference sequence of Cyprinus carpio mithocondrial genome (Access no.: NC_001606). The primers were synthesized and purified by Integrated DNA Technologies (Leuven, Belgium). The sequences of the most optimal primers are shown in Table 3. The cycling conditions were as follows: a pre-incubation phase of 95 °C for 12 min was followed by 40 cycles of 10 s at 94 °C, 20 s at 59 °C, and 30 s at 72 °C (small fragment) or 4 min at 72 °C (large fragment). Each sample was assayed in quadruplicate. Five dilution points were used to obtain the PCR efficiency.

4.5. Data Analysis

Data analysis was based on the measurement of the cycle threshold (Ct) by the StepOne™/StepOnePlus™ Software v 2.2. The average Ct value from quadruplicate PCR was used. The difference between long and small fragments was calculated by ΔCt (control versus each treated condition). The DNA damage was calculated for lesion per 10 kb DNA by including the size of the long fragment as described by [17].
Lesion rate (Lesion per 10 kb DNA) = (1 – 2 − (Δlong − Δshort)) × (10,000 (bp))/(size of long fragment (bp))
The statistical analysis was carried out using the R software package [43]. The normal distribution of the groups was checked by Shapiro–Wilk test. The different groups were compared with one-way ANOVA tests followed by Tukey post hoc test, with p ≤ 0.05 level of significance.

Author Contributions

Conceptualization, K.M.B. and B.K.; methodology, R.T.S.; validation, R.T.S.; formal analysis, R.T.S.; investigation, R.T.S.; resources, K.M.B. and M.K.-W.; data curation, R.T.S.; writing—original draft preparation, R.T.S.; writing—review and editing, M.M., M.K.-W. and B.K.; visualization, R.T.S.; supervision, M.M. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the EFOP-3.6.3-VEKOP-16-2017-00008 project and the Higher Education Institutional Excellence Program FEKUT2019: TUDFO/47138/2019-ITM awarded by the Ministry of Human Capacities.

Institutional Review Board Statement

The experimental protocol was authorized by the Department of Food Chain Safety, Land Register, Plant and Soil Protection and Forestry of the Pest County Government Office (Hungary) with a permission number PE/EA/1964-7/2017, approved on 7 December 2017.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author (Mária Kovács-Weber).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Escrivá, L.; Font, G.; Manyes, L. In vivo toxicity studies of fusarium mycotoxins in the last decade: A review. Food Chem. Toxicol. 2015, 78, 185–206. [Google Scholar] [CrossRef] [PubMed]
  2. Bennett, J.W.; Klich, M. Mycotoxins. Clin. Microbiol. Rev. 2003, 16, 497–516. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. McCormick, S.P.; Stanley, A.M.; Stover, N.A.; Alexander, N.J. Trichothecenes: From simple to complex mycotoxins. Toxins 2011, 3, 802–814. [Google Scholar] [CrossRef] [PubMed]
  4. Eriksen, G.; Pettersson, H. Toxicological evaluation of trichothecenes in animal feed. Anim. Feed Sci. Technol. 2004, 114, 205–239. [Google Scholar] [CrossRef]
  5. Rodrigues, I.; Naehrer, K. Prevalence of mycotoxins in feedstuffs and feed surveyed worldwide in 2009 and 2010. Phytopathol. Mediterr. 2012, 51, 175–192. [Google Scholar]
  6. Matejova, I.; Faldyna, M.; Modra, H.; Blahova, J.; Palikova, M.; Markova, Z.; Franc, A.; Vicenova, M.; Vojtek, L.; Bartonkova, J.; et al. Effect of T-2 toxin-contaminated diet on common carp (Cyprinus carpio L.). Fish Shellfish Immunol. 2017, 60, 458–465. [Google Scholar] [CrossRef] [PubMed]
  7. Pietsch, C.; Kersten, S.; Burkhardt-Holm, P.; Valenta, H.; Dänick, S. Occurrence of Deoxynivalenol and Zearalenone in Commercial Fish Feed: An Initial Study. Toxins 2013, 5, 184–192. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  8. Yang, L.; Ti, D.; Wang, N.; Deng, Z.; Zhan, Y.; Liu, W.; Hu, Y.; Liu, T.; Tan, L.; Li, Y.; et al. The protective effect of DL-Selenomethionine against T-2/HT-2 toxins-induced cytotoxicity and oxidative stress in broiler hepatocytes. Toxicol. In Vitro 2019, 54, 137–146. [Google Scholar] [CrossRef]
  9. Balogh, K.; Heincinger, M.; Fodor, J.; Mézes, M. Effect of long term feeding of T-2 and HT-2 toxin contaminated diet on the glutathione redox status and lipid peroxidation processes in common carp (Cyprinus carpio L.). Acta Biol. Szeged 2009, 53, 23–27. [Google Scholar] [CrossRef]
  10. Pelyhe, C.S.; Kövesi, B.; Zándoki, E.; Kovács, B.; Szabó-Fodor, J.; Mézes, M. Effect of 4-week feeding of deoxynivalenol or T-2-toxin-contaminated diet on lipid peroxidation and glutathione redox system in the hepatopancreas of common carp (Cyprinus carpio L.). Mycotoxin Res. 2016, 32, 77–83. [Google Scholar] [CrossRef]
  11. Pietsch, C.; Michel, C.; Kersten, S.; Valenta, H.; Dänick, S.; Schulz, C.; Kloas, W.; Burkhardt-Holm, P. In vivo effects of deoxynivalenol (DON) on innate immune responses of carp (Cyprinus carpio L.). Food Chem. Toxicol. 2014, 68, 44–52. [Google Scholar] [CrossRef]
  12. Pietsch, C.; Schulz, C.; Rovira, P.; Kloas, W.; Burkhardt-Holm, P. Organ damage and hepatic lipid accumulation in carp (Cyprinus carpio L.) after feed-borne exposure to the mycotoxin, deoxynivalenol (DON). Toxins 2014, 6, 756–778. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Al-Faragi, J.K. The Efficacy of Prebiotic (β-Glucan) as a Feed Additive against Toxicity of Aflatoxin B1 in Common Carp, Cyprinus Carpio L. J. Aquac. Res. Dev. 2014, 5, 240. [Google Scholar] [CrossRef] [Green Version]
  14. Lehle, S.; Hildebrand, D.G.; Merz, B.; Malak, P.N.; Becker, M.S.; Schmezer, P.; Essmann, F.; Schulze-Osthoff, K.; Rothfuss, O. LORD-Q: A long-run real-time PCR-based DNA-damage quantification method for nuclear and mitochondrial genome analysis. Nucleic Acids Res. 2013, 42, 1–12. [Google Scholar] [CrossRef] [Green Version]
  15. Wagener, S.; Volker, T.; De Spirt, S.; Ernst, H.; Stahl, W. 3,3′-Dihydroxyisorenieratene and isorenieratene prevent UV-induced DNA damage in human skin fibroblasts. Free Radic. Biol. Med. 2012, 53, 457–463. [Google Scholar] [CrossRef] [PubMed]
  16. Dannenmann, B.; Lehle, S.; Lorscheid, S.; Huber, S.M.; Essmann, F.; Schulz-Osthoff, K. Simultaneous quantification of DNA-damage and mitochondrial copy number by Long-run DNA-damage quantification (LORD-Q). Oncotarget 2017, 8, 112417–112425. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  17. Rothfuss, O.; Gasser, T.; Patenge, N. Analysis of differential DNA damage in the mitochondrial genome employing a semi-long run real-time PCR approach. Nucleic Acids Res. 2010, 38, e24. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  18. Zhu, S.; Coffmann, J.A. Simple and fast quantification of DNA damage by real-time PCR, and its application to nuclear and mitochondrial DNA from multiple tissues of aging zebrafish. BMC Res. Notes 2017, 10, 269. [Google Scholar] [CrossRef] [Green Version]
  19. Kainz, P.; Schmiedlechner, A.; Strack, H.B. Specificity-Enhanced Hot-Start PCR: Addition of Double-Stranded DNA Fragments Adapted to the Annealing Temperature. Biotechniques 2018, 28, 2. [Google Scholar] [CrossRef] [Green Version]
  20. Tubbs, A.; Nussenzweig, A. Endogenous DNA damage as a source of genomic instability in cancer. Cell 2017, 168, 644–656. [Google Scholar] [CrossRef] [Green Version]
  21. Holton, N.W.; Ebenstein, Y.; Gassman, N.R. Broad spectrum detection of DNA damage by Repair Assisted Damage Detection (RADD). DNA Repair 2018, 66–67, 42–49. [Google Scholar] [CrossRef] [PubMed]
  22. Anson, R.M.; Mason, P.A.; Bohr, V.A. Gene-specific and mitochondrial repair of oxidative DNA damage. Methods Mol. Biol. 2006, 314, 155–181. [Google Scholar] [CrossRef] [PubMed]
  23. Chen, R.; Hou, R.; Hong, X.; Yan, S.; Zha, J. Organophosphate flame retardants (OPFRs) induce genotoxicity in vivo: A survey on apoptosis, DNA methylation, DNA oxidative damage, liver metabolites, and transcriptomics. Environ. Int. 2019, 130, 104914. [Google Scholar] [CrossRef] [PubMed]
  24. Mondal, N.K.; Bhattacharya, P.; Ray, M.R. Assessment of DNA damage by comet assay and fast halo assay in buccal epithelial cells of Indian women chronically exposed to biomass smoke. Int. J. Hyg. Environ. Health 2011, 214, 311–318. [Google Scholar] [CrossRef]
  25. Mathew, S.T.; Johansson, P.; Gao, Y.; Fasth, A.; Ek, T.; Hammarsten, O. A flow cytometry assay that measures cellular sensitivity to DNA-damaging agents, customized for clinical routine laboratories. Clin. Biochem. 2016, 49, 566–572. [Google Scholar] [CrossRef] [PubMed]
  26. Didenko, V.V. (Ed.) DNA Damage Detection In Situ, Ex Vivo, and In Vitro; Springer Protocols, Methods in Molecular Biology; Humna Press: New York, NY, USA, 2011. [Google Scholar]
  27. Edwards, J.G. Quantification of mitochondrial DNA (mtDNA) damage and error rates by real-time QPCR. Mitochondrion 2009, 9, 31–35. [Google Scholar] [CrossRef] [Green Version]
  28. Moss, M.O. Mycotoxin review—1. Aspergillus and Penicillium. Mycologist 2002, 16, 116–119. [Google Scholar] [CrossRef]
  29. Li, Y.; Wang, Z.; Beier, R.C.; Shen, J.; Smet, D.D.; De Saeger, S.; Zhang, S. T-2 Toxin, a Trichothecene Mycotoxin: Review of Toxicity, Metabolism, and Analytical Methods. J. Agric. Food Chem. 2011, 59, 3441–3453. [Google Scholar] [CrossRef]
  30. Anater, A.; Manyes, L.; Meca, G.; Ferrer, E.; Bittencourt, L.F.; Pimpão, C.T.; Font, G. Mycotoxins and their consequences in aquaculture: A review. Aquaculture 2016, 451, 1–10. [Google Scholar] [CrossRef]
  31. Panigrahi, S. Bioassay of mycotoxins using terrestrial and aquatic, animal and plant species. Food Chem. Toxicol. 1993, 31, 767–790. [Google Scholar] [CrossRef]
  32. Sobrova, P.; Adam, V.; Vasatkova, A.; Beklova, M.; Zeman, L.; Kizek, R. Deoxynivalenol and its toxicity. Interdiscip. Toxicol. 2010, 3, 94–99. [Google Scholar] [CrossRef]
  33. Mostrom, M. Trichothecenes and zearalenone. In Reproductive and Developmental Toxicology; Gupta, R.C., Ed.; Academic Press: Cambridge, MA, USA, 2011; pp. 753–763. [Google Scholar] [CrossRef]
  34. Li, P.; Su, R.; Yin, R.; Lai, D.; Wang, M.; Liu, Y.; Zhou, L. Detoxification of mycotoxins through biotransformation. Toxins 2020, 12, 121. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Dizdaroglu, M. Oxidatively induced DNA damage: Mechanisms, repair and disease. Cancer Lett. 2012, 327, 26–47. [Google Scholar] [CrossRef] [PubMed]
  36. Jena, N.R. DNA damage by reactive species: Mechanisms, mutation and repair. J. Biosci. 2012, 37, 503–517. [Google Scholar] [CrossRef] [PubMed]
  37. García-Medinan, S.; Núñez-Betancourt, J.A.; García-Medina, A.L.; Galar-Martínez, L.; Neri-Cruz, N.; Islas-Flores, H.; Gómez-Oliván, L.M. The relationship of cytotoxic and genotoxic damage with blood aluminum levels and oxidative stress induced by this metal in common carp (Cyprinus carpio) erythrocytes. Ecotoxicol. Environ. Saf. 2013, 96, 191–197. [Google Scholar] [CrossRef]
  38. Yang, L.; Tu, D.; Zhai, Z.; Cui, J. Cytotoxicity and apoptosis induced by mixed mycotoxins (T-2 and HT-2 toxin) on primary hepatocytes of broilers in vitro. Toxicon 2017, 129, 1–10. [Google Scholar] [CrossRef]
  39. Fodor, J.; Németh, M.; Kametler, L.; Pósa, R.; Kovács, M.; Horn, P. Novel methods of Fusarium toxins’ production for toxicological experiments. Acta Agrar. Kaposváriensis 2006, 10, 277–285. [Google Scholar]
  40. Pussemier, L.; Piérard, J.Y.; Anselme, M.; Tangni, E.K.; Motte, J.C.; Larondelle, Y. Development and application of analytical methods for the determination of mycotoxins in organic and conventional wheat. Food Addit. Contam. 2006, 23, 1208–1218. [Google Scholar] [CrossRef]
  41. Trebstein, A.; Seefelder, W.; Lauber, U.; Humpf, H.U. Determination of T-2 and HT-2 toxins in cereals including oats after immunoaffinity cleanup by liquid chromatography and fluorescence detection. J. Agric. Food Chem. 2008, 56, 4968–4975. [Google Scholar] [CrossRef]
  42. Untergasser, A.; Nijveen, H.; Rao, X.; Bisseling, T.; Geurts, R.; Leunissen, J.A. Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Res. 2007, 35, W71–W74. [Google Scholar] [CrossRef] [Green Version]
  43. R Core Team R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2013; Available online: http://www.R-project.org/ (accessed on 26 July 2013).
Toxins 13 00576 g001 550
Figure 1. Specificity of the short (a) and long (b) fragments by agarose gel electrophoresis. Agarose gel (1.5%) electrophoresis of real-time PCR products with ethidium bromide staining; template DNS is 10 ng of template. (a) aAmplified products of the short fragment, the expected product size was 150 bp. Loading well 1–2 from T-2, loading well 3–4 from DON treated group (week 3). Loading well 5 is the negative control sample, loading well 6 is the size marker (GeneRulerTM 100 bp DNA ladder). (b) Amplified products of the long fragment, the expected product size was 3400 bp. Loading well 1 is the size marker (GeneRuler TM 100 bp DNA ladder). Loading well 2–3 is from T-2, loading well 4–5 is from the DON treated group. Loading well 6 is the negative control sample.
Figure 1. Specificity of the short (a) and long (b) fragments by agarose gel electrophoresis. Agarose gel (1.5%) electrophoresis of real-time PCR products with ethidium bromide staining; template DNS is 10 ng of template. (a) aAmplified products of the short fragment, the expected product size was 150 bp. Loading well 1–2 from T-2, loading well 3–4 from DON treated group (week 3). Loading well 5 is the negative control sample, loading well 6 is the size marker (GeneRulerTM 100 bp DNA ladder). (b) Amplified products of the long fragment, the expected product size was 3400 bp. Loading well 1 is the size marker (GeneRuler TM 100 bp DNA ladder). Loading well 2–3 is from T-2, loading well 4–5 is from the DON treated group. Loading well 6 is the negative control sample.
Toxins 13 00576 g001
Toxins 13 00576 g002a 550Toxins 13 00576 g002b 550
Figure 2. Amplification plot and melt curve of the short (a) and long (b) fragments by StepOne™/StepOnePlus™ Software (a) amplification plot, (b) melt curve of short fragment: two samples from T-2 group (2 blue line), two samples from the DON group (purple, pink line), one control sample (red, yellow, two green line) in the quadruplicate from week 3. The negative control is the magenta line. (c) Amplification plot of the long fragment: one control (yellow, two green, red) and one treated (two purple, two blue) samples in quadruplicate. (d) Melt curve of the long fragment: two samples from T-2 group (2 blue line), two samples from DON group (magenta, pink line), one control sample (red, yellow, two green line) in quadruplicate from week 3. The negative control is the purple line.
Figure 2. Amplification plot and melt curve of the short (a) and long (b) fragments by StepOne™/StepOnePlus™ Software (a) amplification plot, (b) melt curve of short fragment: two samples from T-2 group (2 blue line), two samples from the DON group (purple, pink line), one control sample (red, yellow, two green line) in the quadruplicate from week 3. The negative control is the magenta line. (c) Amplification plot of the long fragment: one control (yellow, two green, red) and one treated (two purple, two blue) samples in quadruplicate. (d) Melt curve of the long fragment: two samples from T-2 group (2 blue line), two samples from DON group (magenta, pink line), one control sample (red, yellow, two green line) in quadruplicate from week 3. The negative control is the purple line.
Toxins 13 00576 g002aToxins 13 00576 g002b
Table
Table 1. Mortality-increasing effect of mycotoxins in the experimental groups during the trial (dead specimens/week).
Table 1. Mortality-increasing effect of mycotoxins in the experimental groups during the trial (dead specimens/week).
ControlDONT-2
Week 1011
Week 2033
Week 3244
Mortality rate %5.516.727.8
Liver necrosis0%100%100%
Intestine inflammation0%100%100%
Table
Table 2. The fold range of DNA lesions at groups treated with different mycotoxins compared to the control during the trial time by LORD-Q PCR.
Table 2. The fold range of DNA lesions at groups treated with different mycotoxins compared to the control during the trial time by LORD-Q PCR.
WeekControlT-2DON
MeanMeanS.D.MeanS.D.
1.0 A1.33 bB0.221.87 bC0.42
2.0 A0.74 aB0.061.47 abC0.43
3.0 A0.68 aA0.050.82 aA0.27
a,b: different superscript letters show significant differences (p ≤ 0.05) between weeks in T-2 or in DON groups by Tukey test. A,B,C: different superscript letters show significant differences (p ≤ 0.05) between groups in the same week by Tukey test.
Table
Table 3. Primers and their PCR parameter.
Table 3. Primers and their PCR parameter.
Primer NameSequence (5′ to 3′)Amplicon Size (bp)Position on the mt Genome (bp)PCR Efficiency %R2
F2-R4.RAAGCACGGATCAGACGAACA1565887–6042940.99
F2-R4.FCACGCAGGAGCATCAGTAGA
F3-R2.RTAGGCTGGATAATAGGGTTGC3436647–4082860.98
F3-R2.FCCGTTCAACCTCACCACTTCT
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Szabó, R.T.; Kovács-Weber, M.; Balogh, K.M.; Mézes, M.; Kovács, B. Changes of DNA Damage Effect of T-2 or Deoxynivalenol Toxins during Three Weeks Exposure in Common Carp (Cyprinus carpio L.) Revealed by LORD-Q PCR. Toxins 2021, 13, 576. https://0-doi-org.brum.beds.ac.uk/10.3390/toxins13080576

AMA Style

Szabó RT, Kovács-Weber M, Balogh KM, Mézes M, Kovács B. Changes of DNA Damage Effect of T-2 or Deoxynivalenol Toxins during Three Weeks Exposure in Common Carp (Cyprinus carpio L.) Revealed by LORD-Q PCR. Toxins. 2021; 13(8):576. https://0-doi-org.brum.beds.ac.uk/10.3390/toxins13080576

Chicago/Turabian Style

Szabó, Rubina Tünde, Mária Kovács-Weber, Krisztián Milán Balogh, Miklós Mézes, and Balázs Kovács. 2021. "Changes of DNA Damage Effect of T-2 or Deoxynivalenol Toxins during Three Weeks Exposure in Common Carp (Cyprinus carpio L.) Revealed by LORD-Q PCR" Toxins 13, no. 8: 576. https://0-doi-org.brum.beds.ac.uk/10.3390/toxins13080576

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop