Next Article in Journal
Selective Oxidation of Cinnamyl Alcohol to Cinnamaldehyde over Functionalized Multi-Walled Carbon Nanotubes Supported Silver-Cobalt Nanoparticles
Previous Article in Journal
Heterogeneous Catalysts for the Conversion of Glucose into 5-Hydroxymethyl Furfural
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Catalysts
Volume 11
Issue 7
10.3390/catal11070862
catalysts-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

A Thermophilic GH5 Endoglucanase from Aspergillus fumigatus and Its Synergistic Hydrolysis of Mannan-Containing Polysaccharides

by
Xinxi Gu
1,2,
Haiqiang Lu
2,
Lijuan Zhang
2 and
Xiangchen Meng
1,*
1
Key Laboratory of Dairy Science, Ministry of Education, Northeast Agricultural University, Harbin 150030, China
2
College of Food Science and Technology, Hebei Agricultural University, Baoding 071001, China
*
Author to whom correspondence should be addressed.
Catalysts 2021, 11(7), 862; https://0-doi-org.brum.beds.ac.uk/10.3390/catal11070862
Submission received: 22 June 2021 / Revised: 14 July 2021 / Accepted: 15 July 2021 / Published: 19 July 2021
Browse Figures
Versions Notes

Abstract

:
In this study, we isolated and identified a thermophilic strain of Aspergillus fumigatus from the “Daqu” samples. Transcriptomic analysis of A. fumigatus identified 239 carbohydrate-active enzymes (CAZy)-encoding genes, including 167 glycoside hydrolase (GH)-encoding genes, 58 glycosyltransferase (GT)-encoding genes, 2 polysaccharide lyase (PLs)-encoding genes and 12 carbohydrate esterase (CEs)-encoding genes, which indicates that the strain has a strong potential for application for enzyme production. Furthermore, we also identified a novel endoglucanase gene (AfCel5A), which was expressed in Pichia pastoris and characterized. The novel endoglucanase AfCel5A exhibited the highest hydrolytic activity against CMC-Na and the optimal activity at 80 °C and pH 4.0 and also showed good stability at pH 3.0–11.0 and below 70 °C. The Km and Vmax values of AfCel5 were 0.16 ± 0.05 mg·mL−1 and 7.23 ± 0.33 mol mg−1·min−1, respectively, using CMC-Na as a substrate. Further, the endoglucanase exhibited a high tolerance toward NaCl as well as glucose. In addition, the finding that the endoglucanase AfCel5A in combination with β-mannanse (ManBK) clearly increased the release of total reducing sugars of glucomannan by up to 74% is significant.

1. Introduction

Lignocellulose is the richest renewable source for the industrial production of fuels and chemicals and is comprised of lignin, cellulose and hemicellulose [1,2,3]. However, large tonnages of unexploited lignocellulosic pose a series of environmental problems [4]. Due to lignocellulose’s structural complexity, the complete depolymerization of lignocellulose demands the synergy of a glycoside hydrolase [5]. The endoglucanase EC 3.2.1.4 plays a significant role in lignocellulose hydrolysis, as it can break down lignocellulose into cellobiose and glucose [6]. Commonly, endoglucanases are often known as cellulase, which is widely used in feed additives, pulp and biofuel industries [7,8]. Nowadays, endoglucanases can be isolated from bacteria and fungi, particularly the Trichoderma and Aspergillus spp. [9,10]. As reported, the optimum pH of endoglucanases from fungi is between pH 3.0 and 6.0, and the optimum temperature is in the range of 40–60 °C [11]. However, circumventing the poor tolerance and the low catalytic efficiency of endoglucanases remains a significant research focus.
Thermophilic enzymes have strong thermal stability and high catalytic efficiency, providing a comprehensive prospect in lignocellulosic biomass utilization [12,13]. Thermophiles have been commonly used as thermophilic enzyme producers and have always been obtained from hot springs, deep-sea vent fields and other thermal environments [14,15,16]. However, this is particularly unfavorable and demanding for the researchers. Daqu is a unique saccharogenic and fermentative agent and is considered a good source of thermophilic microorganisms [17,18,19].
As previously mentioned, mannans are the primary hemicellulose components of softwoods [20], and the efficient degradation of mannans is required for many enzymes working synergistically [21]. However, extensive research mainly explores the synergy of β-mannanase, β-mannosidase or α-galactosidase [22]. In addition to the above, other enzymes or proteins should also play a significant role in mannan hydrolysis. Jeon et al. reported that endoglucanase could promote galactomannan degradation [23]. A similar phenomenon has also been found in xylanase and mannanase [24]. However, knowledge about the synergistic effect of thermophilic mannanase and cellulases is scarce.
In this study, AfCel5A, a new thermophilic cellulase from A. fumigatus, was efficiently expressed in P. pastoris and biochemically characterized. The optimum temperature of AfCel5A is 80 °C, and the optimum pH is 4.0. AfCel5A exhibits excellent stability, including pH stability, thermal stability and salt and glucose tolerance. We applied the endoglucanase AfCel5A to enhance mannan hydrolysis by up to 75% with β-mannanase (ManBK). Thus, this work provides an effective strategy for the utilization of lignocellulose resources.

2. Results

2.1. Isolation and Identification of the Thermophilic Fungi

Daqu is a fermenting starter that has commonly been used in Chinese liquor fermentation for hundreds of years. In this study, HBHF5 strain producing higher endoglucanase activity was successfully isolated from a Daqu sample (Figure 1A).
Colonies of strain HBHF grew rapidly at 45 °C as dark blue-green colonies with a floccose-like surface but did not grow at temperatures lower than 19 °C (Figure 1A). Microscopic observation showed a typical broom flask-shaped conidiophore like other Aspergillus species (Figure 1B). The ITS rDNA sequence of the HBHF5 strain showed that its sequence is most closely related to A. fumigatus rDNA sequence with 99% similarity (Figure 1C). In conclusion, strain HBHF5 was identified as A. fumigatus HBHF.

2.2. Transcriptome Analysis of A. fumigatus HBHF

To further explore the gene expression of A. fumigatus HBHF under wheat bran conditions, the transcriptome was analyzed by RNA-Seq and is listed in Table 1. A total of 239 genes could be assigned to different CAZy families based on the CAZy database (http://www.cazy.org, accessed on 26 May 2021). Glycoside hydrolases (GHs) were the largest category in the expressed CAZy genes, accounting for 69.8%, followed by glycosyltransferases (GTs, 24.3%) and carbohydrate esterases (CEs, 5.0%). Finally, polysaccharide lyases (PLs) only accounted for ~0.8% and played a less critical role in the degradation of wheat bran. Further analyses identified these GH genes, including chitinase, cellulase, amylase and mannanase. In summary, this finding further demonstrated that A. fumigatus HBHF5 is a good producer of glycoside hydrolases and is worthy of further evaluation.

2.3. Sequence Analysis, Expression and Purification of AfCel5A

A putative endoglucanase AfCel5A gene (accession No. XP_751043.1) was found in A. fumigatus HBHF5. The full-length gene AfCel5 contained 1397 bp and was interrupted by four introns (84–131, 343–388, 454–512, 611–660) (Figure 2A). The AfCel5 gene contains an open reading frame (ORF) of 1194 bp, encoding a protein of 397 amino acids in length and a signal peptide of 16 amino acids at the N-terminus. The mature protein contains three functional domains: a catalytic domain belonging to the GH5 family (35–327 aa), a CBM1 domain (365–397 aa) and a linker region (328–364 aa) (Figure 2B). The theoretical molecular weight of the mature AfCel5 was 42.6 kDa, and the isoelectric point was 4.89.
Utilizing endoglucanase (PDB:1H1N) as a structural template, the three-dimensional model(3D) of AfCel5A protein was constructed by homology modeling approach (Figure 2C). After validation using Procheck, the final model was found to be of good quality as 91.1% of the total residues fall in the most favored regions. The 3D structure of AfCel5A displays a (βα)8 TIM-barrel fold structure, similar to another endoglucanase of the GH5 family (Figure 2C). Based on the multiple sequence alignment, the result indicated that deduced AfCel5A contained seven highly conserved residues of the GH5 family: Arg72, His116, Asn155, Glu156, His221, Tyr223 and Glu263. Meantime, AfCel5A showed the highest sequence homology of 89.2% to endoglucanase from Aspergillus udagawae (GFF23991.1), 69.9% to that from Talaromyces leycettanus (AYW35863.1) and 58.5% to that from Aspergillus terreus (AAW68436.2). AfCel5A gene was successfully heterologously expressed in P. pastoris GS115 host. We found that the endoglucanase activity can reach 3.74 U·mL−1 after 72 h induction. The culture supernatant was collected, purified and concentrated to apparent homogeneity. AfCel5A has an apparent molecular mass on SDS-PAGE of around 50 kDa (Figure 2D), larger than the inferred 42.6 kDa. N-glycosylation prediction showed that AfCel5A had one unique N-glycosylation site at residues 32–35. However, its treatment with EndoH did not alter the molecular weight to the theoretical value. Further analyses identified many O-glycosylation sites in the Thr/Ser-rich linker domain, which is likely why the molecular weight was higher.

2.4. Characteristics of Recombinant AfCel5A

In general, an enzyme derived from thermophilic microorganisms has a high reaction temperature and excellent stability, which are essential parameters in determining its potential commercial applications. AfCel5A displayed an optimal reaction temperature at 80 °C and still retained more than 30% activity at 90 °C (Figure 3A). Meanwhile, AfCel5 showed a highly stable activity after incubating at 70 °C for 1 h, whereas after 1 h incubation at 75 °C, 70% of the activity remained (Figure 3C). The highest enzyme activity of AfCel5A was observed at pH 4.0 (Figure 3B), while the enzyme was utterly inactive at pH less than 2.0 or higher than 10.0. AfCel5A was also remarkably stable in a wide pH range (pH 2.0 to 12.0) and maintained approximately 90–100% of activity (Figure 3D).
As shown in Table 2, most metal ions had a little inhibitory effect on the AfCel5 activity, with Mn2+ and Ag+ being the exception. Mn2+ showed a promoting effect on endoglucanase activity at low concentrations, while it had the opposite effect at a high concentration. Likewise, the chemical reagent SDS showed a strong inhibitory effect on AfCel5 activity. In addition to this, AfCel5 exhibited an individual tolerance to surfactants and other organic reagents, such as urea, EDTA and acetone.
AfCel5A exhibited distinct features in terms of substrate specificity. The enzyme activity was set at 100% for reactions with 1% CMC-Na as the substrate; AfCel5A displayed higher activity for KGM (129%), followed by guar gum (57%), pectin (31%) and Avicel (27%), and no activity was detected for LBG. The apparent Km and Vmax values of AfCel5A were observed as 0.16 ± 0.05 mg·mL−1 and 7.23 ± 0.33 mol mg−1·min−1, respectively, using CMC-Na as substrate.

2.5. Activity of AfCel5A in a High Concentration of NaCl and Glucose

It is known that cellobiose and glucose are released from cellulose degradation, which is one of the key factors that inhibit the enzymatic hydrolysis of endoglucanase. Therefore, the effect of varying glucose concentrations on AfCel5A activity was assessed (Figure 4A). It was found that AfCel5A well tolerated up to 35 mM glucose without any significant effect on activity. Further, in the presence of more than 35 mM glucose, relative enzyme activity gradually decreases with increasing concentration. On the other hand, AfCel5A displayed an excellent salt tolerance, as more than 80% endoglucanase activity was observed at 3M NaCl (Figure 4B).

2.6. Synergistic Action of AfCel5A and ManBK on Mannan Degradation

It was noted (Table 3) that the addition of AfCel5A significantly enhanced the overall conversion by up to 74%, compared to ManBK alone. AfCel5A had very weak capacities of degrading LBG alone. Sequential and simultaneous enzyme combinations showed a synergistic effect on LBG degradation, increasing the reducing sugar release by up to 1.57-fold.
When enzyme combinations depolymerized KGM, similar results were also found. However, sequential reaction (AfCel5A→ManBK, or ManBK→AfCel5A) was more effective than the simultaneous reaction of AfCel5A and ManBK. At the same time, we also found that the synergistic effect changed with different substrate kinds. The synergy degree of AfCel5A and ManBK was approximately 1.2 when using GG as substrate, while the synergy degree could reach about 1.5 with LBG as substrate and 1.6 with KGM as substrate.

3. Discussion

In the present study, a new A. fumigatus strain HBHF was obtained from a Daqu sample. We identified a total of 239 CAZy-encoding genes were expressed under wheat bran induction. Among these carbohydrate-active enzymes, the GHs accounted for the highest proportion, 69.8%. Similar results were reported by De Gouvêa et al. [25]. The above results further confirmed that strain HBHF is a very promising producer of cellulose-degrading enzymes.
With the completion of 24 genome sequences of A. fumigatus, several CAZy-encoding genes from A. fumigatus have been cloned and characterized, such as β-glucosidase [26], mannanase [27], pectinase and xylanase [28]. In addition to this, endoglucanase is the key enzyme in lignin degradation. There are 25 endoglucanases in the A. fumigatus genome that are distributed in eight chromosomes unevenly [29]. We obtained a novel endoglucanase gene from this strain, which exhibits a difference in amino acid sequence from the characterized endoglucanase, suggesting that endoglucanase AfCel5A may have different properties or specificities.
We successfully performed expression and enzymatic characteristic assays on the AfCel5A gene. It was determined that the maximal production of endoglucanase AfCel5A (3.74 U/mL) was observed 72 h after induction. The optimal pH value of AfCel5A was 4.0, which was close to the most previously reported value for fungal endoglucanase. Meanwhile, it showed relatively higher activity (>30%) under alkaline conditions (pH 7.0–8.0), which is a clear distinction from other thermophilic endoglucanases. For example, the pH value of 8.0 could cause a complete loss of activity of TeEgl5A from Talaromyces leycettanus JCM12802 and caused TlCel5A to only keep less than 10% activity [30]. Besides the hydrolysis pH of enzymes, pH stability is another important property for their potential industrial applications [31]. AfCel5A displayed higher stability in a broad pH range (3.0–11.0) than other endoglucanases.
The comparatively high optimal temperature activity of AfCel5A obtained here was surprising. The optimal temperature of AfCel5 was 80 °C, which is significantly higher than that reported for others endoglucanases from the thermophilic fungi A. fumigatus. For example, the A. fumigatus Af293 endoglucanase Af-EGL7 had maximal activity at 55 °C [32], the A. fumigatus ABK9 endoglucanases had maximal activity at 50 °C [33], the A. fumigatus Z5 endoglucanases Egl2 and Egl3 had maximal activity at 50 and 60 °C, respectively [34], the A. fumigatus MKU1 endoglucanase Eng61 had maximal activity at 60 °C [35] and the A. fumigatus DBiUN-1 endoglucanases had maximal activity at 60 °C [36]. As far as we know, this is the highest optimal temperature of endoglucanase AfCel5A so far reported for A. fumigatus. Besides, we also found that AfCel5A’s optimum temperature is much higher than those of other endoglucanases. For example, the optimum temperature ranges for most cellulases are between 40 and 70 °C generally. TlCel5A from Talaromyces leycettanus JCM12802 and MtEG5A from Myceliophthora thermophila displayed optimal activity at 75 and 70 °C, respectively. Furthermore, AfCel5A’s optimum temperature is lower than that reported for T. emersonii CBS394.64 endoglucanase TeEgl5A (90 °C) [37]. Interestingly, AfCel5A had very excellent pH stability in comparison with TeEgl5A. AfCel5A is exceptionally stable at pH 11.0, where TeEgl5A completely loses its activity. It was also found that AfCel5A exhibited better thermal stability compared with some thermophilic endoglucanases, including TlCel5A and TlCel6A from T. leycettanus JCM12802, with TlCel5A losing 20% of its activity and TlCel6A losing 60% of its activity at 70 °C after 1 h incubation, as well as Talaromyces emersonii CBS394.64 endoglucanase Egl7A, which lost 80% of its activity. The thermal stability of the enzyme was lower than that of T. emersonii CBS394.64 endoglucanase. AfCel5A retained 30–60% of its original activity after 1 h of incubation at 80–85 °C.
The results indicated that AfCel5A showed synergistic interactions with ManBK in the hydrolysis of mannan-containing polysaccharides, and the maximum synergy degree reached 1.74. AfCel5A showed a weak ability to hydrolyze LBG, while had a more potent synergy with ManBK. In contrast to this, AfCel5A showed a strong GG degradation ability, but we observed that the reducing sugar release is much less when AfCel5A and ManBK act on GG than LBG, as the synergy degree was only 1.2. As we know, GG and LBG belong to the galactomannans, which are composed of mannose and galactose. It was reported that GG and LBG have mannose-to-galactose (M/G) ratios of 2 and 4, respectively [38,39]. Thus, we speculated that the synergy degree differences are likely because GG has more galactose residues, which inhibited the enzymatic hydrolysis. Given the results above, efficient GG hydrolysis always requires the synergy between β-mannanase and α-galactosidase [40,41,42]. In studies, the synergy degrees of AfCel5A and ManBK displayed similar values and reached 1.6 when using KGM and LBG as substrates. Unlike LBG and GG, KGM is composed of glucose and mannose backbone, lightly modeled and branched by the glucosyl units. Thus, α-galactosidase appeared much less intense in the KGM degradation process.

4. Materials and Methods

4.1. Strain and Culture Medium

Escherichia coli strain DH5α was used as a subcloning host for cloning and plasmid preparation, grown in the Luria–Bertani (LB) broth at 37 °C. Strain P. pastoris GS115 and plasmid pPIC9K (Invitrogen, Carlsbad, CA, USA) were utilized for heterologous expression. The clones were cultured in buffered glycerol complex media (BMGY) and then induced in buffered methanol complex media (BMMY).

4.2. Microorganism Isolation and Identification

The Daqu sample was obtained from Hebei Liulingzui Distillery Co., Ltd. (Hebei, China). One gram of Daqu sample was suspended in 9 mL buffered NaCl (0.85%) and subsequently transferred onto 1.0% CMC-Na agar plates at 45 °C for 3–5 days. Strains producing clear zones around their colonies were isolated and maintained on potato dextrose agar (PDA) medium at 45 and 19 °C, respectively.
The fungi morphological analysis was conducted using a light microscope (Olympus CX21, Tokyo, Japan). Molecular identification of the fungal isolates was carried out by PCR amplifying and sequencing the internal transcribed spacer (ITS) fragment, using universal reverse primers (ITS1 and ITS4). Finally, the phylogenetic tree was generated using MEGA6.0 software.

4.3. RNA Isolation and Sequencing Analysis

A.fumigatus HBHF was incubated in enzyme-producing medium (10.0 g·L−1 of KH2PO4, 0.3 g·L−1 of CaCl2·2H2O, 3.0 g·L−1 of MgSO4·7H2O, 2.0 g·L−1 of (NH4)2SO4, 0.5 g·L−1 of FeSO4·7H2O and 5.0 g·L−1 of wheat bran) at 45 °C for 3 days. The mycelia were ground with a mortar and pestle under liquid nitrogen. Total RNA was extracted using TRizol Reagent (Invitrogen, Waltham, MA, USA) according to kit instructions. SuperScript II Reverse Transcriptase kit (Invitrogen, Carlsbad, CA, USA) was applied to reversely transcribe RNA to cDNA. RNA sequencing libraries were generated with the TruSeq Stranded mRNA Sample Prep kit (Illumina, San Diego, CA, USA). The libraries were sequenced with HiSeq 2500 system (Illumina, San Diego, CA, USA). For functional annotations, the assembled unigenes were aligned using public databases, including SwissProt databases, CAZy databases and KEGG databases.

4.4. Cloning and Bioinformatic Analysis of AfCel5A Gene

Primers of the AfCel5 gene (AfCel5A-F: AGGAATTCGCGCCGAATGCGAAG, GATAATAGTGGAAGCCTTCAT, AfCel5A-R: CTACAGGCATTGAGAGTAGTAGTCG TTC) were designed regarding the putative endoglucanase gene (AFUA_6G11600) from the full genome sequence of A. fumigatus Af293. RNA was reverse transcribed into cDNA with ReverTra Ace-α-kit (Toyobo, Osaka, Japan). Subsequently, the AfCel5 gene was amplified with primers (AfCel5A-PF: CGGAATTCGCGCCGAATGCGAAG, AfCel5A-PR: AATGCGGCCGCC TAC AGGC ATT GAGAGTAGTAGTC), and then the purified PCR products were cloned into the pMD19-T vector (TaKaRa, Dalian, China) to generate pMD19-T/AfCel5A. The ExPASy server (http://www.expasy.org/tools/, accessed on 16 May 2021) was used to predict the isoelectric point and molecular weight of the AfCel5 protein. The CBS server (http://www.cbs.dtu.dk/services, accessed on 20 May) was used to predict the potential N- and O-glycosylation sites in the AfCel5A. Signal peptide cleavage site analyses were conducted using SignalP 5.0 server (http://www.cbs.dtu.dk/services/SignalP/, accessed on 20 May 2021). The AfCel5A tertiary structure was modeled using the I-TASSER server (http://zhanglab.ccmb.med.umich.edu/I-TASSER/, accessed on 26 May 2021).

4.5. Heterologous Expression and Purification of AfCel5

The positive plasmid was digested with restriction enzymes EcoR I /Not I and then inserted into vector pPIC9K. Finally, the confirmed pPIC9K/AfCel5 plasmids were linearized with BglII and then transformed into P. pastoris GS115 strain. The transformed cultures were coated on minima dextrose (MD) agar plates and cultured at 30 °C until visible clones appeared. The positive clones were cultured in 4 mL BMGY medium at 30 °C with shaking at 200 rpm for 48 h. Cells were harvested by centrifugation and then resuspended with 2 mL BMMY medium for induction. Finally, the culture supernatant was harvested 72 h after induction by centrifugation at 8000× g.
The crude enzyme from the culture supernatant was concentrated via ultrafiltration (10 kDa cutoff, Millipore, Sartorius, Germany). For further purification, the concentrated supernatant was treated by the AKTA system. Protein purity and molecular weights were determined by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE, 12% gel). The amount of protein was determined by the Protein Assay Kit (Bio-Rad, Hercules, CA, USA). Protein samples were treated by endoglycosidase H (New England Biolabs, Ipswich, MA, USA) according to the operation manual.

4.6. Determination of Enzymatic Activity

The activity of endoglucanase was calculated by DNS method [43]. The reaction solution contained 100 µL enzyme liquid, 450 µL CMC-Na solution (1g·L−1) and 450 µL citric acid buffer (pH 5.0). The above solution was reacted for 10 min at 80 °C, followed by adding 1500 µL of DNS reagent to the system to stop the reaction, and then the absorbance of the mixture at 540 nm was measured. An endoglucanase unit (U) was expressed as the amount of enzyme required to release 1 µmol of glucose per min.

4.7. Biochemical Characterization

The enzyme activity’s optimal pH was evaluated using the standard method with the different buffers (pH 2.0–12.0). The pH stability was analyzed after incubation of AfCel5A at 25 °C for 1 h in different buffers (pH 2.0–12.0). Then, the residual activities were measured by the standard method. The optimal reaction temperature was determined under various temperatures (20–90 °C). The thermostability of AfCel5A was determined after the enzyme was preincubated at 70, 75 and 80 °C for different timespans (0–60 min).
Substrate specificity of AfCel5A was evaluated using 0.5% (w/v) of five different substrates: carob galactomannan, guar gum, konjac glucomannan, pectin and CMC-Na. The Km and Vmax values of AfCel5 were calculated in different concentrations of CMC-Na (0.25–10.0 mg·mL−1, pH 4.0) at 80 °C for 5 min.

4.8. Effect of NaCl and Glucose on Activity

The tolerance of enzymes to high NaCl and glucose concentrations is essential for their industrial application. To evaluate the effects of glucose or NaCl on activity, AfCel5A was incubated at room temperature with different concentrations of salt (0–3 M) or glucose (0–50 mM) for 1 h, and the relative activity measured in the absence of NaCl/glucose was regarded as 100%.

4.9. Synergistic Hydrolysis of Mannans by AfCel5 and ManBK

To investigate the synergistic mannan hydrolysis capabilities, AfCel5A and ManBK were tested alone, simultaneously or sequentially. ManBK of a thermophilic mannanase was obtained from our laboratory, and AfCel5A was obtained in this work. To calculate the degree of synergy (DS), the sum of sugars released was divided by the sugars released by each enzyme alone. The hydrolysis of GG, KGM and LBG was conducted at 70 °C, pH 4.0.
The reaction system (1.0 mL) was prepared by mixing 10.0 mg of LBG as a substrate and 0.2 mL of the enzyme solution (AfCel5A, ManBK or AfCel5A + ManBK) in NaHPO4–citric acid buffer (pH 6.0, 50 mM). For simultaneous reactions, the AfCel5A and ManBK were coincubated for 10 min at 70 °C and then terminated by boiling for 5 min. The sequential reactions were implemented with AfCel5A and ManBK added sequentially. First, AfCel5A (or ManBK) reactions were conducted for 10 min at 70 °C and terminated by heating in a boiling water bath for 5 min. ManBK or AfCel5A was then added to the reaction mixture and treated for 10 min at 70 °C. Finally, the reaction was terminated by boiling, and the DNS method was used to determine the reducing sugar.

4.10. Statistical Analysis

All experiments were performed as triplicates. All data were analyzed using the software GraphPad Prism 7.0 (GraphPad Software, La Jolla, CA, USA).

5. Conclusions

A novel endoglucanases gene, AfCel5A, from A. fumigatus HBHF was successfully expressed and characterized. AfCel5A showed a temperature optimum at 80 °C and a pH optimum at 4.0. AfCel5A exhibits excellent stability, including pH stability, thermal stability and salt and glucose tolerance. In addition, the AfCel5A protein showed an obvious synergistic effect on enzymatic hydrolysis with mannanase ManBK.

Author Contributions

Conceptualization: X.G. and H.L; methodology: H.L.; validation: L.Z.; formal analysis: X.G.; investigation: X.M.; data curation: H.L. and L.Z.; writing—original draft preparation: X.G.; writing—review and editing: H.L.; visualization: X.M.; supervision: X.G.; project administration: X.M.; funding acquisition: X.G. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (No. 31901631), the Research Project of Science and Technology for Higher Education Institutions in Hebei Province of China (No. QN2018005) and the Food Processing Discipline Group of Hebei Agricultural University (No. 2020-08).

Data Availability Statement

The data that support the findings of this study are available from the corresponding author X.M., upon reasonable request.

Acknowledgments

The authors are grateful to Wei Chen from the College of Food Science and Technology, Hebei Agricultural University, for his help with the preparation of the figures in this paper.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Sanderson, K. Lignocellulose: A chewy problem. Nature 2011, 474, S12–S14. [Google Scholar] [CrossRef]
  2. Arevalo-Gallegos, A.; Ahmad, Z.; Asgher, M.; Parra-Saldivar, R.; Iqbal, H.M.N. Lignocellulose: A sustainable material to produce value-added products with a zero waste approach—A review. Int. J. Biol. Macromol. 2017, 99, 308–318. [Google Scholar] [CrossRef] [PubMed]
  3. Cheng, G.; Zhao, Y.; Pan, S.; Wang, X.; Dong, C. A comparative life cycle analysis of wheat straw utilization modes in China. Energy 2020, 194, 116914. [Google Scholar] [CrossRef]
  4. Liqiang, C.; Noerpel, M.R.; Scheckel, K.G.; Ippolito, J.A. Wheat straw biochar reduces environmental cadmium bioavailability. Environ. Int. 2019, 126, 69–75. [Google Scholar] [CrossRef]
  5. Andlar, M.; Rezić, T.; Marđetko, N.; Kracher, D.; Ludwig, R.; Šantek, B. Lignocellulose degradation: An overview of fungi and fungal enzymes involved in lignocellulose degradation. Eng. Life Sci. 2018, 18, 768–778. [Google Scholar] [CrossRef]
  6. Oke, M.A.; Annuar, M.S.M.; Simarani, K. Enhanced endoglucanase production by Bacillus aerius on mixed lignocellulosic substrates. BioResources 2016, 11, 5854–5869. [Google Scholar] [CrossRef] [Green Version]
  7. Akram, F.; ul Haq, I.; Imran, W.; Mukhtar, H. Insight perspectives of thermostable endoglucanases for bioethanol production: A review. Renew. Energ. 2018, 122, 225–238. [Google Scholar] [CrossRef]
  8. Siqueira, J.G.W.; Rodrigues, C.; de Souza Vandenberghe, L.P.; Woiciechowski, A.L.; Soccol, C.R. Current advances in on-site cellulase production and application on lignocellulosic biomass conversion to biofuels: A review. Biomass Bioenerg. 2020, 132, 105419. [Google Scholar] [CrossRef]
  9. Ahmed, A.; Bibi, A. Fungal cellulase; production and applications: Minireview. Int. J. Health Life Sci. 2018, 4, 19–36. [Google Scholar] [CrossRef] [Green Version]
  10. Behera, B.C.; Sethi, B.K.; Mishra, R.R.; Dutta, S.K.; Thatoi, H.N. Microbial cellulases–Diversity & biotechnology with reference to mangrove environment: A review. J. Genet. Eng. Biotechnol. 2017, 15, 197–210. [Google Scholar] [CrossRef]
  11. Maleki, M.; Shahraki, M.F.; Kavousi, K.; Ariaeenejad, S.; Salekdeh, G.H. A novel thermostable cellulase cocktail enhances lignocellulosic bioconversion and biorefining in a broad range of pH. Int. J. Biol. Macromol. 2020, 154, 349–360. [Google Scholar] [CrossRef]
  12. Atalah, J.; Cáceres-Moreno, P.; Espina, G.; Blamey, J.M. Thermophiles and the applications of their enzymes as new biocatalysts. Bioresour. Technol. 2019, 280, 478–488. [Google Scholar] [CrossRef]
  13. Sahoo, K.; Sahoo, R.K.; Gaur, M.; Subudhi, E. Cellulolytic thermophilic microorganisms in white biotechnology: A review. Folia Microbiol. 2020, 65, 25–43. [Google Scholar] [CrossRef]
  14. Mohammad, B.T.; Al Daghistani, H.I.; Jaouani, A.; Abdel-Latif, S.; Kennes, C. Isolation and characterization of thermophilic bacteria from Jordanian hot springs: Bacillus licheniformis and Thermomonas hydrothermalis isolates as potential producers of thermostable enzymes. Int. J. Microbiol. 2017, 2017, 1–12. [Google Scholar] [CrossRef] [Green Version]
  15. Wu, S.; Liu, B.; Zhang, X. Characterization of a recombinant thermostable xylanase from deep-sea thermophilic Geobacillus sp. MT-1 in East Pacific. Appl. Microbiol. Biotechnol. 2006, 72, 1210–1216. [Google Scholar] [CrossRef]
  16. Lu, H.; Zhang, H.; Shi, P.; Luo, H.; Wang, Y.; Yang, P.; Yao, B. A family 5 β-mannanase from the thermophilic fungus Thielavia arenaria XZ7 with typical thermophilic enzyme features. Appl. Microbiol. Biotechnol. 2013, 97, 8121–8128. [Google Scholar] [CrossRef]
  17. Zheng, X.W.; Tabrizi, M.R.; Nout, M.R.; Han, B.Z. Daqu—A traditional Chinese liquor fermentation starter. J. Inst. Brew. 2011, 117, 82–90. [Google Scholar] [CrossRef]
  18. Yao, S.; Liu, Y.; Zhang, M.; Zhang, X.; Li, H.; Zhao, T.; Xin, C.; Xu, L.; Zhang, B.; Cheng, C. Thermoactinomyces daqus sp. nov., a thermophilic bacterium isolated from high-temperature Daqu. Int. J. Syst. Evol. Microbiol. 2014, 64, 206–210. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  19. Chen, L.; Yi, Z.; Fang, Y.; Jin, Y.; Xiao, Y.; Zhao, D.; Huo, H.; He, H.; Sun, Q.; Zhao, H. Uncovering key residues responsible for the thermostability of a thermophilic 1, 3 (4)-β-d-glucanase from Nong flavor Daqu by rational design. Enzym. Microb. Tech. 2020, 142, 109672. [Google Scholar] [CrossRef] [PubMed]
  20. Singh, S.; Singh, G.; Arya, S.K. Mannans: An overview of properties and application in food products. Int. J. Biol. Macromol. 2018, 119, 79–95. [Google Scholar] [CrossRef]
  21. Moreira, L.R.S. An overview of mannan structure and mannan-degrading enzyme systems. Appl. Microbiol. Biotechnol. 2008, 79, 165–178. [Google Scholar] [CrossRef]
  22. Malgas, S.; van Dyk, J.S.; Pletschke, B.I. A review of the enzymatic hydrolysis of mannans and synergistic interactions between β-mannanase, β-mannosidase and α-galactosidase. World J. Microb. Biotechnol. 2015, 31, 1167–1175. [Google Scholar] [CrossRef]
  23. Jeon, S.D.; Yu, K.O.; Kim, S.W.; Han, S.O. A celluloytic complex from Clostridium cellulovorans consisting of mannanase B and endoglucanase E has synergistic effects on galactomannan degradation. Appl. Microbiol. Biotechnol. 2011, 90, 565–572. [Google Scholar] [CrossRef] [PubMed]
  24. Várnai, A.; Huikko, L.; Pere, J.; Siika-Aho, M.; Viikari, L. Synergistic action of xylanase and mannanase improves the total hydrolysis of softwood. Bioresour. Technol. 2011, 102, 9096–9104. [Google Scholar] [CrossRef] [PubMed]
  25. De Gouvêa, P.F.; Bernardi, A.V.; Gerolamo, L.E.; de Souza Santos, E.; Riaño-Pachón, D.M.; Uyemura, S.A.; Dinamarco, T.M. Transcriptome and secretome analysis of Aspergillus fumigatus in the presence of sugarcane bagasse. BMC Genom. 2018, 19, 1–18. [Google Scholar] [CrossRef]
  26. Liu, D.; Zhang, R.; Yang, X.; Zhang, Z.; Song, S.; Miao, Y.; Shen, Q. Characterization of a thermostable β-glucosidase from Aspergillus fumigatus Z5, and its functional expression in Pichia pastoris X33. Microb. Cell Fact. 2012, 11, 1–15. [Google Scholar] [CrossRef] [Green Version]
  27. Yilmazer, C.; Germec, M.; Turhan, I. Solid-state fermentation for the production of a recombinant β-mannanase from Aspergillus fumigatus expressed in Aspergillus sojae grown on renewable resources. J. Food Process. Preserv. 2020, e14584. [Google Scholar] [CrossRef]
  28. Zehra, M.; Syed, M.N.; Sohail, M. Banana peels: A promising substrate for the coproduction of pectinase and xylanase from Aspergillus fumigatus MS16. Pol. J. Microbiol. 2020, 69, 19. [Google Scholar] [CrossRef] [Green Version]
  29. Dave, B.R.; Sudhir, A.P.; Subramanian, R.B. Purification and properties of an endoglucanase from Thermoascus aurantiacus. Biotechnol. Rep. 2015, 6, 85–90. [Google Scholar] [CrossRef] [Green Version]
  30. Gu, Y.; Zheng, F.; Wang, Y.; Su, X.; Bai, Y.; Yao, B.; Huang, H.; Luo, H. Characterization of two thermophilic cellulases from Talaromyces leycettanus JCM12802 and their synergistic action on cellulose hydrolysis. PLoS ONE 2019, 14, e0224803. [Google Scholar] [CrossRef] [PubMed]
  31. Bruins, M.E.; Janssen, A.E.; Boom, R.M. Thermozymes and their applications. Appl. Miochem. Biotech. 2001, 90, 155–186. [Google Scholar] [CrossRef]
  32. Vianna Bernardi, A.; Kimie Yonamine, D.; Akira Uyemura, S.; Magnani Dinamarco, T. A thermostable Aspergillus fumigatus GH7 endoglucanase over-expressed in Pichia pastoris stimulates lignocellulosic biomass hydrolysis. Int. J. Mol. Sci. 2019, 20, 2261. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Das, A.; Jana, A.; Paul, T.; Halder, S.K.; Ghosh, K.; Maity, C.; Mohapatra, P.K.D.; Pati, B.R.R.; Mondal, K.C. Thermodynamics and kinetic properties of halostable endoglucanase from Aspergillus fumigatus ABK9. J. Basic Microbiol. 2014, 54, S142–S151. [Google Scholar] [CrossRef]
  34. Liu, D.; Zhang, R.; Yang, X.; Xu, Y.; Tang, Z.; Tian, W.; Shen, Q. Expression, purification and characterization of two thermostable endoglucanases cloned from a lignocellulosic decomposing fungi Aspergillus fumigatus Z5 isolated from compost. Protein. Expres. Purif. 2011, 79, 176–186. [Google Scholar] [CrossRef]
  35. Meera, B.; Vanitha, M.C.; Ramani, G.; Manjula, A.; Gunasekaran, P. Cloning and Expression of an Intronless Gene Encoding Endoglucanase from Aspergillus fumigatus MKU1. Indian J Biotechnol. 2011, 10, 480–486. [Google Scholar] [CrossRef] [Green Version]
  36. Rungrattanakasin, B.; Premjet, S.; Thanonkeo, S.; Klanrit, P.; Thanonkeo, P. Cloning and expression of an endoglucanase gene from the thermotolerant fungus Aspergillus fumigatus DBiNU-1 in Kluyveromyces lactis. Braz. J. Microbiol. 2018, 49, 647–655. [Google Scholar] [CrossRef]
  37. Wang, K.; Luo, H.; Bai, Y.; Shi, P.; Huang, H.; Xue, X.; Yao, B. A thermophilic endo-1, 4-β-glucanase from Talaromyces emersonii CBS394. 64 with broad substrate specificity and great application potentials. Appl. Microbiol. Biotechnol. 2014, 98, 7051–7060. [Google Scholar] [CrossRef] [PubMed]
  38. Malgas, S.; van Dyk, S.J.; Pletschke, B.I. β-Mannanase (Man26A) and α-galactosidase (Aga27A) synergism–a key factor for the hydrolysis of galactomannan substrates. Enzym. Microb. Technol. 2015, 70, 1–8. [Google Scholar] [CrossRef] [PubMed]
  39. Picout, D.R.; Ross-Murphy, S.B.; Jumel, K.; Harding, S.E. Pressure cell assisted solution characterization of polysaccharides. 2. Locust bean gum and tara gum. Biomacromolecules 2002, 3, 761–767. [Google Scholar] [CrossRef]
  40. Aulitto, M.; Fusco, F.A.; Fiorentino, G.; Bartolucci, S.; Contursi, P.; Limauro, D. A thermophilic enzymatic cocktail for galactomannans degradation. Enzym. Microb. Technol. 2018, 111, 7–11. [Google Scholar] [CrossRef] [Green Version]
  41. Xie, J.; Pan, L.; He, Z.; Liu, W.; Zheng, D.; Zhang, Z.; Wang, B. A novel thermophilic β-mannanase with broad-range pH stability from Lichtheimia ramosa and its synergistic effect with α-galactosidase on hydrolyzing palm kernel meal. Process. Biochem. 2020, 88, 51–59. [Google Scholar] [CrossRef]
  42. Yang, L.; Shi, G.; Tao, Y.; Lai, C.; Li, X.; Zhou, M.; Yong, Q. The Increase of Incomplete Degradation Products of Galactomannan Production by Synergetic Hydrolysis of β-Mannanase and α-Galactosidase. Appl. Biochem. Biotech. 2021, 193, 405–416. [Google Scholar] [CrossRef] [PubMed]
  43. Xiao, C.; Lu, Z.M.; Zhang, X.J.; Wang, S.T.; Ao, L.; Shen, C.H.; Shi, J.S.; Xu, Z.H. Bio-heat is a key environmental driver shaping the microbial community of medium-temperature Daqu. Appl. Environ. Microb. 2017, 83. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Catalysts 11 00862 g001 550
Figure 1. Identification of isolated A. fumigatus HBHF5 strain. (A) Strain HBHF5 cultivated on PDA plate at 45 °C. (B) Morphology of strain HBHF5 stained with lactophenol cotton blue. (C) Phylogenetic tree analysis of strain HBHF5.
Figure 1. Identification of isolated A. fumigatus HBHF5 strain. (A) Strain HBHF5 cultivated on PDA plate at 45 °C. (B) Morphology of strain HBHF5 stained with lactophenol cotton blue. (C) Phylogenetic tree analysis of strain HBHF5.
Catalysts 11 00862 g001
Catalysts 11 00862 g002 550
Figure 2. Structure analysis of endoglucanase AfCel5A. (A) The exon/intron structure analysis of gene AfCel5A. (B) The domain analysis of the AfCel5A protein. (C) Three-dimensional structure of the AfCel5A protein. (D) SDS-PAGE analysis of the AfCel5A protein.
Figure 2. Structure analysis of endoglucanase AfCel5A. (A) The exon/intron structure analysis of gene AfCel5A. (B) The domain analysis of the AfCel5A protein. (C) Three-dimensional structure of the AfCel5A protein. (D) SDS-PAGE analysis of the AfCel5A protein.
Catalysts 11 00862 g002
Catalysts 11 00862 g003 550
Figure 3. Characteristics of the endoglucanase AfCel5A. (A) The optimum temperature for endoglucanase activities. (B) The optimum pH for endoglucanase activities. (C) The thermostability of AfCel5A at 70, 75 and 80 °C. (D) The pH stability of AfCel5A at different pH values.
Figure 3. Characteristics of the endoglucanase AfCel5A. (A) The optimum temperature for endoglucanase activities. (B) The optimum pH for endoglucanase activities. (C) The thermostability of AfCel5A at 70, 75 and 80 °C. (D) The pH stability of AfCel5A at different pH values.
Catalysts 11 00862 g003
Catalysts 11 00862 g004 550
Figure 4. Effect of different (A) glucose and (B) NaCl concentrations on AfCel5A activity.
Figure 4. Effect of different (A) glucose and (B) NaCl concentrations on AfCel5A activity.
Catalysts 11 00862 g004
Table
Table 1. CAZy-encoding genes identified from the transcriptome of A. fumigatus HBHF5.
Table 1. CAZy-encoding genes identified from the transcriptome of A. fumigatus HBHF5.
CAZy FamilyGene NumberGene ID
CE11AFUA_5G09860
CE45AFUA_4G12330, AFUA_1G10540, AFUA_2G05900, AFUA_3G00520, AFUA_4G12120
CE83AFUA_3G07650, AFUA_8G06880, AFUA_3G07650
CE91AFUA_8G04100
CE121AFUA_1G03890
PL12AFUA_2G00760, AFUA_7G06400
GH12AFUA_2G05580, AFUA_3G06060
GH52AFUA_6G08840, AFUA_7G01320
GH136AFUA_1G15150, AFUA_2G13460, AFUA_3G07380, AFUA_4G10130, AFUA_5G10540, AFUA_2G00710
GH153AFUA_2G00690, AFUA_3G00610, AFUA_4G10140
GH1812AFUA_1G02800, AFUA_3G07110, AFUA_3G07160, AFUA_3G11280, AFUA_5G01400, AFUA_5G03760, AFUA_5G03850, AFUA_7G05140, AFUA_8G01410
AFUA_5G03960, AFUA_5G06840, AFUA_8G00700,
GH204AFUA_2G00640, AFUA_8G05020, AFUA_3G11780, AFUA_8G04060
GH286AFUA_1G17220, AFUA_4G13920, AFUA_1G17220, AFUA_8G01970, AFUA_8G02630, AFUA_8G06890
GH3013AFUA_1G05770, AFUA_1G14710, AFUA_1G16400, AFUA_1G17410, AFUA_5G07080, AFUA_5G07190, AFUA_6G03570, AFUA_6G08700, AFUA_6G12010, AFUA_7G06140, AFUA_3G00230, AFUA_5G07080, AFUA_8G07120
GH323AFUA_2G01240, AFUA_5G00480, AFUA_6G05000
GH331AFUA_4G13800
GH357AFUA_1G14170, AFUA_3G00380, AFUA_5G14090, AFUA_5G14550, AFUA_6G06660, AFUA_4G00390, AFUA_1G16700
GH365AFUA_1G01200, AFUA_5G02130, AFUA_5G13830, AFUA_8G01100, AFUA_8G01130
GH542AFUA_1G16920, AFUA_3G02090
GH556AFUA_1G03600, AFUA_1G14450, AFUA_6G13270, AFUA_1G11460, AFUA_3G07520, AFUA_6G09250
GH622AFUA_1G09900, AFUA_2G15160
GH635AFUA_1G16250, AFUA_4G10150, AFUA_8G07070, AFUA_5G03500, AFUA_6G04210
GH651AFUA_4G13530
GH748AFUA_2G09520, AFUA_3G03870, AFUA_5G01830, AFUA_6G01800, AFUA_6G07480, AFUA_6G11600, AFUA_7G01540,
AFUA_7G06740
GH754AFUA_3G14980, AFUA_4G01290, AFUA_6G00500, AFUA_8G00930
GH925AFUA_1G14560, AFUA_4G10070, AFUA_6G06790, AFUA_6G12360, AFUA_3G08200
GT210AFUA_3G10400, AFUA_5G08210, AFUA_1G12600, AFUA_2G01870, AFUA_2G13430, AFUA_2G13440, AFUA_3G14420, AFUA_4G04180, AFUA_5G00760, AFUA_8G05630
GT43AFUA_4G13400, AFUA_5G13210, AFUA_6G06940
GT51AFUA_5G02480
GT151AFUA_1G06890
GT206AFUA_6G12950, AFUA_2G04010, AFUA_3G05650, AFUA_3G07370AFUA_7G03940, AFUA_2G04020,
GT211AFUA_5G09550
GT221AFUA_1G13870
GT331AFUA_6G14180
GT351AFUA_1G12920
GT393AFUA_1G07690, AFUA_3G06450, AFUA_8G04500
GT481AFUA_6G12400
GT581AFUA_5G11990
GT591AFUA_2G11080
GT661AFUA_8G04430
GT9016AFUA_2G02360, AFUA_5G14780, AFUA_6G14480, AFUA_2G01450, AFUA_2G14910, AFUA_2G15910, AFUA_4G10750, AFUA_5G13090, AFUA_6G04450, AFUA_6G14040, AFUA_7G01300, AFUA_5G10760, AFUA_4G09130, AFUA_4G11280, AFUA_5G06050, AFUA_1G01380
Table
Table 2. Effect of various metal ions or chemical reagents on the activity of AfCel5A.
Table 2. Effect of various metal ions or chemical reagents on the activity of AfCel5A.
Metal Ions and ChemicalsRelative Activity (%) a
-1 mM5 mM
None100.0 ± 1.5100.0 ± 0.7
Ag+56.9 ± 2.713.1 ± 3.3
Mn2+133.4 ± 2.613.9 ± 6.9
Zn2+96.7 ± 1.356.3 ± 5.2
Al3+90.6 ± 2.379.3 ± 1.3
Mg2+94.8 ± 1.489.1 ± 1.4
Fe3+84.6 ± 1.491.6 ± 1.8
Li+84.75 ± 1.495.7 ± 4.1
Ca2+80.1 ± 1.587.2 ± 2.9
K+89.5 ± 3.6102.7 ± 1.2
Acetone77.5 ± 1.870.3 ± 0.6
Triton X-10075.5 ± 3.058.8 ± 4.6
SDS20.9 ± 8.90.5 ± 3.4
CTAB82.9 ± 7.565.9 ± 4.1
EDTA90.4 ± 3.684.3 ± 6.6
Urea97.3 ± 4.396.8 ± 3.5
a Values represent mean ± SD (n = 3) relative to the untreated control samples.
Table
Table 3. The synergistic hydrolysis of AfCel5 and ManBK using mannans as the substrate.
Table 3. The synergistic hydrolysis of AfCel5 and ManBK using mannans as the substrate.
Enzyme AddedReducing Sugar Content
(μ mol)		Synergistic Effect
(DS)
MannanFirst EnzymeSecond Enzyme
AfCel5None0.02-
ManBKNone0.30-
LBGAfCel5ManBK0.551.57
ManBKAfCel50.541.53
AfCel5 + ManBKNone0.491.39
AfCel5None0.44-
ManBKNone0.45-
Guar gumAfCel5ManBK1.061.19
ManBKAfCel51.061.19
AfCel5 + ManBKNone1.071.20
AfCel5None0.05-
ManBKNone0.29-
KGMAfCel5ManBK0.591.74
ManBKAfCel50.631.61
AfCel5 + ManBKNone0.411.19
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Gu, X.; Lu, H.; Zhang, L.; Meng, X. A Thermophilic GH5 Endoglucanase from Aspergillus fumigatus and Its Synergistic Hydrolysis of Mannan-Containing Polysaccharides. Catalysts 2021, 11, 862. https://0-doi-org.brum.beds.ac.uk/10.3390/catal11070862

AMA Style

Gu X, Lu H, Zhang L, Meng X. A Thermophilic GH5 Endoglucanase from Aspergillus fumigatus and Its Synergistic Hydrolysis of Mannan-Containing Polysaccharides. Catalysts. 2021; 11(7):862. https://0-doi-org.brum.beds.ac.uk/10.3390/catal11070862

Chicago/Turabian Style

Gu, Xinxi, Haiqiang Lu, Lijuan Zhang, and Xiangchen Meng. 2021. "A Thermophilic GH5 Endoglucanase from Aspergillus fumigatus and Its Synergistic Hydrolysis of Mannan-Containing Polysaccharides" Catalysts 11, no. 7: 862. https://0-doi-org.brum.beds.ac.uk/10.3390/catal11070862

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop