Quartz Crystal Microbalance Genosensing of Brettanomyces bruxellensis Yeast in Wine Using a Rapid and Efficient Drop and Collect Protocol
Abstract
:1. Introduction
2. Material and Methods
2.1. Reagents
2.2. Materials
2.3. Instruments
2.4. ssDNA Sequences
- The capture ssDNA-probe sequence (53 nt) targeting the ITS1–ITS2 regions (internal transcribed spacer 1 and 2) of B. bruxellensis DNA modified with a thiol group at its 5′, named SH-capture probe [18];
- The complementary ssDNA sequence (53 nt) used as a positive control (CS-positive control) and;
- The non-complementary ssDNA sequence (53 nt) as a negative control (NCS-negative control).
2.5. Whole DNA Extraction from Microorganisms
2.6. DNA Extraction from Wine
2.7. Cleaning of Commercial Quartz Crystal
2.7.1. For Application without TEM-Grid Patterns—Short DNA Sequence Sensing
2.7.2. For Micro-/Nano-Patterning with TEM-Grid—Whole DNA Sensing in Wine
2.8. Biofunctionalization of Quartz Crystal with ssDNA Capture Probe
2.9. Drop and Collect Protocol for Acoustic Sensing of CS-Positive Control and NCS-Negative Control
2.10. Multi-TEM Patterned Crystal—Fabrication Steps
2.11. Evaluation of Gold Grain Sizes Formed through TEM Grid on Quartz Crystal
2.12. Processing the QCM Data
3. Results and Discussion
3.1. SEM Characterization of S-QCM Gold Electrode Before and After 4 nm Au Evaporation
3.2. Genosensing of ssDNA-Brett on S-QCM Gold Electrode—Positive and Negative Controls Using Drop and Collect Protocol
3.3. Brett Genosensing in Wine Sample Using S-QCM Crystal
3.4. Genosensing on TEM-Patterned QCM
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Cibrario, A.; Avramova, M.; Dimopoulou, M.; Magani, M.; Miot-Sertier, C.; Mas, A.; Portillo, M.C.; Ballestra, P.; Albertin, W.; Masneuf-Pomrede, I.; et al. Brettanomyces bruxellensis wine isolates show high geographical dispersal and long persistence in cellars. PLoS ONE 2019, 14, e0222749. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tindal, R.A.; Jeffery, D.W.; Muhlack, R.A. Mathematical modelling to enhance winemaking efficiency: A review of red wine colour and polyphenol extraction and evolution. Aust. J. Grape Wine Res. 2021, 27, 219–233. [Google Scholar] [CrossRef]
- Puecher, C.; Rohregger, S.; Malacarne, M.; Nicolini, G. 4-Ethylphenol and 4-ethylguaiacol depletion in wine using esterified cellulose. Food Chem. 2012, 132, 2126–2130. [Google Scholar]
- Tubia, I.; Prasad, K.; Perez-Lorenzo, E.; Abadin, C.; Zumarraga, M.; Oyanguren, I.; Barbero, F.; Paredes, J.; Arana, S. Beverage spoilage yeast detection methods and control technologies: A review of Brettanomyces. Int. J. Food Microbiol. 2018, 283, 65–76. [Google Scholar] [CrossRef] [PubMed]
- Durmuş, N.G.; Lin, R.L.; Kozberg, M.; Dermici, D.; Khademhosseini, A.; Demirci, U. Acoustic-Based Biosensors BT—Encyclopedia of Microfluidics and Nanofluidics; Springer: New York, NY, USA, 2015. [Google Scholar]
- Su, J.; Esmaeilzadeh, H.; Zhang, F.; Yu, Q.; Cernigliaro, G.; Xu, J.; Sun, H. An Ultrasensitive Micropillar-based Quartz Crystal Microbalance Device for Real-time Measurement of Protein Immobilization and Protein-Protein Interaction. Biosens. Bioelectron. 2018, 99, 325–331. [Google Scholar] [CrossRef] [PubMed]
- Buck, R.P.; Lindner, E.; Kutner, W.; Inzelt, G. Piezoeletric chemical sensors. Pure Appl. Chem. 2004, 76, 1139–1160. [Google Scholar] [CrossRef]
- Meccea, V.M. From Quartz Crystal Microbalance to Fundamental Principles of Mass Measurements. Anal. Lett. 2005, 38, 753–767. [Google Scholar] [CrossRef]
- Mujahid, A.; Dickert, F.L. Surface Acoustic Wave (SAW) for Chemical Sensing Applications of Recognition Layers. Sensors 2017, 17, 2716. [Google Scholar] [CrossRef] [Green Version]
- Chen, J.Y.; Penn, L.S.; Xi, J. Quartz Crystal Microbalance: Sensing Cell-substrate Adhesion and Beyond. Biosens. Bioelectron. 2018, 99, 593–602. [Google Scholar] [CrossRef]
- Liu, K.; Zhang, C. Volatile Organic Compounds Gas Sensor Based on Quartz Crystal Microbalance for Fruit Freshness Detection: A Review. Food Chem. 2021, 334, 1277615. [Google Scholar] [CrossRef]
- Wang, L.; Gao, J.; Xu, J. QCM Formaldehyde Sensing Materials: Design and Sensing Mechanism. Sens. Actuators B Chem. 2019, 293, 71–82. [Google Scholar] [CrossRef]
- Jia, K.; Adam, P.M.; Ionescu, R.E. Sequential Acoustic Detection of Atrazine Herbicide and Carbofuran Insecticide Using a Single Micro-structured Gold Quartz Crystal Microbalance. Sens. Actuators B Chem. 2013, 400–404. [Google Scholar] [CrossRef]
- Lien, T.T.N.; Lam, T.D.; An, V.T.H.; Hoang, T.V.; Quang, D.T.; Khieu, D.Q.; Kim, J.S. Multi-wall Carbon Nanotubes (MWCNTs)-Doped Polypyrrole DNA Biosensor for Label-free Detection of Genetically Modified Organisms by QCM and EIS. Talanta 2010, 80, 1164–1169. [Google Scholar] [CrossRef]
- Asai, N.; Shimizu, T.; Shingubara, S.; Ito, T. Fabrication of Highly Sensitive QCM Sensor using AAO Nanoholes and its Application in Biosensing. Sens. Actuators B Chem. 2018, 276, 534–539. [Google Scholar] [CrossRef]
- Lim, H.J.; Saha, T.; Tey, B.T.; Tan, W.S.; Ooi, C.W. Quartz Crystal Microbalance-based Biosensors as Rapid Diagnostic Devices for Infectious Diseases. Biosens. Bioelectron. 2020, 168, 112513. [Google Scholar] [CrossRef]
- Hao, R.Z.; Song, H.B.; Zuo, G.M.; Yang, R.F.; Wei, H.P.; Wang, D.B.; Cui, Z.Q.; Zhang, Z.; Cheng, Z.X.; Zhang, X.E. DNA Probe Functionalized QCM Biosensor based on Gold Nanoparticle Amplification for Bacillus Anthracis Detection. Biosens. Bioelectron. 2011, 26, 3398–3404. [Google Scholar] [CrossRef]
- Mecea, V.M. Is Quartz Crystal Microbalance Really a Mass Sensor? Sens. Actuators A Phys. 2006, 128, 270–277. [Google Scholar] [CrossRef]
- Wachiralurpan, S.; Chansiri, K.; Lieberzeit, P.A. Direct Detection of Listeria Monocytogenes DNA Amplification Products with Quartz Crystal Microbalance. Sens. Actuators B Chem. 2020, 308, 127678. [Google Scholar] [CrossRef]
- Shibata, H.; Nemoto, J.; Shiba, S.; Yamane, Y.; Kawai, G.; Hashimoto, K. Immobilization of DNA on Quartz Crystal Microbalance Sensor Modified with Self-assembled Monolayer of Thiol Derivative. J. Oleo Sci. 2020, 69, 271–276. [Google Scholar] [CrossRef] [PubMed]
- Latif, U.; Can, S.; Hayden, O.; Grillberger, P.; Dickert, F.L. Sauerbrey and anti-Sauerbrey Behavioral Studies in QCM Sensors—Detection of Bioanalytes. Sens. Actuators B Chem. 2013, 176, 825–830. [Google Scholar] [CrossRef]
- Manzano, M.; Cocolin, L.; Longo, B.; Comi, G. PCR-DGGE Differentiation of Strains of Saccharomyces sensu stricto. Antonie Leeuwenhoek Int. J. Gen. Mol. Microbiol. 2004, 85, 23–27. [Google Scholar] [CrossRef] [PubMed]
- Cecchini, F.; Manzano, M.; Yohai Mandabi, Y.; Perelman, E.; Marks, R.S. Chemiluminescent DNA Optical Fibre Sensor for Brettanomyces bruxellensis Detection. J. Biotechnol. 2012, 157, 25–30. [Google Scholar] [CrossRef] [PubMed]
- Casari Bariani, G.; Zhou, L.; Poggesi, S.; Mittapalli, R.; Manzano, M.; Ionescu, R.E. Multi-Detection of Gliadin Using QCM Crystals Patterned with Controlled Sectors of TEM Grid and Annealed Nanoislands on Gold Electrode. Nanomaterials 2020, 10, 790. [Google Scholar] [CrossRef] [PubMed]
Thiol-probe (SH-capture probe) | [ThiolC6]TGTTTGAGCGTCATTTCCTTCTCACTATTTAGTGGTTATGAGATTACACGAGG (53 bp) |
Complementary sequence (CS-positive control) | CCTCGTGTAATCTCATAACCACTAAATAGTGAGAAGGAAATGACGCTCAAACA(53 bp) |
Non-complementary sequence (NCS-negative control) | CCTAAGGTAATAGCATAAGTACTAAATAACCAGAATCAAAGAACGCTCAACTT (53 bp) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Poggesi, S.; Zhou, L.; Bariani, G.C.; Mittapalli, R.; Manzano, M.; Ionescu, R.E. Quartz Crystal Microbalance Genosensing of Brettanomyces bruxellensis Yeast in Wine Using a Rapid and Efficient Drop and Collect Protocol. Crystals 2021, 11, 562. https://0-doi-org.brum.beds.ac.uk/10.3390/cryst11050562
Poggesi S, Zhou L, Bariani GC, Mittapalli R, Manzano M, Ionescu RE. Quartz Crystal Microbalance Genosensing of Brettanomyces bruxellensis Yeast in Wine Using a Rapid and Efficient Drop and Collect Protocol. Crystals. 2021; 11(5):562. https://0-doi-org.brum.beds.ac.uk/10.3390/cryst11050562
Chicago/Turabian StylePoggesi, Simone, Lan Zhou, Giuliocesare Casari Bariani, Rakesh Mittapalli, Marisa Manzano, and Rodica Elena Ionescu. 2021. "Quartz Crystal Microbalance Genosensing of Brettanomyces bruxellensis Yeast in Wine Using a Rapid and Efficient Drop and Collect Protocol" Crystals 11, no. 5: 562. https://0-doi-org.brum.beds.ac.uk/10.3390/cryst11050562