Anti-Inflammatory Effects by Pharmacological Inhibition or Knockdown of Fatty Acid Amide Hydrolase in BV2 Microglial Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Reagents
2.2. Cell Culture and Treatment
2.3. siRNA Transfection
2.4. PGE2 EIA
2.5. Membrane Fractionation and Activity-Based Protein Profiling (ABPP)
2.6. Western Blotting
2.7. qRT-PCR
2.8. AEA Hydrolysis Assay
2.9. ROS Assay
2.10. Statistics
3. Results
3.1. Inhibition Profile of PF3845 and URB597 In Vitro Conditions
3.2. Reduction of PGE2 Production by FAAH Inhibitors
3.3. Reduction of Inflammatory Gene Expression by FAAH Inhibitors
3.4. Anti-Inflammatory Effects of FAAH Inhibitors Independent of CB Receptor Activation
3.5. Construction of FAAH Knockdown Cells
3.6. Reduced Inflammatory Responses but Increased M2 Markers by FAAH Knockdown.
3.7. Anti-Inflammatory Effects of FAAH Inhibition and Knockdown Independent of CB Receptors and PPARs
4. Discussion
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Bisogno, T.; Ligresti, A.; Di Marzo, V. The endocannabinoid signalling system: Biochemical aspects. Pharmacol. Biochem. Behav. 2005, 81, 224–238. [Google Scholar] [CrossRef] [PubMed]
- Pacher, P.; Batkai, S.; Kunos, G. The endocannabinoid system as an emerging target of pharmacotherapy. Pharmacol. Rev. 2006, 58, 389–462. [Google Scholar] [CrossRef] [PubMed]
- Pertwee, R.G.; Howlett, A.C.; Abood, M.E.; Alexander, S.P.; Di Marzo, V.; Elphick, M.R.; Greasley, P.J.; Hansen, H.S.; Kunos, G.; Mackie, K.; et al. International Union of Basic and Clinical Pharmacology. LXXIX. Cannabinoid receptors and their ligands: Beyond CB(1) and CB(2). Pharmacol. Rev. 2010, 62, 588–631. [Google Scholar] [CrossRef] [PubMed]
- Maccarrone, M.; Guzman, M.; Mackie, K.; Doherty, P.; Harkany, T. Programming of neural cells by (endo)cannabinoids: From physiological rules to emerging therapies. Nat. Rev. Neurosci. 2014, 15, 786–801. [Google Scholar] [CrossRef]
- Sharkey, K.A.; Wiley, J.W. The Role of the Endocannabinoid System in the Brain-Gut Axis. Gastroenterology 2016, 151, 252–266. [Google Scholar] [CrossRef]
- Balsevich, G.; Petrie, G.N.; Hill, M.N. Endocannabinoids: Effectors of glucocorticoid signaling. Front. Neuroendocrinol. 2017, 47, 86–108. [Google Scholar] [CrossRef]
- Kano, M.; Ohno-Shosaku, T.; Hashimotodani, Y.; Uchigashima, M.; Watanabe, M. Endocannabinoid-mediated control of synaptic transmission. Physiol. Rev. 2009, 89, 309–380. [Google Scholar] [CrossRef]
- Lu, H.C.; Mackie, K. An Introduction to the Endogenous Cannabinoid System. Biol. Psychiatry 2016, 79, 516–525. [Google Scholar] [CrossRef]
- Quarta, C.; Mazza, R.; Obici, S.; Pasquali, R.; Pagotto, U. Energy balance regulation by endocannabinoids at central and peripheral levels. Trends Mol. Med. 2011, 17, 518–526. [Google Scholar] [CrossRef]
- Garcia-Arencibia, M.; Molina-Holgado, E.; Molina-Holgado, F. Effect of endocannabinoid signalling on cell fate: Life, death, differentiation and proliferation of brain cells. Br. J. Pharmacol. 2019, 176, 1361–1369. [Google Scholar] [CrossRef]
- McAllister, S.D.; Glass, M. CB(1) and CB(2) receptor-mediated signalling: A focus on endocannabinoids. Prostaglandins Leukot Essent Fatty Acids 2002, 66, 161–171. [Google Scholar] [CrossRef] [PubMed]
- McHugh, D.; Hu, S.S.; Rimmerman, N.; Juknat, A.; Vogel, Z.; Walker, J.M.; Bradshaw, H.B. N-arachidonoyl glycine, an abundant endogenous lipid, potently drives directed cellular migration through GPR18, the putative abnormal cannabidiol receptor. BMC Neurosci. 2010, 11, 44. [Google Scholar] [CrossRef]
- Lauckner, J.E.; Jensen, J.B.; Chen, H.Y.; Lu, H.C.; Hille, B.; Mackie, K. GPR55 is a cannabinoid receptor that increases intracellular calcium and inhibits M current. Proc. Natl. Acad. Sci. USA 2008, 105, 2699–2704. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Di Marzo, V.; Melck, D.; Orlando, P.; Bisogno, T.; Zagoory, O.; Bifulco, M.; Vogel, Z.; De Petrocellis, L. Palmitoylethanolamide inhibits the expression of fatty acid amide hydrolase and enhances the anti-proliferative effect of anandamide in human breast cancer cells. Biochem. J. 2001, 358, 249–255. [Google Scholar] [CrossRef]
- O’Sullivan, S.E. Cannabinoids go nuclear: Evidence for activation of peroxisome proliferator-activated receptors. Br. J. Pharmacol. 2007, 152, 576–582. [Google Scholar] [CrossRef] [PubMed]
- Ben-Shabat, S.; Fride, E.; Sheskin, T.; Tamiri, T.; Rhee, M.H.; Vogel, Z.; Bisogno, T.; De Petrocellis, L.; Di Marzo, V.; Mechoulam, R. An entourage effect: Inactive endogenous fatty acid glycerol esters enhance 2-arachidonoyl-glycerol cannabinoid activity. Eur. J. Pharmacol. 1998, 353, 23–31. [Google Scholar] [CrossRef]
- Tsuboi, K.; Uyama, T.; Okamoto, Y.; Ueda, N. Endocannabinoids and related N-acylethanolamines: Biological activities and metabolism. Inflamm. Regen. 2018, 38, 28. [Google Scholar] [CrossRef]
- Parker, L.A.; Rock, E.M.; Limebeer, C.L. Regulation of nausea and vomiting by cannabinoids. Br. J. Pharmacol. 2011, 163, 1411–1422. [Google Scholar] [CrossRef] [Green Version]
- Sagar, D.R.; Kendall, D.A.; Chapman, V. Inhibition of fatty acid amide hydrolase produces PPAR-alpha-mediated analgesia in a rat model of inflammatory pain. Br. J. Pharmacol. 2008, 155, 1297–1306. [Google Scholar] [CrossRef]
- Ahn, K.; Johnson, D.S.; Cravatt, B.F. Fatty acid amide hydrolase as a potential therapeutic target for the treatment of pain and CNS disorders. Expert Opin. Drug Discov. 2009, 4, 763–784. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bortolato, M.; Mangieri, R.A.; Fu, J.; Kim, J.H.; Arguello, O.; Duranti, A.; Tontini, A.; Mor, M.; Tarzia, G.; Piomelli, D. Antidepressant-like activity of the fatty acid amide hydrolase inhibitor URB597 in a rat model of chronic mild stress. Biol. Psychiatry 2007, 62, 1103–1110. [Google Scholar] [CrossRef]
- Celorrio, M.; Fernandez-Suarez, D.; Rojo-Bustamante, E.; Echeverry-Alzate, V.; Ramirez, M.J.; Hillard, C.J.; Lopez-Moreno, J.A.; Maldonado, R.; Oyarzabal, J.; Franco, R.; et al. Fatty acid amide hydrolase inhibition for the symptomatic relief of Parkinson’s disease. Brain Behav. Immun. 2016, 57, 94–105. [Google Scholar] [CrossRef]
- Selvaraj, P.; Wen, J.; Tanaka, M.; Zhang, Y. Therapeutic Effect of a Novel Fatty Acid Amide Hydrolase Inhibitor PF04457845 in the Repetitive Closed Head Injury Mouse Model. J. Neurotrauma. 2019. [Google Scholar] [CrossRef]
- Tchantchou, F.; Tucker, L.B.; Fu, A.H.; Bluett, R.J.; McCabe, J.T.; Patel, S.; Zhang, Y. The fatty acid amide hydrolase inhibitor PF-3845 promotes neuronal survival, attenuates inflammation and improves functional recovery in mice with traumatic brain injury. Neuropharmacology 2014, 85, 427–439. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Al Kury, L.T.; Voitychuk, O.I.; Yang, K.H.; Thayyullathil, F.T.; Doroshenko, P.; Ramez, A.M.; Shuba, Y.M.; Galadari, S.; Howarth, F.C.; Oz, M. Effects of the endogenous cannabinoid anandamide on voltage-dependent sodium and calcium channels in rat ventricular myocytes. Br. J. Pharmacol. 2014, 171, 3485–3498. [Google Scholar] [CrossRef] [Green Version]
- Vignali, M.; Benfenati, V.; Caprini, M.; Anderova, M.; Nobile, M.; Ferroni, S. The endocannabinoid anandamide inhibits potassium conductance in rat cortical astrocytes. Glia 2009, 57, 791–806. [Google Scholar] [CrossRef] [PubMed]
- Eljaschewitsch, E.; Witting, A.; Mawrin, C.; Lee, T.; Schmidt, P.M.; Wolf, S.; Hoertnagl, H.; Raine, C.S.; Schneider-Stock, R.; Nitsch, R.; et al. The endocannabinoid anandamide protects neurons during CNS inflammation by induction of MKP-1 in microglial cells. Neuron 2006, 49, 67–79. [Google Scholar] [CrossRef] [PubMed]
- Hernangomez, M.; Mestre, L.; Correa, F.G.; Loria, F.; Mecha, M.; Inigo, P.M.; Docagne, F.; Williams, R.O.; Borrell, J.; Guaza, C. CD200-CD200R1 interaction contributes to neuroprotective effects of anandamide on experimentally induced inflammation. Glia 2012, 60, 1437–1450. [Google Scholar] [CrossRef] [Green Version]
- Li, H.; Wood, J.T.; Whitten, K.M.; Vadivel, S.K.; Seng, S.; Makriyannis, A.; Avraham, H.K. Inhibition of fatty acid amide hydrolase activates Nrf2 signalling and induces heme oxygenase 1 transcription in breast cancer cells. Br. J. Pharmacol. 2013, 170, 489–505. [Google Scholar] [CrossRef] [Green Version]
- Benito, C.; Tolon, R.M.; Castillo, A.I.; Ruiz-Valdepenas, L.; Martinez-Orgado, J.A.; Fernandez-Sanchez, F.J.; Vazquez, C.; Cravatt, B.F.; Romero, J. beta-Amyloid exacerbates inflammation in astrocytes lacking fatty acid amide hydrolase through a mechanism involving PPAR-alpha, PPAR-gamma and TRPV1, but not CB(1) or CB(2) receptors. Br. J. Pharmacol. 2012, 166, 1474–1489. [Google Scholar] [CrossRef] [PubMed]
- Bosier, B.; Muccioli, G.G.; Lambert, D.M. The FAAH inhibitor URB597 efficiently reduces tyrosine hydroxylase expression through CB(1)- and FAAH-independent mechanisms. Br. J. Pharmacol. 2013, 169, 794–807. [Google Scholar] [CrossRef] [PubMed]
- Masocha, W. Systemic lipopolysaccharide (LPS)-induced microglial activation results in different temporal reduction of CD200 and CD200 receptor gene expression in the brain. J. Neuroimmunol. 2009, 214, 78–82. [Google Scholar] [CrossRef]
- Franco, R.; Fernandez-Suarez, D. Alternatively activated microglia and macrophages in the central nervous system. Prog. Neurobiol. 2015, 131, 65–86. [Google Scholar] [CrossRef]
- Malek, N.; Popiolek-Barczyk, K.; Mika, J.; Przewlocka, B.; Starowicz, K. Anandamide, Acting via CB2 Receptors, Alleviates LPS-Induced Neuroinflammation in Rat Primary Microglial Cultures. Neural. Plast. 2015, 2015, 130639. [Google Scholar] [CrossRef]
- Mecha, M.; Carrillo-Salinas, F.J.; Feliu, A.; Mestre, L.; Guaza, C. Microglia activation states and cannabinoid system: Therapeutic implications. Pharmacol. Ther. 2016, 166, 40–55. [Google Scholar] [CrossRef] [PubMed]
- Muccioli, G.G.; Xu, C.; Odah, E.; Cudaback, E.; Cisneros, J.A.; Lambert, D.M.; Lopez Rodriguez, M.L.; Bajjalieh, S.; Stella, N. Identification of a novel endocannabinoid-hydrolyzing enzyme expressed by microglial cells. J. Neurosci. 2007, 27, 2883–2889. [Google Scholar] [CrossRef]
- Ribeiro, R.; Wen, J.; Li, S.; Zhang, Y. Involvement of ERK1/2, cPLA2 and NF-kappaB in microglia suppression by cannabinoid receptor agonists and antagonists. Prostaglandins Other Lipid Mediat. 2013, 100–101, 1–14. [Google Scholar] [CrossRef]
- Navarrete, C.M.; Fiebich, B.L.; de Vinuesa, A.G.; Hess, S.; de Oliveira, A.C.; Candelario-Jalil, E.; Caballero, F.J.; Calzado, M.A.; Munoz, E. Opposite effects of anandamide and N-arachidonoyl dopamine in the regulation of prostaglandin E and 8-iso-PGF formation in primary glial cells. J. Neurochem. 2009, 109, 452–464. [Google Scholar] [CrossRef] [PubMed]
- Tham, C.S.; Whitaker, J.; Luo, L.; Webb, M. Inhibition of microglial fatty acid amide hydrolase modulates LPS stimulated release of inflammatory mediators. FEBS Lett. 2007, 581, 2899–2904. [Google Scholar] [CrossRef] [Green Version]
- Piomelli, D.; Tarzia, G.; Duranti, A.; Tontini, A.; Mor, M.; Compton, T.R.; Dasse, O.; Monaghan, E.P.; Parrott, J.A.; Putman, D. Pharmacological profile of the selective FAAH inhibitor KDS-4103 (URB597). CNS Drug Rev. 2006, 12, 21–38. [Google Scholar] [CrossRef]
- Alexander, J.P.; Cravatt, B.F. Mechanism of carbamate inactivation of FAAH: Implications for the design of covalent inhibitors and in vivo functional probes for enzymes. Chem. Biol. 2005, 12, 1179–1187. [Google Scholar] [CrossRef]
- Ahn, K.; Johnson, D.S.; Mileni, M.; Beidler, D.; Long, J.Z.; McKinney, M.K.; Weerapana, E.; Sadagopan, N.; Liimatta, M.; Smith, S.E.; et al. Discovery and characterization of a highly selective FAAH inhibitor that reduces inflammatory pain. Chem. Biol. 2009, 16, 411–420. [Google Scholar] [CrossRef]
- Johnson, D.S.; Ahn, K.; Kesten, S.; Lazerwith, S.E.; Song, Y.; Morris, M.; Fay, L.; Gregory, T.; Stiff, C.; Dunbar, J.B.; et al. Benzothiophene piperazine and piperidine urea inhibitors of fatty acid amide hydrolase (FAAH). Bioorg. Med. Chem. Lett. 2009, 19, 2865–2869. [Google Scholar] [CrossRef] [Green Version]
- Ahn, K.; Smith, S.E.; Liimatta, M.B.; Beidler, D.; Sadagopan, N.; Dudley, D.T.; Young, T.; Wren, P.; Zhang, Y.; Swaney, S.; et al. Mechanistic and pharmacological characterization of PF-04457845: A highly potent and selective fatty acid amide hydrolase inhibitor that reduces inflammatory and noninflammatory pain. J. Pharmacol. Exp. Ther. 2011, 338, 114–124. [Google Scholar] [CrossRef]
- Mecha, M.; Feliu, A.; Carrillo-Salinas, F.J.; Rueda-Zubiaurre, A.; Ortega-Gutierrez, S.; de Sola, R.G.; Guaza, C. Endocannabinoids drive the acquisition of an alternative phenotype in microglia. Brain Behav. Immun. 2015, 49, 233–245. [Google Scholar] [CrossRef]
- Ma, L.; Jia, J.; Liu, X.; Bai, F.; Wang, Q.; Xiong, L. Activation of murine microglial N9 cells is attenuated through cannabinoid receptor CB2 signaling. Biochem. Biophys. Res. Commun. 2015, 458, 92–97. [Google Scholar] [CrossRef]
- Tao, Y.; Li, L.; Jiang, B.; Feng, Z.; Yang, L.; Tang, J.; Chen, Q.; Zhang, J.; Tan, Q.; Feng, H.; et al. Cannabinoid receptor-2 stimulation suppresses neuroinflammation by regulating microglial M1/M2 polarization through the cAMP/PKA pathway in an experimental GMH rat model. Brain Behav. Immun. 2016, 58, 118–129. [Google Scholar] [CrossRef] [PubMed]
- Moreno-Galindo, E.G.; Barrio-Echavarria, G.F.; Vasquez, J.C.; Decher, N.; Sachse, F.B.; Tristani-Firouzi, M.; Sanchez-Chapula, J.A.; Navarro-Polanco, R.A. Molecular basis for a high-potency open-channel block of Kv1.5 channel by the endocannabinoid anandamide. Mol. Pharmacol. 2010, 77, 751–758. [Google Scholar] [CrossRef]
- Espinosa-Parrilla, J.F.; Martinez-Moreno, M.; Gasull, X.; Mahy, N.; Rodriguez, M.J. The L-type voltage-gated calcium channel modulates microglial pro-inflammatory activity. Mol. Cell Neurosci. 2015, 64, 104–115. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Long, J.Z.; LaCava, M.; Jin, X.; Cravatt, B.F. An anatomical and temporal portrait of physiological substrates for fatty acid amide hydrolase. J. Lipid Res. 2011, 52, 337–344. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Saghatelian, A.; McKinney, M.K.; Bandell, M.; Patapoutian, A.; Cravatt, B.F. A FAAH-regulated class of N-acyl taurines that activates TRP ion channels. Biochemistry 2006, 45, 9007–9015. [Google Scholar] [CrossRef]
- Sasso, O.; Pontis, S.; Armirotti, A.; Cardinali, G.; Kovacs, D.; Migliore, M.; Summa, M.; Moreno-Sanz, G.; Picardo, M.; Piomelli, D. Endogenous N-acyl taurines regulate skin wound healing. Proc. Natl. Acad. Sci. USA 2016, 113, E4397–E4406. [Google Scholar] [CrossRef] [PubMed]
- Alhouayek, M.; Bottemanne, P.; Makriyannis, A.; Muccioli, G.G. N-acylethanolamine-hydrolyzing acid amidase and fatty acid amide hydrolase inhibition differentially affect N-acylethanolamine levels and macrophage activation. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2017, 1862, 474–484. [Google Scholar] [CrossRef] [PubMed]
- Aparicio, N.; Grande, M.T.; Ruiz de Martin Esteban, S.; Lopez, A.; Ruiz-Perez, G.; Amores, M.; Vazquez, C.; Martinez-Relimpio, A.M.; Pazos, M.R.; Cravatt, B.F.; et al. Role of interleukin 1-beta in the inflammatory response in a fatty acid amide hydrolase-knockout mouse model of Alzheimer’s disease. Biochem. Pharmacol. 2018, 157, 202–209. [Google Scholar] [CrossRef] [PubMed]
Gene 1 | Sense Primer | Anti-Sense Primer |
---|---|---|
Arg1 | AGCCAATGAAGAGCTGGCTGGT | AACTGCCAGACTGTGGTCTCCA |
Ptgs2(Cox2) | GAAATGGCTGCAGAATTGAA | AAGGAGAATGGTGCTCCAAG |
Faah | CAACTACACCATGCCCACTC | GACCTCCAGGGCATAAGGTA |
Gapdh | AGGTCGGTGTGAACGGATTTG | TGTAGACCATGTAGTTGAGGTCA |
Il4 | GGTCTCAACCCCCAGCTAGT | GCCGATGATCTCTCTCAAGTGAT |
Il6 | TAGTCCTTCCTACCCCAATTTCC | TTGGTCCTTAGCCACTCCTTC |
Il10 | GCTCTTACTGACTGGCATGAG | CGCAGCTCTAGGAGCATGTG |
Il1b | GCAACTGTTCCTGAACTCAACT | ATCTTTTGGGGTCCGTCAACT |
Nos2 (iNOS) | ACCTTGTTCAGCTACGCCTT | CATTCCCAAATGTGCTTGTC |
Ccl2 (MCP1) | TTAAAAACCTGGATCGGAACCAA | GCATTAGCTTCAGATTTACGGGT |
Ptges (mPGES1) | TGTCCAAATCCTGTCTTCCA | GGTTCTGGAGCACACCCTAT |
Ptges2 (mPGES2) | GAAATGGCTGCAGAATTGAA | AAGGAGAATGGTGCTCCAAG |
Tnf (TNF-α) | CCCTCACACTCAGATCATCTTCT | GCTACGACGTGGGCTACAG |
Ym1 | CAGGTCTGGCAATTCTTCTGAA | GTCTTGCTCATGTGTGTAAGTGA |
Treatment | COX-2 | IL-1β | MCP1 |
---|---|---|---|
LPS | 1.00 ± 0.05 | 1.00 ± 0.07 | 1.00 ± 0.06 |
LPS+PF | 0.34 ± 0.01 1 | 0.16 ± 0.00 1 | 0.30 ± 0.00 1 |
LPS+PF+SR1 | 0.29 ± 0.02 | 0.16 ± 0.00 | 0.26 ± 0.01 |
LPS+PF+SR2 | 0.35 ± 0.02 | 0.16 ± 0.01 | 0.26 ± 0.02 |
LPS+PF+GW6471 | 0.21 ± 0.04 | 0.06 ± 0.01 | 0.24 ± 0.04 |
LPS+PF+GW9662 | 0.39 ± 0.03 | 0.19 ± 0.01 | 0.32 ± 0.04 |
LPS+PF+O1918 | 0.39 ± 0.01 | 0.19 ± 0.01 | 0.33 ± 0.03 |
Treatment | COX-2 | IL-1β | MCP1 |
---|---|---|---|
siNC | 1.00 ± 0.22 | 1.00 ± 0.25 | 1.00 ± 0.18 |
siFAAH | 0.44 ± 0.12 1 | 0.25 ± 0.11 1 | 0.28 ± 0.10 1 |
siFAAH+SR1 | 0.37 ± 0.11 | 0.15 ± 0.06 | 0.32 ± 0.04 |
siFAAH+SR2 | 0.33 ± 0.04 | 0.15 ± 0.05 | 0.26 ± 0.05 |
siFAAH+GW6471 | 0.30 ± 0.05 | 0.13 ± 0.04 | 0.32 ± 0.04 |
siFAAH+GW9662 | 0.38 ± 0.09 | 0.16 ± 0.05 | 0.34 ± 0.08 |
siFAAH+O1918 | 0.42 ± 0.12 | 0.20 ± 0.07 | 0.37 ± 0.05 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tanaka, M.; Yagyu, K.; Sackett, S.; Zhang, Y. Anti-Inflammatory Effects by Pharmacological Inhibition or Knockdown of Fatty Acid Amide Hydrolase in BV2 Microglial Cells. Cells 2019, 8, 491. https://0-doi-org.brum.beds.ac.uk/10.3390/cells8050491
Tanaka M, Yagyu K, Sackett S, Zhang Y. Anti-Inflammatory Effects by Pharmacological Inhibition or Knockdown of Fatty Acid Amide Hydrolase in BV2 Microglial Cells. Cells. 2019; 8(5):491. https://0-doi-org.brum.beds.ac.uk/10.3390/cells8050491
Chicago/Turabian StyleTanaka, Mikiei, Kazuya Yagyu, Scott Sackett, and Yumin Zhang. 2019. "Anti-Inflammatory Effects by Pharmacological Inhibition or Knockdown of Fatty Acid Amide Hydrolase in BV2 Microglial Cells" Cells 8, no. 5: 491. https://0-doi-org.brum.beds.ac.uk/10.3390/cells8050491