DLO-HiC Analyse Tool

2020-2-24 16:59:39

Running information

Configure information

Input file: DLO-HIC-Lane2-1_combined_R1.fastq.gz Min Linker length: 32
Output folder: . Max reads length: 20
Output prefix: K562-MseI-rep3-NoIter Match score: 1
Genome file: /public/home/hjiang/data/fasta/Hg19-HP.fa MisMatch score: -1
Genome index prefix: /public/home/hjiang/data/index/Hg19-HP InDel score: -1
HalfLinkerA: GTCGGAGAACCAGTAGCT Resolution: 1000000
HalfLinkerB: Thread: 16
Restriction: T^TAA    

Linker Filter

Basic statistics

Adapter Sequence: GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCCCGTATGCCGTCTTCTGCTTGAAAAAAAAA
Total reads: 262,150,931 100.00%
AA: 231,638,584 88.36%
Ambiguous: 30,512,347 11.64%
Valid pair: 231,617,696 88.35%
Output folder: ./01.PreProcess

Base distribution in adapter detection

Linker alignment score distribution

Tag length distribution

Alignment

Basic statistics

  • Linker AA: GTCGGAGAACCAGTAGCTAGCTACTGGTTCTCCGAC

    Item Number Percentage Item Number Percentage
    Fastq file R1: 231,617,696 100.00% Fastq file R2: 231,617,696 100.00%
    Unique map R1: 178,978,021 77.27% Unique map R2: 176,490,219 76.20%
    Multi map R1: 41,097,271 17.74% Multi map R2: 40,836,508 17.63%
    Unmap R1: 11,542,403 4.98% Unmap R2: 14,290,969 6.17%
    Merge: 141,840,306 61.24%      
    Output folder: ./02.Alignment

    • Noise Reduction

    Basic statistics

    Input: 141,840,306

    Item Number Percentage
    Self-Ligation: 374,901 0.26%
    ReLigation: 941,852 0.66%
    Duplicate: 11,320,066 7.98%
    Clean data: 129,203,487 91.09%
    Intra-chrom: 107,014,197 82.83%
    Inter-chrom: 22,189,290 17.17%
    Short range: 25,112,008 23.47%
    Long range: 81,902,189 76.53%

    Orientation-Position statistics

    '+' and '-' represent the orientation of alignment, 's' means reads located in the 5' end of restriction fragment and 't' means reads located in the 3' end of restriction fragment

      s,s s,t t,s t,t
    +,+ 378,948 15,772,559 15,987,520 112,356
    +,- 16,090,609 223,671 272,802 15,782,325
    -,+ 16,081,437 271,439 224,411 15,766,409
    -,- 442,222 15,760,892 15,959,727 76,160

    Annotation statistics

    Interaction distance distribution

    Matrix report

    Basic statistics

    Interaction heatmap

  • Resolution 1,000,000 bp

    • Running time

    Item Value(h/m/s)
    Start time: Mon Feb 24 13:28:13 CST 2020
    Linker filtering: 0H54M20S
    Mapping: 1H44M36S
    Noise Reduction: 0H36M41S
    Create matrix: 0H15M22S
    Total: 3H31M0S