Next Article in Journal
HEDGEHOG/GLI Modulates the PRR11-SKA2 Bidirectional Transcription Unit in Lung Squamous Cell Carcinomas
Next Article in Special Issue
The Diversity and Evolution of Sex Chromosomes in Frogs
Previous Article in Journal
Whole Genome Analysis of Environmental Pseudomonas mendocina Strains: Virulence Mechanisms and Phylogeny
Previous Article in Special Issue
Highly Rearranged Karyotypes and Multiple Sex Chromosome Systems in Armored Catfishes from the Genus Harttia (Teleostei, Siluriformes)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Genes
Volume 12
Issue 1
10.3390/genes12010116
genes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Sex Chromosome Turnover in Bent-Toed Geckos (Cyrtodactylus)

by
Shannon E. Keating
1,*,
Madison Blumer
2,
L. Lee Grismer
3,
Aung Lin
4,
Stuart V. Nielsen
1,5,6,
Myint Kyaw Thura
7,
Perry L. Wood, Jr.
8,
Evan S. H. Quah
9 and
Tony Gamble
1,10,11
1
Department of Biological Sciences, Marquette University, Milwaukee, WI 53233, USA
2
Keck Science Department, Scripps College, Claremont, CA 91711, USA
3
Herpetology Laboratory, Department of Biology, La Sierra University, Riverside, CA 92515, USA
4
Fauna and Flora International, No (35), 3rd Floor, Shan Gone Condo, Myay Ni Gone Market Street, Sanchaung Township, Yangon 11111, Myanmar
5
Department of Natural Sciences, University of Michigan-Dearborn, Dearborn, MI 48128, USA
6
Department of Herpetology, Florida Museum of Natural History, Gainesville, FL 31611, USA
7
Myanmar Environment Sustainable Conservation, Yangon 11181, Myanmar
8
Department of Biological Sciences and Museum of Natural History, Auburn University, Auburn, AL 36849, USA
9
Institute of Tropical Biodiversity and Sustainable Development, University Malaysia Terengganu, Kuala Nerus, Terengganu 21030, Malaysia
10
Milwaukee Public Museum, 800 W. Wells St., Milwaukee, WI 53233, USA
11
Bell Museum of Natural History, University of Minnesota, 2088 Larpenteur Ave. W., St. Paul, MN 55113, USA
 
add Show full affiliation list
 
remove Hide full affiliation list
*
Author to whom correspondence should be addressed.
Genes 2021, 12(1), 116; https://0-doi-org.brum.beds.ac.uk/10.3390/genes12010116
Submission received: 31 December 2020 / Revised: 13 January 2021 / Accepted: 14 January 2021 / Published: 19 January 2021
(This article belongs to the Special Issue Vertebrate Karyotype Evolution: How Far Have We Come, and Where Are We Going?)
Browse Figures
Review Reports Versions Notes

Abstract

:
Lizards and snakes (squamates) are known for their varied sex determining systems, and gecko lizards are especially diverse, having evolved sex chromosomes independently multiple times. While sex chromosomes frequently turnover among gecko genera, intrageneric turnovers are known only from Gekko and Hemidactylus. Here, we used RADseq to identify sex-specific markers in two species of Burmese bent-toed geckos. We uncovered XX/XY sex chromosomes in Cyrtodactylus chaunghanakwaensis and ZZ/ZW sex chromosomes in Cyrtodactylus pharbaungensis. This is the third instance of intrageneric turnover of sex chromosomes in geckos. Additionally, Cyrtodactylus are closely related to another genus with intrageneric turnover, Hemidactylus. Together, these data suggest that sex chromosome turnover may be common in this clade, setting them apart as exceptionally diverse in a group already known for diverse sex determination systems.
Keywords:
Gekkota; lizard; RADseq; synteny

1. Introduction

Squamate reptiles (lizards and snakes) have evolved a number of different sex-determining systems [1,2,3,4,5,6,7,8], but gekkotan lizards stand out in terms of their diversity. The ancestor of geckos is hypothesized to have temperature-dependent sex determination (TSD) followed by repeated transitions to both XX/XY and ZZ/ZW sex chromosomes with some species retaining the ancestral TSD [3,5]. Gecko sex determination is so labile that there are even two gecko genera that exhibit intrageneric transitions. Hemidactylus and Gekko include species with both XX/XY and ZZ/ZW sex chromosomes [5,9,10,11]. The repeated sex chromosome turnovers in geckos provide opportunities for focused study on the evolutionary forces driving sex chromosome transitions and their early evolution. By identifying additional turnover events, we increase our power to investigate these fundamental evolutionary questions.
Bent-toed geckos (Cyrtodactylus) are the most species rich gecko genus with >300 described species distributed throughout South and Southeast Asia and Oceania [12,13,14,15,16,17]. Despite this diversity, we only know the sex-determining system of one species, the Bornean endemic Cyrtodactylus pubisulcus, whose ZZ/ZW sex chromosomes were identified through traditional cytogenetics [18]. Other Cyrtodactylus karyotypes have failed to reveal heteromorphic, or visually distinct, sex chromosomes [18,19]. Nonetheless, investigating Cyrtodactylus sex chromosomes is a worthwhile endeavor because Cyrtodactylus is closely related to the aforementioned Hemidactylus, a genus with both XX/XY and ZZ/ZW species [12,20]. It stands to reason that the plasticity observed within Hemidactylus may extend to Cyrtodactylus.
Here, we investigated sex chromosome systems in two species of bent-toed geckos from Myanmar. Using restriction-site-associated DNA sequencing (RADseq [21]), we found that Cyrtodactylus pharbaungensis possesses a ZZ/ZW sex chromosome system, while Cyrtodactylus chaunghanakwaensis has an XX/XY system. When considered in light of the previously recognized ZZ/ZW system in C. pubisulcus [18], these results indicate at least one turnover has occurred within Cyrtodactylus. This discovery further highlights the extraordinary number of transitions among gekkotan sex chromosomes and the enormous gap in our knowledge surrounding the phylogenetic distribution of gecko sex chromosomes and evolutionary processes that lead to sex chromosome transitions.

2. Materials and Methods

Cyrtodactylus chaunghanakwaensis [22] and C. pharbaungensis [23] are range-restricted endemics known only from small isolated karstic hills from Mon State in the Salween Basin of southern Myanmar, and were collected from their type localities at Chaunghanakwa Hill and Pharbaung Cave (Supplementary Table S1). We extracted DNA from eight females and eleven males of C. pharbaungensis and ten females and nine males of C. chaunghanakwaensis using the QIAGEN DNeasy Blood and Tissue Kit. We prepared RADseq libraries using a modified protocol from Etter et al. [5,24]. Briefly, we digested genomic DNA using a high-fidelity Sbf1 restriction enzyme (New England Biolabs, Ipswich, MA, USA), and ligated individually barcoded P1 adapters to each sample. We pooled samples into multiple libraries, sonicated, and size selected for 200–500 bp fragments using magnetic beads in a PEG/NaCl buffer [25]. We then blunt-end repaired, dA-tailed, and ligated pooled libraries with P2 adapters containing unique Illumina i7 (San Diego, CA, USA) indices. We amplified pooled libraries using NEBNext Ultra II Q5 polymerase (New England Biolabs) for 16 cycles and size selected a second time for 250–650 bp fragments that now contained full Illumina adapters. Libraries were sequenced using paired-end 150-bp reads on an Illumina HiSeq X (San Diego, CA, USA) at Novogene. Cleaned RADseq reads have been deposited to NCBI SRA: SAMN17316796-SAMN17316830.
We analyzed the RADseq data using a previously described bioinformatic pipeline [5]. We demultiplexed, trimmed, and filtered raw Illumina reads using the process_radtags function in STACKS [26] (1.41). We used RADtools [27] (1.2.4) to generate RADtags for each individual and identified candidate loci and alleles from the forward reads. We then used a custom Python script [5] to identify putative sex-specific markers from the RADtools output, i.e., markers found in one sex but not the other. The script also generates a list of “confirmed” sex-specific RAD markers that excludes any sex-specific markers found in the original read files of the opposite sex, thus eliminating false positives. Finally, we used Geneious [28] (R11) to assemble the forward and reverse reads of “confirmed” sex-specific RAD markers. These loci should correspond to genomic regions unique to a single sex, the Y or W chromosome, such that female-specific markers denote a ZZ/ZW system while male-specific markers indicate an XX/XY system.
We validated a subset of the “confirmed” sex-specific markers with PCR. DNA primers (Table 1) were designed using Primer3 [29] in Geneious (R11). We tested ten markers for C. pharbaungensis using nine females and ten males and ten markers for C. chaunghanakwaensis using ten females and nine males. After PCR, markers were visualized on a 1% agarose gel to determine whether they amplified in a sex-specific pattern.
We queried sex-specified RAD markers against an assembled Hemidactylus turcicus transcriptome [30] using BLAST [31] in Geneious (R11). We then used BLAST to compare the matching H. turcicus transcripts to genes in the chicken (Gallus gallus) genome [32,33], as it is a commonly used point of reference when discussing synteny among amniotes [11,34,35,36,37,38,39]. By identifying the sex chromosome linkage group, we can determine whether C. pharbaungensis and C. chaunghanakwaensis have sex chromosome systems syntenic with each other or other amniote species. Alternatively, if each species has a different sex chromosome linkage group, then we can conclude they have different sex chromosomes, even if there is no difference in heterogamety.
Identifying sex chromosome turnovers is best done in a phylogenetic framework. Therefore, we generated a phylogeny of Hemidactylus and Cyrtodactylus species to combine our new results with sex chromosome data from the literature. We accessed ND2 and adjacent tRNAs for 239 Cyrtodactylus species, 61 Hemidactylus species, and 11 outgroup species from GenBank (Supplementary Table S2) and previous publications [16]. We aligned the sequences with Muscle [40] using the default settings in Geneious [28] and generated a maximum likelihood phylogeny using IQ-TREE (v2.1.2) [41]. We first used ModelFinder [42] to select among alternative partition schemes and models of evolution using the Bayesian information criterion (BIC) with four partitions: the first, second, and third codon of ND2, and the associated tRNAs. IQ-TREE then constructed a maximum likelihood tree using the selected models. Nodal support was generated with 1000 ultrafast bootstrap approximations (UFBoot [43]). We used least-square dating (LSD2 [44]) to generate a time tree using secondary calibrations from Gamble et al. [45], utilizing several calibration points between Hemidactylus and Cyrtodactylus species as well as the outgroups. Confidence intervals were generated with 100 replicates.
All experiments were carried out in accordance with animal use protocols under the Brigham Young University’s Institutional Animal Care and Use Committee (IACUC protocol #160401). Export and collection permits were issued by Mr. Win Naing Thaw of the Ministry of Natural Resources and Environmental Conservation Forest Department.

3. Results

RADseq analysis for C. pharbaungensis included eleven males and four females—barcode errors resulted in several of the female samples not being used for subsequent analysis. We identified 153,555 RAD loci with two or fewer alleles. Of these, 652 markers were female-specific and none were male-specific. We checked the sex-specific markers against the reads from the opposite sex and retained 646 “confirmed” female-specific RAD markers. We designed PCR primers for ten markers and validated two as sex-specific (Figure 1A). Marker CyrtP_253 produced a small band in females (~400 bp) and a larger band in males (~900 bp). These PCR products correspond to amplification of the W allele in females and the Z allele in males. Although the Z and W alleles have diverged to the point that they are different sizes, enough sequence similarity presumably exists that the primers designed for the W allele still amplify the Z allele in males. In females, the W allele is preferentially amplified over the Z allele, producing a single band. PCR primers designed using the W allele will occasionally produce PCR products from the homogametic sex, although these are typically much fainter than those in the heterogametic sex when visualized on a gel [5,46]. Marker CyrtP_194 amplified strongly in females and not in males. These results indicate C. pharbaugensis has a ZZ/ZW sex chromosome system, and the female-specific markers are linked to the W chromosome.
We eliminated one female C. chaunghanakwaensis, LSUHC13294, from the RADseq analysis due to low read depth, leaving nine females and nine males. We identified 151,212 RAD markers. We found zero female-specific markers and 168 male-specific markers, of which 166 were “confirmed” by checking them against the original female reads. We designed PCR primers for ten markers and validated three as sex-specific. CyrtC_6, CyrtC_18, and CyrtC_151 all amplified strongly in males but not in females (Figure 1B). These results indicate a XX/XY sex chromosome system where the male-specific RAD markers are localized to the male-specific Y chromosome.
Using H. turcicus transcripts as an intermediary step (Supplemental Table S3), we identified 38 chicken genes via BLAST of female-specific C. pharbaungensis RAD markers. We observed 19 of these genes on chicken chromosome ten. This was significantly more genes than expected (expected = 1; p = 5.525818 × 10−21, Figure 2), assuming the number of expected genes with BLAST hits is proportional to the number of annotated genes on each chromosome. This suggests the ZZ/ZW sex chromosomes of C. pharbaungensis are syntenic with chicken chromosome ten. The number of genes with BLAST hits on other chromosomes was equal to or fewer than expected with the exception of chicken chromosome 12, which was not significant (observed = 2, expected = 1; p = 0.1938535; Figure 2). p-values were calculated using the hypergeometric test in R v.3.6.3 [47,48]. We were unable to confidently identify the sex linkage group for C. chaunghanakwaensis as BLAST searches returned only two genes each on different chicken linkage groups (Supplementary Table S4).
The ND2 phylogenetic tree (Figure 3A) was largely concordant with previously published phylogenies utilizing similar datasets and methods [16,51,52]. The best fit models of sequence evolution for each partition were: codon one = TVM + F + R7; codon two = TIM + F + R8; codon three = TIM + F + R7; and tRNAs = SYM + R5.

4. Discussion

Geckos are known for their diverse sex chromosome systems and frequent turnovers [5,53,54]. This includes sex chromosome transitions among species in at least two gecko genera, Hemidactylus and Gekko [5,9,10,11]. Cyrtodactylus becomes the third gecko genus with an intra-generic transition with the discovery of novel sex chromosome systems in two species of Burmese bent-toed geckos: ZZ/ZW in C. pharbaungensis and XX/XY in C. chaunghanakwaensis. Despite being a highly diverse genus with >300 species, the sex chromosome systems identified here represent only the second and third known instance of sex chromosomes in the genus. Given the phylogenetic placement of these species and C. pubisulcus, a species with ZZ/ZW sex chromosomes, at least one turnover has occurred, possibly more if the ZZ/ZW sex chromosomes of C. pharbaungensis and C. pubisulcus are not homologous (Figure 3). Hemidactylus, the sister genus to Cyrtodactylus, has likewise experienced intrageneric sex chromosome turnovers (Figure 3, [5]), suggesting the Hemidactylus + Cyrtodactylus clade may be prone to frequent turnover of sex chromosomes.
Because the vast majority of Cyrtodactylus species have yet to be studied (Figure 3A) there is almost certainly additional sex chromosome diversity within the genus. Cyrtodactylus is the most speciose gecko genus and continues to grow as new species are described every year [55,56]. However, less than 1% of species have a known sex determination system. Hemidactylus fares little better, as ~1.8% of described species have a known sex determination system. Further investigations of other Cyrtodactylus and Hemidactylus species will likely uncover additional sex chromosomes and help to localize transitions onto the phylogeny. Given the diversity of sex chromosome systems observed among Cyrtodactylus and Hemidactylus (despite the paucity of sampling), these genera form an ideal clade for studying the evolutionary drivers of rapid sex chromosome turnover and the early evolution of sex chromosomes.
Sex chromosomes evolve from autosomes and some autosomes may be more likely to make this change than others [34,57]. However, C. pharbaungensis is the first amniote shown to have sex chromosomes syntenic with chicken chromosome ten. Synteny information is vital for identifying sex chromosome turnovers, particularly cis-turnovers where a novel sex chromosome system replaces an ancestral system with the same heterogamety, for example, a novel ZZ/ZW system replacing the ancestral ZZ/ZW system or a novel XX/XY system replacing the ancestral XX/XY system. Since both C. pharbaungensis and C. pubisulcus have female heterogamety synteny data could allow us to distinguish whether these are the same or different ZZ/ZW systems. Unfortunately, karyotype data used to identify the heteromorphic sex chromosomes of C. pubisulcus do not provide any synteny information [18]. If future studies demonstrate that C. pharbaungensis and C. pubisulcus do not share homologous sex chromosomes, then all three Cyrtodactylus species studied thus far have independently derived sex chromosome systems. Alternatively, if C. pharbaungensis and C. pubisulcus have the same sex linkage group, then at least one turnover occurred in Cyrtodactylus, in which an ancestral ZZ/ZW system was maintained in both C. pharbaungensis and C. pubisulcus but transitioned to an XX/XY system in C. chaunghanakwaensis.
Mapping sex-specific Cyrtodactylus RAD markers directly to chicken did not yield useful results, but an alternative approach using the H. turcicus transcriptome as an intermediate step was successful in C. pharbaungensis. Using one or more intermediate steps for BLAST searches has been used previously to identify the sex chromosome linkage group in a frog species with limited genomic resources. In that study, Rana arvalis sex-linked markers were iteratively mapped to a Rana temporaria draft genome. Those R. temporaria fragments were mapped to the Nanorana parkeri genome. Finally, the matching N. parkeri scaffolds were mapped to the highly contiguous Xenopus tropicalis genome [58]. The increasing availability of genomic and transcriptomic data across diverse vertebrate clades should make hierarchical mapping strategies like this a routine part of identifying sex chromosome synteny.

5. Conclusions

Here, we uncovered the XX/XY sex chromosomes of C. chaunghanakwaensis and the ZZ/ZW sex chromosomes of C. pharbaungensis. These results contribute to the ever-increasing diversity of gecko sex chromosome systems. Although squamate lizards are known for a diversity of sex chromosome systems, they tend to have conserved systems within suborders or families, including scincids [59], lacertids [60], varanids [61,62], pleurodonts [63] (but see [6,8]), and caenophidian snakes [36,64]. In contrast, geckos regularly experience sex chromosome turnovers between families and genera, and, as demonstrated here, even within genera. These frequent transitions make geckos a remarkable group within the already remarkable squamates, and highlights their importance as a model for studying sex chromosome evolution.

Supplementary Materials

The following are available online at https://0-www-mdpi-com.brum.beds.ac.uk/2073-4425/12/1/116/s1, Table S1: List of Cyrtodactylus chaunghanakwaensis and C. pharbaungensis specimens used for RADseq and PCR, Table S2: List of specimens, voucher ID, and GenBank Accession Number for the ND2 sequence data, Table S3: Results from BLAST of female-specific Cyrtodactylus pharbaungensis RAD contigs, Table S4: Results from BLAST of male-specific Cyrtodactylus chaunghanakwaensis RAD contigs.

Author Contributions

S.E.K., S.V.N. and T.G. conceptualized the study; P.L.W.J., L.L.G., A.L., E.S.H.Q., and M.K.T. performed the fieldwork; S.E.K., M.B., and S.V.N. performed the lab work; S.E.K. and T.G. performed the analyses and designed and co-drafted the manuscript. All authors contributed to reviewing and editing the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by grants from the National Science Foundation DBI1659595 (REU awarded to A. Abbott and E. Blumenthal, Marquette University). Fieldwork for P.L.W.J. was supported by the Monte L. Bean Life Science Museum.

Institutional Review Board Statement

All experiments were carried out in accordance with animal use protocols under the Brigham Young University’s Institutional Animal Care and Use Committee (IACUC protocol #160401). Export and collection permits were issued by Win Na-ing Thaw of the Ministry of Natural Resources and Environmental Conservation Forest Department.

Data Availability Statement

The RADseq data are available at the NCBI Short Read Archive Bioproject PRJNA692216.

Acknowledgments

This paper is contribution number 939 of the Auburn University Museum of Natural History.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Ezaz, T.; Quinn, A.E.; Miura, I.; Sarre, S.D.; Georges, A.; Graves, J.A.M. The dragon lizard Pogona vitticeps has ZZ/ZW micro-sex chromosomes. Chromosome Res. 2005, 13, 763–776. [Google Scholar] [CrossRef] [PubMed]
  2. Ezaz, T.; Sarre, S.; O’Meally, D.; Graves, J.M.; Georges, A. Sex chromosome evolution in lizards: Independent origins and rapid transitions. Cytogenet. Genome Res. 2009, 127, 249–260. [Google Scholar] [CrossRef] [PubMed]
  3. Pokorna, M.; Kratochvíl, L. Phylogeny of sex-determining mechanisms in squamate reptiles: Are sex chromosomes an evolutionary trap? Zool. J. Linn. Soc. 2009, 156, 168–183. [Google Scholar] [CrossRef] [Green Version]
  4. Gamble, T.; Geneva, A.J.; Glor, R.E.; Zarkower, D. Anolis Sex chromosomes are derived from a single ancestral pair. Evolution 2014, 68, 1027–1041. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Gamble, T.; Coryell, J.; Ezaz, T.; Lynch, J.; Scantlebury, D.P.; Zarkower, D. Restriction site-associated DNA sequencing (RAD-Seq) reveals an extraordinary number of transitions among gecko sex-determining systems. Mol. Biol. Evol. 2015, 32, 1296–1309. [Google Scholar] [CrossRef] [Green Version]
  6. Altmanová, M.; Rovatsos, M.; Pokorná, M.J.; Veselý, M.; Wagner, F.; Kratochvíl, L. All iguana families with the exception of basilisks share sex chromosomes. Zoology 2018, 126, 98–102. [Google Scholar] [CrossRef]
  7. Nielsen, S.V.; Banks, J.; Diaz, R., Jr.; Trainor, P.; Gamble, T. Dynamic sex chromosomes in Old World chameleons (Squamata: Chamaeleonidae). J. Evol. Biol. 2018, 31, 484–490. [Google Scholar] [CrossRef] [Green Version]
  8. Nielsen, S.V.; Guzmán-Méndez, I.A.; Gamble, T.; Blumer, M.; Pinto, B.J.; Kratochvíl, L.; Rovatsos, M. Escaping the evolutionary trap? Sex chromosome turnover in basilisks and related lizards (Corytophanidae: Squamata). Biol. Lett. 2019, 15, 20190498. [Google Scholar] [CrossRef]
  9. Yoshida, M.; Itoh, M. Karyotype of the gekko Gekko Japonicus. Chrom. Inf. Serv. 1974, 17, 29–31. [Google Scholar]
  10. Solleder, E.; Schmid, M. XX/XY-Sex Chromosomes in Gekko gecko (Sauria, Reptilia). Amphib. Reptil. 1984, 5, 339–345. [Google Scholar] [CrossRef]
  11. Kawai, A.; Ishijima, J.; Nishida, C.; Kosaka, A.; Ota, H.; Kohno, S.; Matsuda, Y. The ZW sex chromosomes of Gekko hokouensis (Gekkonidae, Squamata) represent highly conserved homology with those of avian species. Chromosoma 2009, 118, 43–51. [Google Scholar] [CrossRef] [PubMed]
  12. Wood, P.L., Jr.; Heinicke, M.P.; Jackman, T.R.; Bauer, A.M. Phylogeny of bent-toed geckos (Cyrtodactylus) reveals a west to east pattern of diversification. Mol. Phylogenet. Evol. 2012, 65, 992–1003. [Google Scholar] [CrossRef] [PubMed]
  13. Das, I.; van Dijk, P.P. Species richness and endemicity of the herpetofauna of South and Southeast Asia. Raffles Bull. Zool. 2013, 29, 269–277. [Google Scholar]
  14. Brennan, I.G.; Bauer, A.M.; Van Tri, N.; Wang, Y.; Wang, W.; Zhang, Y.-P.; Murphy, R.W. Barcoding utility in a mega-diverse, cross-continental genus: Keeping pace with Cyrtodactylus geckos. Sci. Rep. 2017, 7, 1–11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Grismer, L.L.; Wood, P.J.; Thura, M.K.; Quah, E.S.; Grismer, M.S.; Murdoch, M.L.; Espinoza, R.E.; Lin, A. A new Cyrtodactylus Gray, 1827 (Squamata, Gekkonidae) from the Shan Hills and the biogeography of bent-toed geckos from Eastern Myanmar. Zootaxa 2018, 4446, 477–500. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Grismer, L.L.; Wood, P.L., Jr.; Le, M.D.; Quah, E.S.; Grismer, J.L. Evolution of habitat preference in 243 species of bent-toed geckos (genus Cyrtodactylus Gray, 1827) with a discussion of karst habitat conservation. Ecol. Evol. 2020, 10. [Google Scholar] [CrossRef]
  17. Grismer, L.L.; Wood, P.L., Jr.; Poyarkov, N.A.; Le, M.D.; Kraus, F.; Agarwal, I.; Oliver, P.M.; Nguyen, S.N.; Nguyen, T.Q.; Karunarathna, S.; et al. Phylogenetic partitioning of the third-largest vertebrate genus in the world, Cyrtodactylus Gray, 1827 (Reptilia; Squamata; Gekkonidae) and its relevance to taxonomy and conservation. Vertebr. Zool. 2021, accepted. [Google Scholar]
  18. Ota, H.; Hikida, T.; Matsui, M.; Mori, A. Karyotypes of two species of the genus Cyrtodactylus (Squamata: Gekkonidae) from Sarawak, Malaysia. Caryologia 1992, 45, 43–49. [Google Scholar] [CrossRef] [Green Version]
  19. Thongnetr, W.; Tanomtong, A.; Prasopsin, S.; Maneechot, N.; Pinthong, K.; Patawang, I. Cytogenetic study of the bent-toed gecko (Reptilia, Gekkonidae) in Thailand; I: Chromosomal classical features and NORs characterization of Cyrtodactylus Kunyai and C. Interdigitalis. Caryologia 2019, 72, 23–28. [Google Scholar] [CrossRef]
  20. Gamble, T.; Greenbaum, E.; Jackman, T.R.; Russell, A.P.; Bauer, A.M. Repeated origin and loss of adhesive toepads in geckos. PLoS ONE 2012, 7, e39429. [Google Scholar] [CrossRef] [Green Version]
  21. Baird, N.A.; Etter, P.D.; Atwood, T.S.; Currey, M.C.; Shiver, A.L.; Lewis, Z.A.; Selker, E.U.; Cresko, W.A.; Johnson, E.A. Rapid SNP discovery and genetic mapping using sequenced RAD markers. PLoS ONE 2008, 3, e3376. [Google Scholar] [CrossRef] [PubMed]
  22. Grismer, L.L.; Wood, P.L., Jr.; Thura, M.K.; Quah, E.S.; Murdoch, M.L.; Grismer, M.S.; Herr, M.W.; Lin, A.; Kyaw, H. Three more new species of Cyrtodactylus (Squamata: Gekkonidae) from the Salween Basin of Eastern Myanmar underscore the urgent need for the conservation of Karst Habitats. J. Nat. Hist. 2018, 52, 1243–1294. [Google Scholar] [CrossRef]
  23. Grismer, L.L.; Wood, P.L., Jr.; Thura, M.K.; Zin, T.; Quah, E.S.; Murdoch, M.L.; Grismer, M.S.; Lin, A.; Kyaw, H.; Lwin, N. Twelve new species of Cyrtodactylus Gray (Squamata: Gekkonidae) from isolated limestone habitats in East-Central and Southern Myanmar demonstrate high localized diversity and unprecedented microendemism. Zool. J. Linn. Soc. 2018, 182, 862–959. [Google Scholar] [CrossRef] [Green Version]
  24. Etter, P.D.; Bassham, S.; Hohenlohe, P.A.; Johnson, E.A.; Cresko, W.A. SNP discovery and genotyping for evolutionary genetics using RAD sequencing. In Molecular Methods for Evolutionary Genetics; Humana Press: Totowa, NJ, USA, 2012; Volume 772, pp. 157–178. [Google Scholar]
  25. Rohland, N.; Reich, D. Cost-effective, high-throughput DNA sequencing libraries for multiplexed target capture. Genome Res. 2012, 22, 939–946. [Google Scholar] [CrossRef] [Green Version]
  26. Catchen, J.M.; Amores, A.; Hohenlohe, P.; Cresko, W.; Postlethwait, J.H. Stacks: Building and genotyping loci de novo from short-read sequences. G3 2011, 1, 171–182. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  27. Baxter, S.W.; Davey, J.W.; Johnston, J.S.; Shelton, A.M.; Heckel, D.G.; Jiggins, C.D.; Blaxter, M.L. Linkage mapping and comparative genomics using next-generation RAD sequencing of a non-model organism. PLoS ONE 2011, 6, e19315. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  28. Kearse, M.; Moir, R.; Wilson, A.; Stones-Havas, S.; Cheung, M.; Sturrock, S.; Buxton, S.; Cooper, A.; Markowitz, S.; Duran, C. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 2012, 28, 1647–1649. [Google Scholar] [CrossRef] [PubMed]
  29. Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3—New capabilities and interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef] [Green Version]
  30. Pinto, B.J.; Nielsen, S.V.; Gamble, T. Transcriptomic data support a nocturnal bottleneck in the ancestor of gecko lizards. Mol. Phylogenet. Evol. 2019, 141, 106639. [Google Scholar] [CrossRef]
  31. Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic Local Alignment Search Tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
  32. International Chicken Genome Sequencing Consortium. Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution. Nature 2004, 432, 695–716. [Google Scholar] [CrossRef] [PubMed]
  33. Warren, W.C.; Hillier, L.W.; Tomlinson, C.; Minx, P.; Kremitzki, M.; Graves, T.; Markovic, C.; Bouk, N.; Pruitt, K.D.; Thibaud-Nissen, F. A new chicken genome assembly provides insight into avian genome structure. G3 2017, 7, 109–117. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Graves, J.A.M.; Peichel, C.L. Are homologies in vertebrate sex determination due to shared ancestry or to limited options? Genome Biol. 2010, 11, 205. [Google Scholar] [CrossRef] [PubMed]
  35. Kawai, A.; Nishida-Umehara, C.; Ishijima, J.; Tsuda, Y.; Ota, H.; Matsuda, Y. Different origins of bird and reptile sex chromosomes inferred from comparative mapping of chicken Z-linked genes. Cytogenet. Genome Res. 2007, 117, 92–102. [Google Scholar] [CrossRef]
  36. Matsubara, K.; Tarui, H.; Toriba, M.; Yamada, K.; Nishida-Umehara, C.; Agata, K.; Matsuda, Y. Evidence for different origin of sex chromosomes in snakes, birds, and mammals and step-wise differentiation of snake sex chromosomes. Proc. Natl. Acad. Sci. USA 2006, 103, 18190–18195. [Google Scholar] [CrossRef] [Green Version]
  37. Matsuda, Y.; Nishida-Umehara, C.; Tarui, H.; Kuroiwa, A.; Yamada, K.; Isobe, T.; Ando, J.; Fujiwara, A.; Hirao, Y.; Nishimura, O. Highly conserved linkage homology between birds and turtles: Bird and turtle chromosomes are precise counterparts of each other. Chromosome Res. 2005, 13, 601–615. [Google Scholar] [CrossRef]
  38. Alföldi, J.; Di Palma, F.; Grabherr, M.; Williams, C.; Kong, L.; Mauceli, E.; Russell, P.; Lowe, C.B.; Glor, R.E.; Jaffe, J.D. The genome of the green anole lizard and a comparative analysis with birds and mammals. Nature 2011, 477, 587–591. [Google Scholar] [CrossRef] [Green Version]
  39. Pokorná, M.; Giovannotti, M.; Kratochvíl, L.; Caputo, V.; Olmo, E.; Ferguson-Smith, M.A.; Rens, W. Conservation of chromosomes syntenic with avian autosomes in squamate reptiles revealed by comparative chromosome painting. Chromosoma 2012, 121, 409–418. [Google Scholar] [CrossRef]
  40. Edgar, R.C. MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004, 32, 1792–1797. [Google Scholar] [CrossRef] [Green Version]
  41. Nguyen, L.-T.; Schmidt, H.A.; Von Haeseler, A.; Minh, B.Q. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef]
  42. Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.K.; von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat. Methods 2017, 14, 587–589. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  43. Hoang, D.T.; Chernomor, O.; Von Haeseler, A.; Minh, B.Q.; Vinh, L.S. UFBoot2: Improving the ultrafast bootstrap approximation. Mol. Biol. Evol. 2018, 35, 518–522. [Google Scholar] [CrossRef] [PubMed]
  44. To, T.-H.; Jung, M.; Lycett, S.; Gascuel, O. Fast dating using least-squares criteria and algorithms. Syst. Biol. 2016, 65, 82–97. [Google Scholar] [CrossRef] [PubMed]
  45. Gamble, T.; Greenbaum, E.; Jackman, T.R.; Bauer, A.M. Into the light: Diurnality has evolved multiple times in geckos. Biol. J. Linn. Soc 2015, 115, 896–910. [Google Scholar] [CrossRef] [Green Version]
  46. Gamble, T.; McKenna, E.; Meyer, W.; Nielsen, S.V.; Pinto, B.J.; Scantlebury, D.P.; Higham, T.E. XX/XY sex chromosomes in the South American dwarf gecko (Gonatodes Humeralis). J. Hered. 2018, 109, 462–468. [Google Scholar] [CrossRef]
  47. Kachitvichyanukul, V.; Schmeiser, B. Computer generation of hypergeometric random variates. J. Stat. Comput. Simul. 1985, 22, 127–145. [Google Scholar] [CrossRef]
  48. R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2020. [Google Scholar]
  49. Wickham, H. Ggplot2: Elegant Graphics for Data Analysis; Springer: Berlin/Heidelberg, Germany, 2016; ISBN 3-319-24277-6. [Google Scholar]
  50. Wickham, H. Reshaping data with the reshape package. J. Stat. Softw. 2007, 21, 1–20. [Google Scholar] [CrossRef]
  51. O’Connell, K.A.; Smart, U.; Sidik, I.; Riyanto, A.; Kurniawan, N.; Smith, E.N. Diversification of bent-toed geckos (Cyrtodactylus) on Sumatra and West Java. Mol. Phylogenet. Evol. 2019, 134, 1–11. [Google Scholar] [CrossRef]
  52. Carranza, S.; Arnold, E. Systematics, biogeography, and evolution of Hemidactylus geckos (Reptilia: Gekkonidae) elucidated using mitochondrial DNA sequences. Mol. Phylogenet. Evol. 2006, 38, 531–545. [Google Scholar] [CrossRef]
  53. Moritz, C. Patterns and processes of sex chromosome evolution in gekkonid lizards (Sauria: Reptilia). In Cytogenetics of Amphibians and Reptiles; Birkhäuser Verlag: Basel, Switzerland, 1990; pp. 205–219. [Google Scholar]
  54. Gamble, T. A review of sex determining mechanisms in geckos (Gekkota: Squamata). Sex. Dev. 2010, 4, 88–103. [Google Scholar] [CrossRef] [Green Version]
  55. Grismer, L.L.; Quah, E.S.; Thura, M.K. Origin, diversity, and conservation of karst-associated bent-toed geckos (Genus Cyrtodactylus) in Myanmar (Burma). Isr. J. Ecol. Evol. 2020, 1, 1–7. [Google Scholar] [CrossRef]
  56. Uetz, P.; Hošek, J.; Hallermann, J. The Reptile Database. 2020. Available online: http://www.reptile-database.org/ (accessed on 1 December 2020).
  57. O’Meally, D.; Ezaz, T.; Georges, A.; Sarre, S.D.; Graves, J.A.M. Are some chromosomes particularly good at sex? Insights from amniotes. Chromosome Res. 2012, 20, 7–19. [Google Scholar] [CrossRef] [PubMed]
  58. Brelsford, A.; Lavanchy, G.; Sermier, R.; Rausch, A.; Perrin, N. Identifying homomorphic sex chromosomes from wild-caught adults with limited genomic resources. Mol. Ecol. Res. 2017, 17, 752–759. [Google Scholar] [CrossRef] [Green Version]
  59. Kostmann, A.; Kratochvil, L.; Rovatsos, M. Poorly differentiated XX/XY sex chromosomes are widely shared across skink radiation. BioRxiv 2020. [Google Scholar] [CrossRef]
  60. Rovatsos, M.; Vukić, J.; Altmanová, M.; Johnson Pokorná, M.; Moravec, J.; Kratochvíl, L. Conservation of sex chromosomes in lacertid lizards. Mol. Ecol. 2016, 25, 3120–3126. [Google Scholar] [CrossRef] [PubMed]
  61. Iannucci, A.; Altmanová, M.; Ciofi, C.; Ferguson-Smith, M.; Milan, M.; Pereira, J.C.; Pether, J.; Rehák, I.; Rovatsos, M.; Stanyon, R. Conserved sex chromosomes and karyotype evolution in monitor lizards (Varanidae). Heredity 2019, 123, 215–227. [Google Scholar] [CrossRef]
  62. Rovatsos, M.; Rehák, I.; Velenský, P.; Kratochvíl, L. Shared ancient sex chromosomes in varanids, beaded lizards, and alligator lizards. Mol. Biol. Evol. 2019, 36, 1113–1120. [Google Scholar] [CrossRef]
  63. Rovatsos, M.; Pokorná, M.; Altmanová, M.; Kratochvíl, L. Cretaceous park of sex determination: Sex chromosomes are conserved across iguanas. Biol. Lett. 2014, 10, 20131093. [Google Scholar] [CrossRef]
  64. Vicoso, B.; Emerson, J.; Zektser, Y.; Mahajan, S.; Bachtrog, D. Comparative sex chromosome genomics in snakes: Differentiation, evolutionary strata, and lack of global dosage compensation. PLoS Biol. 2013, 11, e1001643. [Google Scholar] [CrossRef] [Green Version]
Genes 12 00116 g001 550
Figure 1. PCR validation of female-specific RAD markers in C. pharbaugensis (A) and male-specific RAD markers in C. chaunghanakwaensis (B). Specimen IDs are located beneath gels. Negative control and DNA ladder (Thermo Scientific GeneRuler 100 bp DNA ladder, Waltham, MA, USA) are shown on the right of each gel.
Figure 1. PCR validation of female-specific RAD markers in C. pharbaugensis (A) and male-specific RAD markers in C. chaunghanakwaensis (B). Specimen IDs are located beneath gels. Negative control and DNA ladder (Thermo Scientific GeneRuler 100 bp DNA ladder, Waltham, MA, USA) are shown on the right of each gel.
Genes 12 00116 g001
Genes 12 00116 g002 550
Figure 2. Localization of 38 chicken genes identified via BLAST of female-specific C. pharbaungensis RAD markers using Hemidactylus turcicus transcripts as an intermediary step. The number of observed (black) and expected (gray) genes with a BLAST match are shown for each chicken chromosome. The 19 genes found on chicken chromosome 10 are significantly more than expected (p = 5.525818 × 10−21), indicating synteny with C. pharbaungensis sex chromosomes. Plot made using ggplot2 and reshape2 in R v.3.6.3 [48,49,50].
Figure 2. Localization of 38 chicken genes identified via BLAST of female-specific C. pharbaungensis RAD markers using Hemidactylus turcicus transcripts as an intermediary step. The number of observed (black) and expected (gray) genes with a BLAST match are shown for each chicken chromosome. The 19 genes found on chicken chromosome 10 are significantly more than expected (p = 5.525818 × 10−21), indicating synteny with C. pharbaungensis sex chromosomes. Plot made using ggplot2 and reshape2 in R v.3.6.3 [48,49,50].
Genes 12 00116 g002
Genes 12 00116 g003 550
Figure 3. Phylogenetic placement of XX/XY and ZZ/ZW sex chromosomes in Hemidactylus and Cyrtodactylus geckos. (A) Maximum likelihood phylogeny of Hemidactylus and Cyrtodactylus geckos produced using the mitochondrial ND2 and adjacent tRNAs. Branch lengths are scaled in millions of years using secondary time calibrations. Species with known sex chromosome systems (see Figure 3B) are indicated with colored branches—orange branches indicate species with ZZ/ZW sex chromosomes, blue branches indicate species with XX/XY sex chromosomes. Taxa with gray branches are species with unknown sex chromosomes. (B) Phylogeny of species (pruned tree from Figure 3A) with known sex chromosome systems. Heterogamety is indicated at tips: blue for XX/XY and orange for ZZ/ZW. Time-scale in millions of years before present.
Figure 3. Phylogenetic placement of XX/XY and ZZ/ZW sex chromosomes in Hemidactylus and Cyrtodactylus geckos. (A) Maximum likelihood phylogeny of Hemidactylus and Cyrtodactylus geckos produced using the mitochondrial ND2 and adjacent tRNAs. Branch lengths are scaled in millions of years using secondary time calibrations. Species with known sex chromosome systems (see Figure 3B) are indicated with colored branches—orange branches indicate species with ZZ/ZW sex chromosomes, blue branches indicate species with XX/XY sex chromosomes. Taxa with gray branches are species with unknown sex chromosomes. (B) Phylogeny of species (pruned tree from Figure 3A) with known sex chromosome systems. Heterogamety is indicated at tips: blue for XX/XY and orange for ZZ/ZW. Time-scale in millions of years before present.
Genes 12 00116 g003
Table
Table 1. Newly designed PCR primers used to validate sex-specific RADseq markers.
Table 1. Newly designed PCR primers used to validate sex-specific RADseq markers.
SpeciesPrimer NameSequence (5′ to 3′)
Cyrtodactylus chaunghanakwaensisCyrtC_6-FTCAGCCCTATATGCAACGGATC
CyrtC_6-RTGTCCCTTCAGTTGGTCCAAAA
CyrtC_18-FCCCGGTTAACTCTAGTCGCATT
CyrtC-18-RTGAGGGGTAGGCAAGATAAGGA
CyrtC-151-FCAGACTTGTCACTCACCCTGAA
CyrtC_151-RTGACTTCTCCTCATCTGGCAAC
Cyrtodactylus pharbaungensisCyrtP_194-FAATCAGGCGACCTTTAAGCTCA
CyrtP_194-RTGCAGACGTGATGTAAGGGAAA
CyrtP_253-FCTCAGTGGCTCCCTCGTTAATT
CyrtP_253-RTCTGTGTGGACTTTTTGGACCA
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Keating, S.E.; Blumer, M.; Grismer, L.L.; Lin, A.; Nielsen, S.V.; Thura, M.K.; Wood, P.L., Jr.; Quah, E.S.H.; Gamble, T. Sex Chromosome Turnover in Bent-Toed Geckos (Cyrtodactylus). Genes 2021, 12, 116. https://0-doi-org.brum.beds.ac.uk/10.3390/genes12010116

AMA Style

Keating SE, Blumer M, Grismer LL, Lin A, Nielsen SV, Thura MK, Wood PL Jr., Quah ESH, Gamble T. Sex Chromosome Turnover in Bent-Toed Geckos (Cyrtodactylus). Genes. 2021; 12(1):116. https://0-doi-org.brum.beds.ac.uk/10.3390/genes12010116

Chicago/Turabian Style

Keating, Shannon E., Madison Blumer, L. Lee Grismer, Aung Lin, Stuart V. Nielsen, Myint Kyaw Thura, Perry L. Wood, Jr., Evan S. H. Quah, and Tony Gamble. 2021. "Sex Chromosome Turnover in Bent-Toed Geckos (Cyrtodactylus)" Genes 12, no. 1: 116. https://0-doi-org.brum.beds.ac.uk/10.3390/genes12010116

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop