Genes, Volume 9, Issue 9 (September 2018) – 43 articles

Zinc homeostasis is essential for all organisms. The Zap1 transcriptional activator regulates these processes in the yeast Saccharomyces cerevisiae. During zinc deficiency, Zap1 increases expression of zinc transporters and proteins involved in adapting to the stress of zinc deficiency. Transcriptional activation by Zap1 can also repress expression of some genes, e.g., RTC4. In zinc-replete cells, RTC4 mRNA is produced with a short transcript leader that is efficiently translated. During deficiency, Zap1-dependent expression of an RNA with a longer transcript leader represses the RTC4 promoter. This long leader transcript (LLT) is not translated due to the presence of small open reading frames upstream of the RTC4 coding region. In this study, we show that the RTC4 LLT RNA also plays a second function, i.e., repression of the adjacent GIS2 gene. In generating the LLT transcript, RNA polymerase II transcribes RTC4 through the GIS2 promoter. Production of the LLT RNA correlates with the decreased expression of GIS2 mRNA and mutations that prevent synthesis of the LLT RNA or terminate it before the GIS2 promoter renders GIS2 mRNA expression and Gis2 protein accumulation constitutive. Thus, we have discovered an unusual regulatory mechanism that uses a bicistronic RNA to control two genes simultaneously. Full article

Fungal infections, such as candidiasis caused by Candida, pose a problem of growing medical concern. In developed countries, the incidence of Candida infections is increasing due to the higher survival of susceptible populations, such as immunocompromised patients or the elderly. Existing treatment options are limited to few antifungal drug families with efficacies that vary depending on the infecting species. In this context, the emergence and spread of resistant Candida isolates are being increasingly reported. Understanding how resistance can evolve within naturally susceptible species is key to developing novel, more effective treatment strategies. However, in contrast to the situation of antibiotic resistance in bacteria, few studies have focused on the evolutionary mechanisms leading to drug resistance in fungal species. In this review, we will survey and discuss current knowledge on the genetic bases of resistance to antifungal drugs in Candida opportunistic pathogens. We will do so from an evolutionary genomics perspective, focusing on the possible evolutionary paths that may lead to the emergence and selection of the resistant phenotype. Finally, we will discuss the potential of future studies enabled by current developments in sequencing technologies, in vitro evolution approaches, and the analysis of serial clinical isolates. Full article

We address the problem of observing personal diploid methylomes, CpG methylome pairs of homologous chromosomes that are distinguishable with respect to phased heterozygous variants (PHVs), which is challenging due to scarcity of PHVs in personal genomes. Single molecule real-time (SMRT) sequencing is promising as it outputs long reads with CpG methylation information, but a serious concern is whether reliable PHVs are available in erroneous SMRT reads with an error rate of ∼15%. To overcome the issue, we propose a statistical model that reduces the error rate of phasing CpG site to 1%, thereby calling CpG hypomethylation in each haplotype with >90% precision and sensitivity. Using our statistical model, we examined GNAS complex locus known for a combination of maternally, paternally, or biallelically expressed isoforms, and observed allele-specific methylation pattern almost perfectly reflecting their respective allele-specific expression status, demonstrating the merit of elucidating comprehensive personal diploid methylomes and transcriptomes. Full article

Long non-coding RNA (lncRNA) research in plants has recently gained momentum taking cues from studies in animals systems. The availability of next-generation sequencing has enabled genome-wide identification of lncRNA in several plant species. Some lncRNAs are inhibitors of microRNA expression and have a function known as target mimicry with the sequestered transcript known as an endogenous target mimic (eTM). The lncRNAs identified to date show diverse mechanisms of gene regulation, most of which remain poorly understood. In this review, we discuss the role of identified putative lncRNAs that may act as eTMs for nutrient-responsive microRNAs (miRNAs) in plants. If functionally validated, these putative lncRNAs would enhance current understanding of the role of lncRNAs in nutrient homeostasis in plants. Full article

It is estimated that 30% of all genes in the mammalian cells are regulated by microRNA (miRNAs). The most relevant miRNAs in a cellular context are not necessarily those with the greatest change in expression levels between healthy and diseased tissue. Differentially expressed (DE) miRNAs that modulate a large number of messenger RNA (mRNA) transcripts ultimately have a greater influence in determining phenotypic outcomes and are more important in a global biological context than miRNAs that modulate just a few mRNA transcripts. Here, we describe the development of a tool, “miRmapper”, which identifies the most dominant miRNAs in a miRNA–mRNA network and recognizes similarities between miRNAs based on commonly regulated mRNAs. Using a list of miRNA–target gene interactions and a list of DE transcripts, miRmapper provides several outputs: (1) an adjacency matrix that is used to calculate miRNA similarity utilizing the Jaccard distance; (2) a dendrogram and (3) an identity heatmap displaying miRNA clusters based on their effect on mRNA expression; (4) a miRNA impact table and (5) a barplot that provides a visual illustration of this impact. We tested this tool using nonmetastatic and metastatic bladder cancer cell lines and demonstrated that the most relevant miRNAs in a cellular context are not necessarily those with the greatest fold change. Additionally, by exploiting the Jaccard distance, we unraveled novel cooperative interactions between miRNAs from independent families in regulating common target mRNAs; i.e., five of the top 10 miRNAs act in synergy. Full article

RIG-I-like receptors (retinoic acid-inducible gene-I-like receptors, or RLRs) are family of pattern-recognition receptors for RNA viruses, consisting of three members: retinoic acid-inducible gene I (RIG-I), melanoma differentiation-associated gene 5 (MDA5) and laboratory of genetics and physiology 2 (LGP2). To understand the role of RLRs in bird evolution, we performed molecular evolutionary analyses on the coding genes of avian RLRs using filtered predicted coding sequences from 62 bird species. Among the three RLRs, conservation score and dN/dS (ratio of nonsynonymous substitution rate over synonymous substitution rate) analyses indicate that avian MDA5 has the highest conservation level in the helicase domain but a lower level in the caspase recruitment domains (CARDs) region, which differs from mammals; LGP2, as a whole gene, has a lower conservation level than RIG-I or MDA5. We found evidence of positive selection across all bird lineages in RIG-I and MDA5 but only on the stem lineage of Galliformes in LGP2, which could be related to the loss of RIG-I in Galliformes. Analyses also suggest that selection relaxation may have occurred in LGP2 during the middle of bird evolution and the CARDs region of MDA5 contains many positively selected sites, which might explain its conservation level. Spearman’s correlation test indicates that species-to-ancestor dN/dS of RIG-I shows a negative correlation with endogenous retroviral abundance in bird genomes, suggesting the possibility of interaction between immunity and endogenous retroviruses during bird evolution. Full article

Unverricht-Lundborg disease (ULD) is a common form of progressive myoclonic epilepsy caused by mutations in the cystatin B gene (CSTB) that encodes an inhibitor of several lysosomal cathepsins. Presently, only pharmacological treatment and psychosocial support are available for ULD patients. To overcome the pathogenic effect of the ULD splicing mutation c.66G>A (exon 1), we investigated whether an antisense oligonucleotide therapeutic strategy could correct the defect in patient cells. A specific locked nucleic acid (LNA) antisense oligonucleotide was designed to block a cryptic 5′ss in intron 1. Overall, this approach allowed the restoration of the normal splicing pattern. Furthermore, the recovery was both sequence and dose-specific. In general, this work provides a proof of principle on the correction of a CSTB gene defect causing ULD through a mutation-specific antisense therapy. It adds evidence to the feasibility of this approach, joining the many studies that are paving the way for translating antisense technology into the clinical practice. The insights detailed herein make mutation-based therapy a clear candidate for personalized treatment of ULD patients, encouraging similar investigations into other genetic diseases. Full article

Congenital conotruncal heart defects (CCHD) are a subset of serious congenital heart defects (CHD) of the cardiac outflow tracts or great arteries. Its frequency is estimated in 1/1000 live births, accounting for approximately 10–30% of all CHD cases. Chromosomal abnormalities and copy number variants (CNVs) contribute to the disease risk in patients with syndromic and/or non-syndromic forms. Although largely studied in several populations, their frequencies are barely reported for Latin American countries. The aim of this study was to analyze chromosomal abnormalities, 22q11 deletions, and other genomic imbalances in a group of Argentinean patients with CCHD of unknown etiology. A cohort of 219 patients with isolated CCHD or associated with other major anomalies were referred from different provinces of Argentina. Cytogenetic studies, Multiplex-Ligation-Probe-Amplification (MLPA) and fluorescent in situ hybridization (FISH) analysis were performed. No cytogenetic abnormalities were found. 22q11 deletion was found in 23.5% of the patients from our cohort, 66% only had CHD with no other major anomalies. None of the patients with transposition of the great vessels (TGV) carried the 22q11 deletion. Other 4 clinically relevant CNVs were also observed: a distal low copy repeat (LCR)D-E 22q11 duplication, and 17p13.3, 4q35 and TBX1 deletions. In summary, 25.8% of CCHD patients presented imbalances associated with the disease. Full article

The World Health Organization plans to eliminate hepatitis B and C Infections by 2030. Therefore, there is a need to study and understand hepatitis B virus (HBV) epidemiology and viral evolution further, including evaluating occult (HBsAg-negative) HBV infection (OBI), given that such infections are frequently undiagnosed and rarely treated. We aimed to molecularly characterize HBV genomes from 108 individuals co-infected with human immunodeficiency virus (HIV) and chronic hepatitis B (CHB) or OBI identified from previous HIV studies conducted in Botswana from 2009 to 2012. Full-length (3.2 kb) and nearly full-length (~3 kb) genomes were amplified by nested polymerase chain reaction (PCR). Sequences from OBI participants were compared to sequences from CHB participants and GenBank references to identify OBI-unique mutations. HBV genomes from 50 (25 CHB and 25 OBI) individuals were successfully genotyped. Among OBI participants, subgenotype A1 was identified in 12 (48%), D3 in 12 (48%), and E in 1 (4%). A similar genotype distribution was observed in CHB participants. Whole HBV genome sequences from Botswana, representing OBI and CHB, were compared for the first time. There were 43 OBI-unique mutations, of which 26 were novel. Future studies using larger sample sizes and functional analysis of OBI-unique mutations are warranted. Full article

The derived human alcohol dehydrogenase (ADH)1B*48His allele of the ADH1B Arg48His polymorphism (rs1229984) has been identified as one component of an East Asian specific core haplotype that underwent recent positive selection. Our study has been extended to Southwest Asia and additional markers in East Asia. F_st values (Sewall Wright’s fixation index) and long-range haplotype analyses identify a strong signature of selection not only in East Asian but also in Southwest Asian populations. However, except for the ADH2B*48His allele, different core haplotypes occur in Southwest Asia compared to East Asia and the extended haplotypes also differ. Thus, the ADH1B*48His allele, as part of a core haplotype of 10 kb, has undergone recent rapid increases in frequency independently in the two regions after divergence of the respective populations. Emergence of agriculture may be the common factor underlying the evident selection. Full article

Phytochrome-interacting factors (PIFs), as the basic helix–loop–helix (bHLH) transcription factors, are the primary signaling partners for phytochromes (PHY) that play a key role in PHY-mediated light signal transduction. At present, there are few studies on PIFs in fruit trees. In order to clarify the status of PIFs in grapevines, we identified members of the grape PIFs family and conducted phylogenetic and expression analysis. We identified PIF1, PIF3, PIF4, and PIF7 in PIFs families of the grapevine (Vitis vinifera L.), which were distributed on four different chromosomes with similar gene structures. Except for the closer relationship with PIF1 of citrus, PIFs of grape were distant from the other fruit species such as apple, pear, peach, and strawberry. The VvPIFs (except VvPIF4) were located in the syntenic block with those from Arabidopsis thaliana, Solanum lycopersicum, or Citrus sinensis. In addition to PIF1, all PIFs in grapevines have conserved active PHYB binding (APB) sequences. VvPIF1 has a conserved PIF1-specific active PHYA binding (APA) sequence, while amino acid mutations occurred in the specific APA sequence in VvPIF3. Interestingly, two specific motifs were found in the PIF4 amino acid sequence. The photoreceptor-related elements in the VvPIFs promoter region were the most abundant. PIF1, LONG HYPOCOTYL 5 (HY5) and PIF3, PIF4, GIBBERELLIC ACID INSENSITIVE 1 (GAI1) may interact with each other and participate together in light signal transduction. The relative expression levels of the VvPIFs showed diverse patterns in the various organs at different developmental stages, of which PIF4 was most highly expressed. Prior to maturation, the expression of PIF4 and PIF7 in the skin of the different cultivars increased, while the expression of all PIFs in the flesh decreased. The transcription level of PIFs in grape leaves was sensitive to changes in lighting and shading. Shading treatment was beneficial for enhancing the transcription level of VvPIFs, but the effect on VvPIF3 and VvPIF4 was time-controlled. We concluded that PIFs in grapevines are both conservative and species-specific. The identification and analysis of grape PIFs could provide a theoretical foundation for the further construction of grape light regulation networks. Full article

Protein kinase B (Akt1) is a proto-oncogene that is overactive in most cancers. Akt1 activation requires phosphorylation at Thr308; phosphorylation at Ser473 further enhances catalytic activity. Akt1 activity is also regulated via interactions between the kinase domain and the N-terminal auto-inhibitory pleckstrin homology (PH) domain. As it was previously difficult to produce Akt1 in site-specific phosphorylated forms, the contribution of each activating phosphorylation site to auto-inhibition was unknown. Using a combination of genetic code expansion and in vivo enzymatic phosphorylation, we produced Akt1 variants containing programmed phosphorylation to probe the interplay between Akt1 phosphorylation status and the auto-inhibitory function of the PH domain. Deletion of the PH domain increased the enzyme activity for all three phosphorylated Akt1 variants. For the doubly phosphorylated enzyme, deletion of the PH domain relieved auto-inhibition by 295-fold. We next found that phosphorylation at Ser473 provided resistance to chemical inhibition by Akti-1/2 inhibitor VIII. The Akti-1/2 inhibitor was most effective against pAkt1^T308 and showed four-fold decreased potency with Akt1 variants phosphorylated at Ser473. The data highlight the need to design more potent Akt1 inhibitors that are effective against the doubly phosphorylated and most pathogenic form of Akt1. Full article

Tissue-specific gene expression has long been recognized as a crucial key for understanding tissue development and function. Efforts have been made in the past decade to identify tissue-specific expression profiles, such as the Human Proteome Atlas and FANTOM5. However, these studies mainly focused on “qualitatively tissue-specific expressed genes” which are highly enriched in one or a group of tissues but paid less attention to “quantitatively tissue-specific expressed genes”, which are expressed in all or most tissues but with differential expression levels. In this study, we applied machine learning algorithms to build a computational method for identifying “quantitatively tissue-specific expressed genes” capable of distinguishing 25 human tissues from their expression patterns. Our results uncovered the expression of 432 genes as optimal features for tissue classification, which were obtained with a Matthews Correlation Coefficient (MCC) of more than 0.99 yielded by a support vector machine (SVM). This constructed model was superior to the SVM model using tissue enriched genes and yielded MCC of 0.985 on an independent test dataset, indicating its good generalization ability. These 432 genes were proven to be widely expressed in multiple tissues and a literature review of the top 23 genes found that most of them support their discriminating powers. As a complement to previous studies, our discovery of these quantitatively tissue-specific genes provides insights into the detailed understanding of tissue development and function. Full article

Both type 1 and type 2 diabetes are conditions that are associated with the loss of insulin-producing β-cells within the pancreas. An active research therefore aims at regenerating these β-cells with the hope that they could restore euglycemia. The approaches classically used consist in mimicking embryonic development, making use of diverse cell sources or converting pre-existing pancreatic cells. Despite impressive progresses and promising successes, it appears that we still need to gain further insight into the molecular mechanisms underlying β-cell development. This becomes even more obvious with the emergence of a relatively new field of research, epigenetics. The current review therefore focuses on the latest advances in this field in the context of β-cell (neo-)genesis research. Full article

Candida albicans mutants deficient in homologous recombination (HR) are extremely sensitive to the alkylating agent methyl-methane-sulfonate (MMS). Here, we have investigated the role of HR genes in the protection and repair of C. albicans chromosomes by taking advantage of the heat-labile property (55 °C) of MMS-induced base damage. Acute MMS treatments of cycling cells caused chromosome fragmentation in vitro (55 °C) due to the generation of heat-dependent breaks (HDBs), but not in vivo (30 °C). Following removal of MMS wild type, cells regained the chromosome ladder regardless of whether they were transferred to yeast extract/peptone/dextrose (YPD) or to phosphate buffer saline (PBS); however, repair of HDB/chromosome restitution was faster in YPD, suggesting that it was accelerated by metabolic energy and further fueled by the subsequent overgrowth of survivors. Compared to wild type CAI4, chromosome restitution in YPD was not altered in a Carad59 isogenic derivative, whereas it was significantly delayed in Carad51 and Carad52 counterparts. However, when post-MMS incubation took place in PBS, chromosome restitution in wild type and HR mutants occurred with similar kinetics, suggesting that the exquisite sensitivity of Carad51 and Carad52 mutants to MMS is due to defective fork restart. Overall, our results demonstrate that repair of HDBs by resting cells of C. albicans is rather independent of CaRad51, CaRad52, and CaRad59, suggesting that it occurs mainly by base excision repair (BER). Full article

The proinflammatory cytokine, interleukin-6 (IL-6), plays a critical role in many chronic inflammatory diseases, particularly inflammatory bowel disease. To investigate the regulation of IL-6 gene expression at the molecular level, genomic DNA sequencing of Jinghai yellow chickens (Gallus gallus) was performed to detect single-nucleotide polymorphisms (SNPs) in the region −2200 base pairs (bp) upstream to 500 bp downstream of IL-6. Transcription factor binding sites and CpG islands in the IL-6 promoter region were predicted using bioinformatics software. Twenty-eight SNP sites were identified in IL-6. Four of these 28 SNPs, three [−357 (G > A), −447 (C > G), and −663 (A > G)] in the 5′ regulatory region and one in the 3′ non-coding region [3177 (C > T)] are not labelled in GenBank. Bioinformatics analysis revealed 11 SNPs within the promoter region that altered putative transcription factor binding sites. Furthermore, the C-939G mutation in the promoter region may change the number of CpG islands, and SNPs in the 5′ regulatory region may influence IL-6 gene expression by altering transcription factor binding or CpG methylation status. Genetic diversity analysis revealed that the newly discovered A-663G site significantly deviated from Hardy-Weinberg equilibrium. These results provide a basis for further exploration of the promoter function of the IL-6 gene and the relationships of these SNPs to intestinal inflammation resistance in chickens. Full article

The sequencing of ancient DNA samples provides a novel way to find, characterize, and distinguish exogenous genomes of endogenous targets. After sequencing, computational composition analysis enables filtering of undesired sources in the focal organism, with the purpose of improving the quality of assemblies and subsequent data analysis. More importantly, such analysis allows extinct and extant species to be identified without requiring a specific or new sequencing run. However, the identification of exogenous organisms is a complex task, given the nature and degradation of the samples, and the evident necessity of using efficient computational tools, which rely on algorithms that are both fast and highly sensitive. In this work, we relied on a fast and highly sensitive tool, FALCON-meta, which measures similarity against whole-genome reference databases, to analyse the metagenomic composition of an ancient polar bear (Ursus maritimus) jawbone fossil. The fossil was collected in Svalbard, Norway, and has an estimated age of 110,000 to 130,000 years. The FASTQ samples contained 349 GB of nonamplified shotgun sequencing data. We identified and localized, relative to the FASTQ samples, the genomes with significant similarities to reference microbial genomes, including those of viruses, bacteria, and archaea, and to fungal, mitochondrial, and plastidial sequences. Among other striking features, we found significant similarities between modern-human, some bacterial and viral sequences (contamination) and the organelle sequences of wild carrot and tomato relative to the whole samples. For each exogenous candidate, we ran a damage pattern analysis, which in addition to revealing shallow levels of damage in the plant candidates, identified the source as contamination. Full article

Dental implants provide a predictable treatment option for partial and complete edentulism via the placement of a fixed permanent artificial root to support prosthetic dental crowns. Despite the high survival rates, long-term dental implant failures are still reported, leading to implant removals and additional financial and health burdens. While extrinsic factors that improve the success rate of implants have been well explored, the impact of genetic factors on this matter is poorly understood. A systematic review and meta-analysis study was conducted to determine whether genetic factors contribute to an increased risk of dental implant failures. A comprehensive search for peer-reviewed articles on dental implants and genetic factors was performed using various literature database libraries. The study design was conducted according to Preferred Reporting Items for Systematic Reviews and Meta-Analysis (PRISMA) guidelines, and the obtained records were registered in the International Prospective Register of Systematic Reviews (PROSPERO) database. According to the exclusion/inclusion criteria, 13 studies were eligible for this study out of 809 articles. The meta-analysis of the combined association studies of DNA variations and dental implants did not indicate an increased risk for implant failure due to DNA variations in IL-1B, IL-10 and TNF-α. This study emphasizes the need for larger randomized controlled clinical trials to inform clinicians and patients about the role of genetic factors on dental implant survival and the success rate in healthy and compromised patients. Full article

Lung tissue plays an important role in the respiratory system of mammals after birth. Early lung development includes six key stages, of which the saccular stage spans the pre- and neonatal periods and prepares the distal lung for alveolarization and gas-exchange. However, little is known about the changes in gene expression between fetal and neonatal lungs. In this study, we performed transcriptomic analysis of messenger RNA (mRNA) and long noncoding RNA (lncRNA) expressed in the lung tissue of fetal and neonatal piglets. A total of 19,310 lncRNAs and 14,579 mRNAs were identified and substantially expressed. Furthermore, 3248 mRNAs were significantly (FDR-adjusted p value ≤ 0.05, FDR: False Discovery Rate) differentially expressed and were mainly enriched in categories related to cell proliferation, immune response, hypoxia response, and mitochondrial activation. For example, CCNA2, an important gene involved in the cell cycle and DNA replication, was upregulated in neonatal lungs. We also identified 452 significantly (FDR-adjusted p value ≤ 0.05) differentially expressed lncRNAs, which might function in cell proliferation, mitochondrial activation, and immune response, similar to the differentially expressed mRNAs. These results suggest that differentially expressed mRNAs and lncRNAs might co-regulate lung development in early postnatal pigs. Notably, the TU64359 lncRNA might promote distal lung development by up-regulating the heparin-binding epidermal growth factor-like (HB-EGF) expression. Our research provides basic lung development datasets and will accelerate clinical researches of newborn lung diseases with pig models. Full article

In this study, we report for the first time the existence of complemented palindromic small RNAs (cpsRNAs) and propose that cpsRNAs and palindromic small RNAs (psRNAs) constitute a novel class of small RNAs. The first discovered 19-nt cpsRNA UUAACAAGCUUGUUAAAGA, named SARS-CoV-cpsR-19, was detected from a 22-bp DNA complemented palindrome TCTTTAACAAGCTTGTTAAAGA in the severe acute respiratory syndrome coronavirus (SARS-CoV) genome. The phylogenetic analysis supported that this DNA complemented palindrome originated from bat betacoronavirus. The results of RNA interference (RNAi) experiments showed that one 19-nt segment corresponding to SARS-CoV-cpsR-19 significantly induced cell apoptosis. Using this joint analysis of the molecular function and phylogeny, our results suggested that SARS-CoV-cpsR-19 could play a role in SARS-CoV infection or pathogenesis. The discovery of cpsRNAs has paved a way to find novel markers for pathogen detection and to reveal the mechanisms underlying infection or pathogenesis from a different point of view. Researchers can use cpsRNAs to study the infection or pathogenesis of pathogenic viruses when these viruses are not available. The discovery of psRNAs and cpsRNAs, as a novel class of small RNAs, also inspire researchers to investigate DNA palindromes and DNA complemented palindromes with lengths of psRNAs and cpsRNAs in viral genomes. Full article

Environmental abiotic stresses are limiting factors for less tolerant organisms, including soil plants. Abiotic stress tolerance-associated genes from prokaryotic organisms are supposed to have a bright prospect for transgenic application. The drought-adapted cyanobacterium Nostoc flagelliforme is arising as a valuable prokaryotic biotic resource for gene excavation. In this study, we evaluated the salt-tolerant function and application potential of a candidate gene drnf1 from N. flagelliforme, which contains a P-loop NTPase (nucleoside-triphosphatase) domain, through heterologous expression in two model organisms Synechocystis sp. PCC 6803 and Arabidopsis thaliana. It was found that DRNF1 could confer significant salt tolerance in both transgenic organisms. In salt-stressed transgenic Synechocystis, DRNF1 could enhance the respiration rate; slow-down the accumulation of exopolysaccharides; up-regulate the expression of salt tolerance-related genes at a higher level, such as those related to glucosylglycerol synthesis, Na⁺/H⁺ antiport, and sugar metabolism; and maintain a better K⁺/Na⁺ homeostasis, as compared to the wild-type strain. These results imply that DRNF1 could facilitate salt tolerance by affecting the respiration metabolism and indirectly regulating the expression of important salt-tolerant genes. Arabidopsis was employed to evaluate the salt tolerance-conferring potential of DRNF1 in plants. The results show that it could enhance the seed germination and shoot growth of transgenic plants under saline conditions. In general, a novel prokaryotic salt-tolerant gene from N. flagelliforme was identified and characterized in this study, enriching the candidate gene pool for genetic engineering in plants. Full article

The retention of supernumerary chromosomes in the germ-line of Sciara coprophila is part of a highly-intricate pattern of chromosome behaviours that have fascinated cytogeneticists for over 80 years. Germ-line limited (termed L or “limited”) chromosomes are cytologically heterochromatic and late-replicating, with more recent studies confirming they possess epigenetic hallmarks characteristic of constitutive heterochromatin. Little is known about their genetic constitution although they have been found to undergo cycles of condensation and de-condensation at different stages of development. Unlike most supernumeraries, the L chromosomes in S. coprophila are thought to be indispensable, although in two closely related species Sciara ocellaris and Sciara reynoldsi the L chromosomes, have been lost during evolution. Here, we review what we know about L chromosomes in Sciara coprophila. We end by discussing how study of the L chromosome condensation cycle has provided insight into the site and timing of both the erasure of parental “imprints” and also the placement of a putative “imprint” that might be carried by the sperm into the egg. Full article

T-cell factor 4 (TCF4), together with β-catenin coactivator, functions as the major transcriptional mediator of the canonical wingless/integrated (Wnt) signaling pathway in the intestinal epithelium. The pathway activity is essential for both intestinal homeostasis and tumorigenesis. To date, several mouse models and cellular systems have been used to analyze TCF4 function. However, some findings were conflicting, especially those that were related to the defects observed in the mouse gastrointestinal tract after Tcf4 gene deletion, or to a potential tumor suppressive role of the gene in intestinal cancer cells or tumors. Here, we present the results obtained using a newly generated conditional Tcf4 allele that allows inactivation of all potential Tcf4 isoforms in the mouse tissue or small intestinal and colon organoids. We also employed the clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 system to disrupt the TCF4 gene in human cells. We showed that in adult mice, epithelial expression of Tcf4 is indispensable for cell proliferation and tumor initiation. However, in human cells, the TCF4 role is redundant with the related T-cell factor 1 (TCF1) and lymphoid enhancer-binding factor 1 (LEF1) transcription factors. Full article

Vascular endothelial growth factor (VEGF) expression induces age-related macular degeneration (AMD), which is a common vision-threatening disease due to choroidal neovascularization and a fibrovascular membrane. We describe a mouse model of neovascular AMD with the local expression of human VEGF-A₁₆₅ in the eye. We use a transgenic mouse in which human VEGF-A₁₆₅ has been silenced with the loxP-STOP fragment. The choroidal neovascularization and human VEGF-A₁₆₅ expression in the mouse are induced by subretinal adenoviral Cre gene delivery. Cre gene transfer is compared with adenoviral LacZ gene transfer control. We characterize the AMD phenotype and changes in the vasculature by using fluorescein angiography, optical coherence tomography, and immunohistochemistry. At early time points, mice exhibit increases in retinal thickness (348 ± 114 µm vs. 231 ± 32 µm) and choroidal neovascularization area (12000 ± 15174 µm² vs. 2169 ± 3495 µm²) compared with the control. At later time points, choroidal neovascularization develops into subretinal fibrovascular membrane. Human VEGF-A₁₆₅ expression lasts several weeks. In conclusion, the retinas display vascular abnormalities consistent with choroidal neovascularization. Together with immunohistochemical findings, these changes resemble clinical AMD-like ocular pathologies. We conclude that this mouse model of Cre-induced choroidal neovascularization is useful for mimicking the pathogenesis of AMD, studying the effects of human VEGF-A₁₆₅ in the retina, and evaluating anti-VEGF treatments for choroidal neovascularization. Full article

Network medicine relies on different types of networks: from the molecular level of protein–protein interactions to gene regulatory network and correlation studies of gene expression. Among network approaches based on the analysis of the topological properties of protein–protein interaction (PPI) networks, we discuss the widespread DIAMOnD (disease module detection) algorithm. Starting from the assumption that PPI networks can be viewed as maps where diseases can be identified with localized perturbation within a specific neighborhood (i.e., disease modules), DIAMOnD performs a systematic analysis of the human PPI network to uncover new disease-associated genes by exploiting the connectivity significance instead of connection density. The past few years have witnessed the increasing interest in understanding the molecular mechanism of post-transcriptional regulation with a special emphasis on non-coding RNAs since they are emerging as key regulators of many cellular processes in both physiological and pathological states. Recent findings show that coding genes are not the only targets that microRNAs interact with. In fact, there is a pool of different RNAs—including long non-coding RNAs (lncRNAs) —competing with each other to attract microRNAs for interactions, thus acting as competing endogenous RNAs (ceRNAs). The framework of regulatory networks provides a powerful tool to gather new insights into ceRNA regulatory mechanisms. Here, we describe a data-driven model recently developed to explore the lncRNA-associated ceRNA activity in breast invasive carcinoma. On the other hand, a very promising example of the co-expression network is the one implemented by the software SWIM (switch miner), which combines topological properties of correlation networks with gene expression data in order to identify a small pool of genes—called switch genes—critically associated with drastic changes in cell phenotype. Here, we describe SWIM tool along with its applications to cancer research and compare its predictions with DIAMOnD disease genes. Full article

The reconstruction of ancient metagenomes from archaeological material, and their implication in human health and evolution, is one of the most recent advances in paleomicrobiological studies. However, as for all ancient DNA (aDNA) studies, environmental and laboratory contamination need to be specifically addressed. Here we attempted to reconstruct the tissue-specific metagenomes of a 42,000-year-old, permafrost-preserved woolly mammoth calf through shotgun high-throughput sequencing. We analyzed the taxonomic composition of all tissue samples together with environmental and non-template experimental controls and compared them to metagenomes obtained from permafrost and elephant fecal samples. Preliminary results suggested the presence of tissue-specific metagenomic signals. We identified bacterial species that were present in only one experimental sample, absent from controls, and consistent with the nature of the samples. However, we failed to further authenticate any of these signals and conclude that, even when experimental samples are distinct from environmental and laboratory controls, this does not necessarily indicate endogenous presence of ancient host-associated microbiomic signals. Full article

Detecting high-order epistasis in genome-wide association studies (GWASs) is of importance when characterizing complex human diseases. However, the enormous numbers of possible single-nucleotide polymorphism (SNP) combinations and the diversity among diseases presents a significant computational challenge. Herein, a fast method for detecting high-order epistasis based on an interaction weight (FDHE-IW) method is evaluated in the detection of SNP combinations associated with disease. First, the symmetrical uncertainty (SU) value for each SNP is calculated. Then, the top-k SNPs are isolated as guiders to identify 2-way SNP combinations with significant interaction weight values. Next, a forward search is employed to detect high-order SNP combinations with significant interaction weight values as candidates. Finally, the findings were statistically evaluated using a G-test to isolate true positives. The developed algorithm was used to evaluate 12 simulated datasets and an age-related macular degeneration (AMD) dataset and was shown to perform robustly in the detection of some high-order disease-causing models. Full article

Peroxisomes are central to eukaryotic metabolism, including the oxidation of fatty acids—which subsequently provide an important source of metabolic energy—and in the biosynthesis of cholesterol and plasmalogens. However, the presence and nature of peroxisomes in the parasitic apicomplexan protozoa remains controversial. A survey of the available genomes revealed that genes encoding peroxisome biogenesis factors, so-called peroxins (Pex), are only present in a subset of these parasites, the coccidia. The basic principle of peroxisomal protein import is evolutionarily conserved, proteins harbouring a peroxisomal-targeting signal 1 (PTS1) interact in the cytosol with the shuttling receptor Pex5 and are then imported into the peroxisome via the membrane-bound protein complex formed by Pex13 and Pex14. Surprisingly, whilst Pex5 is clearly identifiable, Pex13 and, perhaps, Pex14 are apparently absent from the coccidian genomes. To investigate the functionality of the PTS1 import mechanism in these parasites, expression of Pex5 from the model coccidian Toxoplasma gondii was shown to rescue the import defect of Pex5-deleted Saccharomyces cerevisiae. In support of these data, green fluorescent protein (GFP) bearing the enhanced (e)PTS1 known to efficiently localise to peroxisomes in yeast, localised to peroxisome-like bodies when expressed in Toxoplasma. Furthermore, the PTS1-binding domain of Pex5 and a PTS1 ligand from the putatively peroxisome-localised Toxoplasma sterol carrier protein (SCP2) were shown to interact in vitro. Taken together, these data demonstrate that the Pex5–PTS1 interaction is functional in the coccidia and indicate that a nonconventional peroxisomal import mechanism may operate in the absence of Pex13 and Pex14. Full article

The relationship between variation of the repetitive component of the genome and domestication in plant species is not fully understood. In previous work, variations in the abundance and proximity to genes of long terminal repeats (LTR)-retrotransposons of sunflower (Helianthus annuus L.) were investigated by Illumina DNA sequencingtocompare cultivars and wild accessions. In this study, we annotated and characterized 22 specific retrotransposon families whose abundance varies between domesticated and wild genotypes. These families mostly belonged to the Chromovirus lineage of the Gypsy superfamily and were distributed overall chromosomes. They were also analyzed in respect to their proximity to genes. Genes close to retrotransposon were classified according to biochemical pathways, and differences between domesticated and wild genotypes are shown. These data suggest that structural variations related to retrotransposons might have occurred to produce phenotypic variation between wild and domesticated genotypes, possibly by affecting the expression of genes that lie close to inserted or deleted retrotransposons and belong to specific biochemical pathways as those involved in plant stress responses. Full article