Dose-Response Recovery of Probiotic Strains in Simulated Gastro-Intestinal Passage
Abstract
:1. Introduction
2. Materials and Methods
2.1. Investigated Products
2.2. Simulated Digestion
2.3. Sample Analysis
2.4. Statistical Methods
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Hill, C.; Guarner, F.; Reid, G.; Gibson, G.R.; Merenstein, D.J.; Pot, B.; Morelli, L.; Canani, R.B.; Flint, H.J.; Salminen, S.; et al. Expert consensus document: The International Scientific Association for Probiotics and Prebiotics consensus statement on the scope and appropriate use of the term probiotic. Nat. Rev. Gastroenterol. Hepatol. 2014, 11, 506–514. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ouwehand, A.C.; Invernici, M.M.; Furlaneto, F.A.C.; Messora, M.R. Effectiveness of Multistrain Versus Single-strain Probiotics: Current Status and Recommendations for the Future. J. Clin. Gastroenterol. 2018, 52, S35–S40. [Google Scholar] [CrossRef] [PubMed]
- Forssten, S.D.; Ouwehand, A.C. Simulating colonic survival of probiotics in single-strain products compared to multi-strain products. Microb. Ecol. Health Dis. 2017, 28, 1378061. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ouwehand, A.C. A review of dose-responses of probiotics in human studies. Benef. Micr. 2017, 8, 143–151. [Google Scholar] [CrossRef]
- Taverniti, V.; Koirala, R.; Dalla Via, A.; Gargari, G.; Leonardis, E.; Arioli, S.; Guglielmetti, S. Effect of Cell Concentration on the Persistence in the Human Intestine of Four Probiotic Strains Administered through a Multispecies Formulation. Nutrients 2019, 11, 285. [Google Scholar] [CrossRef] [Green Version]
- Mäkeläinen, H.; Forssten, S.; Olli, K.; Granlund, L.; Rautonen, N.; Ouwehand, A.C. Probiotic lactobacilli in a semi-soft cheese survive in the simulated human gastrointestinal tract. Int. Dairy J. 2009, 19, 675–683. [Google Scholar] [CrossRef]
- Mäkivuokko, H.; Kettunen, H.; Saarinen, M.; Kamiwaki, T.; Yokoyama, Y.; Stowell, J.; Rautonen, N. The effect of cocoa and polydextrose on bacterial fermentation in gastrointestinal tract simulations. Biosci. Biotechnol. Biochem. 2007, 71, 1834–1843. [Google Scholar] [CrossRef] [Green Version]
- Mäkeläinen, H.S.; Mäkivuokko, H.A.; Salminen, S.J.; Rautonen, N.E.; Ouwehand, A.C. The effects of polydextrose and xylitol on microbial community and activity in a 4-stage colon simulator. J. Food Sci. 2007, 72, M153–M159. [Google Scholar] [CrossRef]
- Cummings, J.H.; Macfarlane, G.T. The control and consequences of bacterial fermentation in the human colon. J. Appl. Bacteriol. 1991, 70, 443–459. [Google Scholar] [CrossRef]
- Ouwehand, A.C.; Tiihonen, K.; Saarinen, M.; Putaala, H.; Rautonen, N. Influence of a combination of Lactobacillus acidophilus NCFM and lactitol on healthy elderly: Intestinal and immune parameters. Br. J. Nutr. 2009, 101, 367–375. [Google Scholar] [CrossRef] [Green Version]
- Lehtinen, M.J.; Hibberd, A.A.; Mannikko, S.; Yeung, N.; Kauko, T.; Forssten, S.; Lehtoranta, L.; Lahtinen, S.J.; Stahl, B.; Lyra, A.; et al. Nasal microbiota clusters associate with inflammatory response, viral load, and symptom severity in experimental rhinovirus challenge. Sci. Rep. 2018, 8, 11411. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Airaksinen, K.; Yeung, N.; Lyra, A.; Lahtinen, S.J.; Huttunen, T.; Shanahan, F.; Ouwehand, A.C. The effect of a probiotic blend on gastrointestinal symptoms in constipated patients: A double blind, randomised, placebo controlled 2-week trial. Benef. Microbes 2019, 1–12. [Google Scholar] [CrossRef]
- Haarman, M.; Knol, J. Quantitative real-time PCR analysis of fecal Lactobacillus species in infants receiving a prebiotic infant formula. Appl. Environ. Microbiol. 2006, 72, 2359–2365. [Google Scholar] [CrossRef] [Green Version]
- Hansen, S.J.; Tang, P.; Kiefer, A.; Galles, K.; Wong, C.; Morovic, W. Droplet digital PCR is an improved alternative method for high-quality enumeration of viable probiotic strains. Front. Microbiol. 2020, 10, 3025. [Google Scholar] [CrossRef]
- Sanders, M.E.; Merenstein, D.; Merrifield, C.A.; Hutkins, R. Probiotics for human use. Nutr. Bull. 2018, 43, 212–225. [Google Scholar] [CrossRef]
- Leite, G.S.F.; Resende, A.S.; West, N.P.; Lancha, A.H., Jr. Probiotics and sports: A new magic bullet? Nutrition 2019, 60, 152–160. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Forssten, S.D.; Roytio, H.; Hibberd, A.A.; Ouwehand, A.C. The effect of polydextrose and probiotic lactobacilli in a Clostridium difficile-infected human colonic model. Microb. Ecol. Health Dis. 2015, 26, 27988. [Google Scholar] [CrossRef] [PubMed]
- Mäkivuokko, H.; Forssten, S.; Saarinen, M.; Ouwehand, A.; Rautonen, N. Synbiotic effects of lactitol and Lactobacillus acidophilus NCFM in a semi-continuous colon fermentation model. Benef. Microbes 2010, 1, 131–137. [Google Scholar] [CrossRef] [PubMed]
- Sady, M.; Najgebauer-Lejko, D.; Domagala, J. The suitability of different probiotic strains for the production of fruit-whey beverages. Acta Sci. Pol. Technol. Aliment. 2017, 16, 421–429. [Google Scholar] [CrossRef]
- Junick, J.; Blaut, M. Quantification of human fecal Bifidobacterium species by use of quantitative real-time PCR analysis targeting the groEL gene. Appl. Environ. Microbiol. 2012, 78, 2613–2622. [Google Scholar] [CrossRef] [Green Version]
- Yamamoto, Y. PCR in diagnosis of infection: Detection of bacteria in cerebrospinal fluids. Clin. Diagn. Lab. Immunol. 2002, 9, 508–514. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mäkeläinen, H.; Forssten, S.; Saarinen, M.; Stowell, J.; Rautonen, N.; Ouwehand, A.C. Xylo-oligosaccharides enhance the growth of bifidobacteria and Bifidobacterium lactis in a simulated colon model. Benef. Microbes 2010, 1, 81–91. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.K.; Lim, C.Y.; Teng, W.L.; Ouwehand, A.C.; Tuomola, E.M.; Salminen, S. Quantitative approach in the study of adhesion of lactic acid bacteria to intestinal cells and their competition with enterobacteria. Appl. Environ. Microbiol. 2000, 66, 3692–3697. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Species/Strain | Primer Name | Sequence | Anneal Temp. [°C] | Reference |
---|---|---|---|---|
B. lactis Bl-04 | Bl04_for | CTTCCCAGAAGGCCGGGT | 60 | [11] |
Bl04_rev | CGAGGCCACGGTGCTCATATAGA | |||
L. acidophilus | Laci_NCFMMJ_RTfwd | CCACGACCAGATGTAACCAA | 62 | [12] |
Laci_NCFM_Rtrev | TTAGAAGATGCCAACGTCGAG | |||
Laci_NCFM_probe | 5’HEX TAA GCC GAA-ZEN-CAA TGC TGA AAC GAT 3’IABkFQ | |||
L. paracasei Lpc-37 | F_paca_IS | ACATCAGTGTATTGCTTGTCAGTGAATAC | 60 | [13] |
R_paca_IS | CCTGCGGGTACTGAGATGTTTC | |||
P_paca_IS | 5’ FAM TGCCGCCGGCCAG 3’ IBQ | |||
L. plantarum Lp-115 | LP115_F | CTTGATGACTCTTCTGGGGC | 60 | [14] |
LP115_R | ACGGGAGTGATAGACGTTGAG | |||
LP115_P | TTGAGTGCAGCGTTGTTTGCGAGCGTCC |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Forssten, S.; Ouwehand, A.C. Dose-Response Recovery of Probiotic Strains in Simulated Gastro-Intestinal Passage. Microorganisms 2020, 8, 112. https://0-doi-org.brum.beds.ac.uk/10.3390/microorganisms8010112
Forssten S, Ouwehand AC. Dose-Response Recovery of Probiotic Strains in Simulated Gastro-Intestinal Passage. Microorganisms. 2020; 8(1):112. https://0-doi-org.brum.beds.ac.uk/10.3390/microorganisms8010112
Chicago/Turabian StyleForssten, Sofia, and Arthur C. Ouwehand. 2020. "Dose-Response Recovery of Probiotic Strains in Simulated Gastro-Intestinal Passage" Microorganisms 8, no. 1: 112. https://0-doi-org.brum.beds.ac.uk/10.3390/microorganisms8010112