Next Article in Journal
Reply to Comment on “Enumeration of Escherichia coli in Probiotic Products. Microorganisms 2019, 7, 437”
Next Article in Special Issue
Pathogenicity and Virulence Factors of Fusarium graminearum Including Factors Discovered Using Next Generation Sequencing Technologies and Proteomics
Previous Article in Journal
Interactions between Kazachstania humilis Yeast Species and Lactic Acid Bacteria in Sourdough
Previous Article in Special Issue
DNA Methylation Profile of β-1,3-Glucanase and Chitinase Genes in Flax Shows Specificity Towards Fusarium Oxysporum Strains Differing in Pathogenicity
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microorganisms
Volume 8
Issue 2
10.3390/microorganisms8020241
microorganisms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

In Vitro Fumonisin Biosynthesis and Genetic Structure of Fusarium verticillioides Strains from Five Mediterranean Countries

by
Giovanni Beccari
1,
Łukasz Stępień
2,
Andrea Onofri
1,
Veronica M. T. Lattanzio
3,
Biancamaria Ciasca
3,
Sally I. Abd-El Fatah
4,
Francesco Valente
1,
Monika Urbaniak
2 and
Lorenzo Covarelli
1,*,†
1
Department of Agricultural, Food and Environmental Sciences, University of Perugia, 06121 Perugia, Italy
2
Department of Pathogen Genetics and Plant Resistance, Institute of Plant Genetics, Polish Academy of Sciences, 60-479 Poznan, Poland
3
National Research Council of Italy, Institute of Sciences of Food Production (ISPA-CNR), 70126 Bari, Italy
4
Food Toxins and Contaminants Department, National Research Centre, Cairo 12622, Egypt
*
Author to whom correspondence should be addressed.
†
Current co-address: Centre for Crop and Disease Management, School of Molecular and Life Science, Curtin University, Bentley, Perth 6102, Australia.
Microorganisms 2020, 8(2), 241; https://0-doi-org.brum.beds.ac.uk/10.3390/microorganisms8020241
Submission received: 24 January 2020 / Accepted: 6 February 2020 / Published: 11 February 2020
(This article belongs to the Special Issue Fusarium: Mycotoxins, Taxonomy and Pathogenicity)
Browse Figures
Versions Notes

Abstract

:
Investigating the in vitro fumonisin biosynthesis and the genetic structure of Fusarium verticillioides populations can provide important insights into the relationships between strains originating from various world regions. In this study, 90 F. verticillioides strains isolated from maize in five Mediterranean countries (Italy, Spain, Tunisia, Egypt and Iran) were analyzed to investigate their ability to in vitro biosynthesize fumonisin B1, fumonisin B2 and fumonisin B3 and to characterize their genetic profile. In general, 80% of the analyzed strains were able to biosynthesize fumonisins (range 0.03–69.84 μg/g). Populations from Italy, Spain, Tunisia and Iran showed a similar percentage of fumonisin producing strains (>90%); conversely, the Egyptian population showed a lower level of producing strains (46%). Significant differences in fumonisin biosynthesis were detected among strains isolated in the same country and among strains isolated from different countries. A portion of the divergent FUM1 gene and of intergenic regions FUM6-FUM7 and FUM7-FUM8 were sequenced to evaluate strain diversity among populations. A high level of genetic uniformity inside the populations analyzed was detected. Apparently, neither geographical origin nor fumonisin production ability were correlated to the genetic diversity of the strain set. However, four strains from Egypt differed from the remaining strains.

Graphical Abstract

1. Introduction

Fusarium verticillioides (Sacc.) Nirenberg is a member of the Gibberella fujikuroi species complex, also called Fusarium fujikuroi species complex (FFSC), a group of 40 closely related Fusarium species defined by morphological traits, sexual compatibility and DNA-based phylogenetic analysis [1,2].
In particular, F. verticillioides belongs to the “African” clade of the FFSC [3], and it is the main causal agent of Fusarium ear rot of maize (Zea mays L.) [4,5]. This fungus has been reported worldwide and, in particular, it prevails in drier and warmer climatic regions [6,7] such as those present in temperate, semitropical and tropical regions including European [4], Mediterranean [8], African [9] and Middle Eastern [10] maize-growing areas. For example, F. verticillioides was the species isolated more frequently from maize kernels harvested in Italy [11,12,13], Spain [14,15,16], Egypt [17,18,19,20,21] and Iran [22]. This is also one of the species able to biosynthesize the secondary metabolites fumonisins [23]. Specifically, F. verticillioides is considered the main fumonisin producer; therefore, this is the most important species associated with fumonisin contamination of maize grains [24]. Fumonisins occur worldwide in maize, including Mediterranean [4,8,24,25] farming areas, where this is one of the most widely cultivated crops [26,27]. Fumonisin accumulation in maize grains can occur in the field, following preharvest infections, and possibly continue during grain storage [28].
Contaminations strongly impair maize grain quality because of the negative impact on animal and human health [29]. Fumonisin mycotoxins can be divided into four main groups, with the most abundant fumonisins found in nature included in the B group: fumonisin B1 (FB1), fumonisin B2 (FB2) and fumonisin B3 (FB3). Among B analogues, FB1 is the most detected fumonisin in maize as well as the most toxicologically active [24,30]. In fact, after ingestion, fumonisins may cause a wide range of toxic effects, especially towards liver and kidneys [31,32,33,34,35]. For this reason, the European Commission has established maximum limits for the sum of FB1 and FB2 in maize for human consumption [36,37].
The amount of fumonisins found in maize kernels is also dependent on the toxigenic ability of the F. verticillioides populations occurring in a certain cultivated field or in a specific geographic area [38]. In fact, within the F. verticillioides species, fumonisin production commonly varies quantitatively because of the different strain abilities to biosynthesize different levels of these mycotoxins [15,24,39,40,41]. The amount of fumonisins produced may also vary in quantity depending on substrate [42], biotic and abiotic factors [43] as well as on the relative expression of the genes involved in the biosynthetic pathway [44]. In fact, fumonisin production in F. verticillioides is regulated by the FUM biosynthetic gene cluster [45], and some of the differences between strains can be explained by FUM gene sequence differences [46,47]. Thus, it is very important to determine the variations of fumonisin production by F. verticillioides to understand the biosynthetic potential of a certain population in a specific cultivation area.
The characterization of fumonisin biosynthesis by F. verticillioides strains isolated from different geographic areas has been often coupled to the study of the genetic structure of these populations to investigate the degree of genetic diversity between the different strains within the same species [44,48,49,50]. This can provide an important insight on the relationships, the variations and/or the similarities among strains originating from various regions as well as on the possible correlations between genetic variability and different fumonisin production [38,51,52,53,54]. Analyses of fumonisin biosynthesis and/or molecular characterization of F. verticillioides strains have been conducted in populations from different countries such as Argentina [55], Brazil [38,41,44,49], Italy [50], Iran [22,52], Ethiopia [53] and Nigeria [54].
A similar approach was adopted in the present work to characterize selected F. verticillioides strains originating from five Mediterranean countries to simultaneously compare them in a wider geographical context by evaluating their in vitro fumonisin production and genetic profile. Specifically, the main objectives of the present study were to:
(i)
investigate the abilities of selected F. verticillioides strains isolated from maize kernels in five Mediterranean countries to in vitro biosynthesize FB1, FB2 and FB3;
(ii)
characterize the genetic structure of these selected strains to assess for possible variability within strains originating from each of the surveyed countries and between the strains originating from different countries.

2. Materials and Methods

2.1. Fungal Strains

A total of 90 F. verticillioides strains (Table 1) isolated from single maize kernels harvested from different fields in five Mediterranean countries (22 from Italy, 9 from Spain, 16 from Tunisia, 28 from Egypt and 15 from Iran) were used in this study (Figure 1). Isolation operations were carried out in the country of origin where all strains were properly stored in fungal collections. The investigated strains had not been extensively subcultured, thus avoiding possible alterations in fumonisin production. Some of the Italian strains used in this work had been already investigated in a previous study [50] and were included to further characterize them in a wider geographical context (Figure 1).

2.2. Confirmation of F. verticillioides Identity by PCR Assays

To preliminarily confirm the identity of the 90 F. verticillioides strains used in this study, species-specific PCR assays were conducted. All strains were grown on Potato Dextrose Agar (PDA (Biolife Italiana, Milan, Italy)) at 22 °C for 14 d in the dark. DNA was extracted as described by Beccari et al. [56,57]. PCR assays were carried out with the specific primers VERT1 (GTCAGAATCCATGCCAGAACG) and VERT2 (CACCCGCAGCAATCCATCAG) [58]. A single PCR protocol was optimized using a total reaction of 20 μL. Each reaction contained 9.2 μL of sterile water for molecular biology (5prime, Hilden, Germany), 1.5 μL of cresol red (Sigma-Aldrich, Saint Louis, MO, USA), 2 μL of 10X PCR buffer (Microtech, Pozzuoli, Naples, Italy), 1.2 μL of magnesium chloride (Microtech), 2 μL of 10 mM DNTP mix (Microtech), 1 μL of 10 μM forward and reverse primers, 0.1 μL of 5 U/μL Taq polymerase (Microtech) and 2 μL of template DNA. The PCR cycle consisted of an initial denaturation step at 94 °C for 2 min, followed by 30 cycles of denaturation (94 °C for 35 s), annealing (60 °C for 30 s), extension (72 °C for 2 min) and a final extension at 72 °C for 5 min. PCR assays contained a positive control (template DNA of F. verticillioides) and a negative control with no DNA added. The amplification was performed in a T-100 thermal cycler (Bio Rad, Hercules, CA, USA). All PCR fragments were separated by electrophoresis by applying a tension of 110 V for about 1 h. Electrophoretic runs were visualized using an UV Image analyzer (Euroclone, Pero, Milan, Italy).

2.3. Determiantion of Fumonisin Biosynthesis by F. verticillioides In Vitro

2.3.1. F. verticillioides Cultures

To determine in vitro fumonisin biosynthesis, cultures of F. verticillioides strains were obtained following the protocol indicated by Covarelli et al. [50] with slight modifications. In brief, 15 g of finely ground maize grains and 15 mL of deionized sterile water were added into 100 mL glass flasks (Duran, Mainz, Germany) to obtain the right moisture for allowing fungal development and then autoclaved three times at alternate days. Three flasks (replicates) for each F. verticillioides strain were then inoculated with a mycelium plug (0.6 cm diameter) taken from the growing edge of one-week-old pure fungal cultures of each strain developed on PDA at 22 °C in the dark. Three flasks (replicates) were used as controls by adding only a PDA plug. Flasks were incubated in the dark at 22 °C for 4 w, and developed cultures were then freeze-dried for 24 h using a lyophilizer instrument (Heto Powder Dry LL3000, Thermo Fisher Scientific, Waltham, MA, USA), ground with mortar and pestle and stored at −80 °C until further analysis.

2.3.2. Fumonisin Extraction and LC-MS/MS Analysis

Each fungal culture was extracted and analyzed in triplicate according to the validated and routine procedure also described by Covarelli et al. [50] with slight modifications. In brief, 1 g of ground sample was extracted with 5 mL of methanol/water (75:25, v/v) following 60 min shaking. The extract was filtered through filter paper. Prior to liquid chromatography, tandem Mass Spectrometry (LC-MS/MS) analysis, the extract was diluted by default 1:50 with a mixture of methanol/water (60:40), then filtered through 0.45 µm syringe filter. Twenty microliters were injected into the LC-MS/MS apparatus. If fumonisin levels were out of the calibration range, a further dilution (1:500 or 1:5000) was applied to the raw extract and then re-analyzed.
LC-MS/MS analyses were performed on a QTrap MS/MS system, from Applied Biosystems (Foster City, CA, USA), equipped with an Electrospray Ionization (ESI) interface and a 1100 series micro-Liquid Chromatography system comprising a binary pump and a micro-autosampler from Agilent Technologies (Waldbronn, Germany). The analytical column was a Gemini® C18 column (150 × 2 mm, 5 µm particles) (Phenomenex, Torrance, CA, USA), preceded by a Gemini® C18 guard column (4 × 2 mm, 5 µm particles). The column oven was set at 40 °C. The flow rate of the mobile phase was 200 µL/min, and the injection volume was 20 µL.
The column effluent was directly transferred into the ESI interface, without splitting. Eluent A was water and eluent B was methanol, both containing 0.5% acetic acid. A gradient elution was performed as follows. The percentage of eluent B was increased from 40% to 80% in 10 min, kept constant 3 min, then increased to 100% in 1 min, and kept constant for 4 min. The column was re-equilibrated with 40% eluent B for 7 min. The ESI interface was used in positive ion mode with the following settings: temperature 350 °C; curtain gas, nitrogen, 30 psi; nebulizer gas, air, 10 psi; heater gas, air, 30 psi; ion spray voltage +4500 V. The mass spectrometer operated in Multiple Reaction Monitoring (MRM) mode. Mycotoxin quantification was performed by external calibration in neat solvent. The identity of fumonisins was confirmed by comparison with the analytical standard considering chromatography retention time and MRM transitions (ion ratios) in agreement with the official guidelines for mycotoxin identification by Mass Spectrometry [59]. Detection limits in maize fungal cultures were 0.002 µg/g for FB1 and 0.001 µg/g for FB2 and FB3.
Methanol (HPLC grade) and glacial acetic acid were purchased from Mallinckrodt Baker (Milan, Italy). Ultrapure water was produced by a Millipore Milli-Q system (Millipore, Bedford, MA, USA). Filter papers (Whatman no. 4) were obtained from Whatman International Ltd. (Maidstone, UK). HPLC syringe filters (regenerated cellulose, 0.45 µm) were from Alltech (Deerfield, IL, USA).

2.4. Genetic Structure of Different F. verticillioides Populations

For genetic diversity assessment, all F. verticillioides strains were cultured on PDA for 7 d. Mycelia were harvested, homogenized in liquid nitrogen, and genomic DNA was extracted using the method already described by Stępień et al. [60]. A pre-validated FUM1-specific marker that showed intraspecific polymorphism in F. verticillioides and F. proliferatum in previous studies [61,62] was used. Briefly, Fum1F1 (CACATCTGTGGGCGATCC)/Fum1R2 (ATATGGCCCCAGCTGCATA) primers were used for FUM1 gene fragment PCR-based amplification and sequencing according to Waśkiewicz et al. [61]. Additionally, FUM6-FUM7 and FUM7-FUM8 intergenic regions were amplified using the primers Fum6eF (AGATTTCCCAACAGTGGCAG)/Fum7bR (GTTTGCTTGGTGGAACTGGT) and Fum7eF (ATCCGGTTGAGTTGGACAAG)/Fum8eR (GGAACAGATGCCCATACCAT) according to Stępień et al. [47].
The BigDye Terminator kit v. 3.1 (Life Technologies, Carlsbad, CA, USA) was used for fluorescent labeling according to the manufacturer’s instructions. DNA fragments were purified using alkaline phosphatase and exonuclease I (Thermo Fisher Scientific)) and precipitated using ice-cold 96% ethanol (Sigma Aldrich, St. Louis, MO, USA). Sequence reading was performed using Applied Biosystems equipment. Sequence reads were analyzed using BioEdit software [63] and aligned using MEGA5 software package [64] using Maximum Parsimony heuristics with standard settings. Based on FUM1 sequences, the most parsimonious tree was calculated (bootstrap test with 1000 replications).
Sequences were compared to the NCBI GenBank-deposited sequence (FUM cluster NCBI (AF155733)) and, in addition, a total of five F. verticillioides FUM1 sequences (F.v.F1.8.I.I, F.v.10I3 (Pisum sativum, Wiatrowo, Poland); F.v.KF3477, F.v.F1M1.1 (Z. mays, Poland); F.v.KF3537 (Ananas comosus, Costa Rica)) were used as references. A total of four Fusarium proliferatum FUM1 sequences (15 F. proliferatum (Z. mays, Iran); F. proliferatum Gar3.2, Gar1 and Gar3.0 (Allium sativum, Poznan, Poland)) were used as outgroup.

2.5. Statistical Analysis

To analyze the in vitro fumonisin biosynthesis within each country of origin, total fumonisin content was submitted to ANOVA by allowing a different standard deviation per strain to comply with heteroscedasticity. Generalized least-squares were used for model fitting, as implemented in the gls() function of the nlme package [65] within the R statistical environment [66]. Heteroscedastic Welch’s t-tests were used for pairwise comparisons of strains, within country [67].

3. Results

3.1. Identity Confirmation of F. verticillioides

DNA extracted from the 90 F. verticillioides strains was subject to PCR assays using the species-specific primer pair VERT1/VERT2. As expected, a single fragment of 800 bp amplified in all the samples, thus confirming their identity as F. verticillioides.

3.2. Fumonisin Biosynthesis by F. verticillioides In Vitro

Data on the in vitro biosynthesis of FB1, FB2 and FB3 with the calculation of total fumonisins (sum of FB1, FB2 and FB3) by the 90 F. verticillioides strains are summarized in Table 1.
In general, this analysis revealed that 80% (n = 71) of the F. verticillioides strains investigated in this study were able to produce fumonisins at variable levels, while the remaining 20% (n = 19) showed undetectable levels (not detected; nd) of fumonisins and were considered, in this experimental condition, as non-producing strains.
Total fumonisins biosynthesized by all positive strains (n = 71) varied from 0.03 to 69.84 μg/g (average 7.88 μg/g), with FB1 being the most abundant analogue followed by FB2 and FB3. All positive strains (100%, n = 71) produced FB1 in levels ranging from 0.03–56.12 μg/g (average 5.9 μg/g), while 64 of 71 strains (90%) produced FB2 in levels ranging from 0.03–10.67 μg/g (average 1.6 μg/g). Finally, 59 of 71 strains (83%) biosynthesized FB3 in a range from 0.01–4.23 μg/g (average 0.7 μg/g). The average ratios of FB1:total fumonisins, FB2:total fumonisins and FB3:total fumonisins were 0.77, 0.13 and 0.05, respectively. The three fumonisin analogues analyzed in this study (FB1, FB2 and FB3) were simultaneously produced by 81% of positive strains (n = 58), while two analogues, FB1 and FB2 as well as FB1 and FB3, were simultaneously biosynthesized by 7% (n = 5) and 1% (n = 1) of positive strains, respectively. Finally, 7 out of 71 strains (10%) producerd only FB1. No strains biosynthesized FB2 or FB3 only.
In most cases, considering all producing strains (n = 71), differences in fumonisin production were detected among the strains isolated in the same country.
In detail, 20 out of 22 strains (91%; Figure 2) isolated from maize grains in Italy and analyzed in this study showed the ability to biosynthesize fumonisins in variable levels (Table 1). Total fumonisins biosynthesized by the Italian positive strains (n = 20) varied from 0.03 to 33.73 μg/g (average 9.98 μg/g). All fumonisin-producing Italian strains (100%, n = 20) biosynthesized FB1 in levels ranging from 0.03–23.87 μg/g (average 5.7 μg/g), while 19 out of 20 strains (95%) produced FB2 and FB3 in levels ranging from 0.03–5.63 μg/g (average 2.20 μg/g) and 0.05–4.23 μg/g (average 0.94 μg/g), respectively. The average ratios of FB1:total fumonisins, FB2:total fumonisins and FB3:total fumonisins were 0.71, 0.18 and 0.10, respectively. The three fumonisin analogues (FB1, FB2 and FB3) were simultaneously produced by 95% of positive Italian strains (n = 20), while 1 out of 20 strains (5%) produced only FB1. Strains ITEM 10027 and PG 36B showed a significantly higher biosynthesis of total fumonisins with respect to the other Italian strains (p < 0.02), with the exception of strains PG 58A1, PG 35A and PG 76A1 (p > 0.07).
Considering the Spanish strains analyzed in this study, all of them (100%, n = 9; Figure 2) were able to in vitro biosynthesize different levels of fumonisins. Total fumonisins produced by these strains ranged from 0.24 to 69.84 μg/g (average 14.01 μg/g) with FB1 being the most abundant (range 0.24–56.12 μg/g; average 10.9 μg/g), followed by FB2 (range 0.03–10.67 μg/g; average 2.4 μg/g) and FB3 (range 0.01–3.04 μg/g; average 0.7 μg/g). The average ratios of FB1:total fumonisins, FB2:total fumonisins and FB3:total fumonisins were 0.81, 0.15 and 0.04, respectively. Eight out of 9 strains (89%) simultaneously biosynthesized all three fumonisin analogues, while in 1 out of 9 strains (11%) only FB1 was detected. Strain 0-C-1–3 2/2 showed a significantly higher (p < 0.008) production of total fumonisins with respect to the other Spanish strains analyzed in this study.
Focusing on the Tunisian strains analyzed in this study, 15 out of 16 strains (94%; Figure 2) produced detectable amounts of fumonisins in vitro. Total fumonisin levels ranged from 0.33 to 13.59 μg/g, with an average production equal to 5.36 μg/g. Twelve out of 15 strains (80%) biosynthesized all the analogues, while 2 out of 15 strains (13%) produced FB1 and FB2, and the remaining strain (7%; n = 1) produced FB1 and FB3. The gradient of production did not differ from that detected for the other strains: FB1 (average 4.01 μg/g) > FB2 (average 0.86 μg/g) > FB3 (average 0.54 μg/g). The average ratios of FB1:total fumonisins, FB2:total fumonisins and FB3:total fumonisins were 0.76, 0.13 and 0.11, respectively. Strains M10, M14 and M1 showed significantly higher total fumonisin biosynthesis with respect to the other Tunisian strains (p < 0.02), with the exception of strains M21, M22, M7 and M8 (p > 0.05).
The F. verticillioides population isolated from maize kernels in Egypt and analyzed in this study showed a low percentage of fumonisin-producing strains (46%, n = 13; Figure 2) with an average total fumonisin production of 3.98 μg/g (range 0.22–11.23 μg/g). All producing strains biosynthesized FB1 (range 0.22–7.52 μg/g; average 2.95 μg/g), while 12 out of 13 strains (92%; average 0.77 μg/g) and 10 out of 13 strains (77%; average 0.40 μg/g) showed the ability to biosynthesize FB2 and FB3, respectively. In other words, 77% of producing strains were able to simultaneously produce all three fumonisin analogues, while 15% (n = 2) and 8% (n = 1) of the Egyptian strains showed the ability to biosynthesize FB1 and FB2 or FB1 alone, respectively. The average ratios of FB1: total fumonisins, FB2:total fumonisins and FB3:total fumonisins were 0.76, 0.17 and 0.09, respectively. The Egyptian strain F3 showed a significantly higher (p < 0.01) production of total fumonisins than F39, F29, F8, F4, F28, F9 and F32 strains.
In the F. verticillioides population isolated from maize kernels in Iran and anlyized in this study, a total of 14 fumonisin-producing strains were recovered (93%; Figure 2). Total fumonisins biosynthesized by all positive strains (n = 14) varied from 0.03 to 39.79 μg/g (average 7.28 μg/g). All producing Iranian strains (100%, n = 14) biosynthesized FB1 in levels ranging from 0.03–30.81 μg/g (average 5.57 μg/g), while 11 out of 14 strains (71%) produced FB2 in levels ranging from 0.1–7.23 μg/g (average 0.70 μg/g), and 10 out of 14 strains (64%) biosynthesized FB3 in levels ranging from 0.09–1.75 μg/g (average 0.70 μg/g), respectively. The average ratios of FB1:total fumonisins, FB2:total fumonisins and FB3:total fumonisins were 0.83, 0.14 and 0.07, respectively. The three fumonisin analogues (FB1, FB2 and FB3) were simultaneously produced by 64% of positive Iranian strains (n = 9), while 4 out of 14 strains (29%) produced only FB1, and 1 out of 14 strains (7%) biosynthesized FB1 and FB2. The Iranian strain 89 showed a significantly higher total fumonisin biosynthesis than the other strains from the same country (p < 0.01), with the exception of strains 5 and 7 (p > 0.05).
Taking into account all fumonisin-producing strains of each country analyzed in this study, differences in total fumonisin biosynthesis among countries were also detected (Figure 3). In particular, the Spanish strains used in this study showed a significantly higher total fumonisin production (average 14.01 μg/g) than the Egyptian ones (average 3.98 μg/g) (p = 0.02). Also, the total fumonisin productions detected for the Italian (average 9.98 μg/g), Tunisian (average 5.36 μg/g) and Iranian (average 6.79 μg/g) strains were higher than the Egyptian ones and lower than the Spanish ones, even if no significant differences were recorded (p > 0.46 and p > 0.47, respectively) (Figure 3).

3.3. Genetic Structure and Variability of F. verticillioides Populations

We sequenced a portion of a divergent FUM1 gene to evaluate the diversity among the five populations of F. verticillioides originating from various countries. All strains amplified DNA fragments of about 1100 bp in length. Additionally, the FUM6-FUM7 (ca. 550 bp) and FUM7-FUM8 (ca. 500 bp) intergenic regions were sequenced using the primers described previously [47].
The sequences were aligned, the ends trimmed manually using MEGA 5 software, and dendrograms of similarities were calculated. Interestingly, the intergenic regions did not show polymorphisms, which was rather unexpected, since these regions normally accumulated more point mutations than the coding regions. However, this means that the F. verticillioides strains characterized in this study, even if originating from different countries, were basically uniform (results not shown).
Therefore, only slightly more polymorphic FUM1 sequences were analyzed and shown (Figure 4). Apparently, neither geographical origin nor fumonisin production ability were correlated to the genetic diversity of the strain set, as almost all of them grouped together. Only four strains from Egypt (F10, F12, F13 and F36) were distinguished from the remaining strains at a bootstrap value of 60, including our five reference sequences [61] and NCBI GenBank-deposited FUM cluster sequences (AF155773) reported by Proctor et al. [45].

4. Discussion

This study was aimed at investigating the different ability of selected F. verticillioides strains isolated from maize kernels harvested in five Mediterranean countries to in vitro biosynthesize fumonisins as well as at characterizing their genetic structure to assess possible variabilities among them. So far, various studies have been conducted to analyze the ability of different F. verticillioides strains from diverse geographic areas to biosynthesize fumonisins. In several investigations, a large percentage of strains able to produce detectable amounts of these mycotoxins were usually found. However, the presence of strains that were not able to biosynthesize measurable levels of fumonisins was also reported. In this research, the majority of the strains isolated from maize grains in Italy, Spain, Tunisia and Iran, analyzed in this study, produced detectable levels of fumonisins (91%, 100%, 94% and 94% respectively; Figure 2), while the remaining part showed a lack of ability to produce measurable amounts of these mycotoxins. Similar percentages of fumonisin-producing strains (> 80%) were also detected in other F. verticillioides populations isolated from maize in Croatia [68], Spain [15,69], Italy [50], Iran [22], Egypt [17], Brazil [41,44,49], Korea [70], USA [71], Argentina [55,72] and from durum wheat in Argentina [2].
Conversely, in this study, only 46% of the analyzed Egyptian strains showed the ability to biosynthesize detectable amounts of fumonisins (Figure 2). Similarly to other studies, low incidences of producing strains were also recorded in other F. verticillioides populations such as those isolated from maize in Croatia (55%) [73], Taiwan (66%) [74] and Spain (36%) [14].
In general, the producing strains analyzed in this study biosynthesized fumonisin analogues following the “typical” gradient: FB1 > FB2 > FB3. A predominance of FB1 compared to the other analyzed fumonisin analogues was recovered also in other F. verticillioides populations such as those isolated from maize in Spain [15,75], Italy [76], Iran [22], Brazil [44,49], Argentina [55,72], Egypt [17], South Korea and South Africa [39]. In this study, no F. verticillioides strains producing more FB2 or FB3 than FB1 were recorded. Conversely, these types of strains were observed in F. verticillioides populations isolated from durum wheat in Argentina [2] and from maize and sorghum cultivated in the United States [77].
As known, fumonisin production within the F. verticillioides species could quantitatively vary due to the different biosynthetic ability of the different strains [24,40]. Also in this study, variability of fumonisin production among strains isolated in the same country was found, highlighting that mycotoxigenic diversity occurred within the five investigated F. verticillioides populations. Variability among F. verticillioides strains isolated from maize in the same country was commonly detected in many surveys in other parts of the world [2,8,15,17,22,44,49,55,73,74,75].
Variability in fumonisin production was also recorded among F. verticillioides strains isolated from different countries [30,39,71]. Also in this study, differences in fumonisin production among strains of different geographic origin were detected. In particular, the Spanish and Egyptian strains analyzed in this study showed a high level of mycotoxigenic variability, being the populations with the highest and the lowest fumonisin productions, respectively.
Interestingly, these two populations were also those with the highest and lowest percentages of fumonisin-producing (Spain) and non-producing (Egypt) strains. Conversely, the other three investigated populations of F. verticillioides (isolated from Italy, Tunisia and Iran) considered in this study did not show a significant variability of fumonisin production. In agreement with the results of Vogelgsang et al. [78], it is important to consider that in vitro results cannot be fully extrapolated to in vivo conditions because there are several factors influencing Fusarium infections and secondary metabolite production in the field. However, in vitro results could provide important information, which may be useful to understand intra-population variability within a single country as well as inter-population variability among different countries.
In this study, the mycotoxigenic characterization of F. verticillioides strains from different geographic origins was coupled to the study of the genetic structure of these populations. The genetic diversity of F. verticillioides has been studied using multiple techniques, including AFLP and RAPD methods [50,53,79]. Recently, however, direct sequencing of specific genomic regions has become more popular because of its high discrimination power and accuracy. The FUM1 gene has already beeeen proven to be useful to assess species diversity inside the FFSC, serving as a source of phylogenetic and chemotypic markers [47], showing often higher levels of polymorphisms than constitutively expressed genes [e.g., beta tubulin (tub2) or translation elongation factor 1α (tef-1α)].
Our previous studies suggested there might be high levels of intraspecific genetic uniformity inside F. verticillioides populations, particularly when compared to the high diversity of the closely related species F. proliferatum [61,62,80,81]. The use of the FUM1 gene sequence analysis allowed for discrimination of subpopulations likely related to the host species of origin. We assumed that a similar rule would be valid for F. verticillioides; therefore, we added some pea- and pineapple-derived strains to the analysis (Figure 4). It was also possible that geographical differences between populations would become visible.
However, in the present study we could not confirm this hypothesis. In fact, this was in accordance to previous findings, which did not reveal significant differences between F. verticillioides strains from different hosts [61]. This was also confirmed by the sequence analysis of the intergenic regions between FUM6 and FUM7 as well as FUM7 and FUM8 genes (results not shown), which were previously used for polymorphism screening [47]. The most likely explanation for this situation may be the endophytic type of growth observed for this pathogen in maize, which combined with the extensive seed material transfer between countries and continents made the population uniform across the world. Another possibility is that FUM cluster integrity and structure undergoes much more strict selection pressure in F. verticillioides than in F. proliferatum. This may implicate that fumonisin production by F. verticillioides is more essential to complete its life cycle than it is for F. proliferatum. This issue was already reported by Glenn et al. [82] but never confirmed for F. proliferatum.
The only outlier obtained in this study was a group of four strains (F10, F12, F13 and F36) isolated from Egypt (Figure 4), which was distinct from the remaining strains. Only one of these strains (F13) produced fumonisins in detectable amounts (Table 1). They should be further studied to explain their genetic diversity.

5. Conclusions

In this study, we analyzed fumonisin production as well as genetic structures of five F. verticillioides populations isolated from maize kernels in five Mediterranean countries.
The characterization of a selected number of strains per country does not allow a general conclusion to be drawn at the country level; however, the results obtained in these experimental conditions highlighted:
(i)
the presence of an Egyptian population which differed from the others for its low percentage of fumonisin-producing strains;
(ii)
the presence of significant differences in fumonisin production within the strains isolated in each of the surveyed countries and, in some cases, also among populations isolated from different countries;
(iii)
the high level of genetic uniformity inside the populations analyzed;
(iv)
the general absence of correlation between geographical origin and/or fumonisin production ability with the genetic diversity of the strain set;
(v)
the presence of four Egyptian strains that were distinguished from the other strains at a bootstrap value of 60.

Author Contributions

Conceptualization, L.C.; validation, G.B. and Ł.S.; formal analysis, Ł.S., A.O. and V.M.T.L.; investigation, G.B., Ł.S., V.M.T.L., B.C., S.I.A.-E.F., F.V. and M.U.; resources, Ł.S., V.M.T.L. and L.C.; data curation, G.B. and Ł.S.; writing—original draft preparation, G.B.; writing—review and editing, Ł.S., V.M.T.L. and L.C.; visualization, G.B.; supervision, L.C. All authors have read and agree to the published version of the manuscript.

Funding

This research received no external funding.

Acknowledgments

The authors wish to thank Antonio Moretti (National Research Council, ISPA-CNR, Bari, Italy) for providing the Italian strains from the ITEM collection, Vicente Sanchis (University of Lleida, Spain) for providing the strains from Spain, Souheib Oueslati (Université Libre de Tunis, Tunisia) for providing the strains from Tunisia and Younes Rezaee Danesh (Urmia University, Urmia, Iran) for providing the strains from Iran.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. O’Donnell, K.; Nirenberg, H.I.; Aoki, T.; Cigelnik, E. A multigene phylogeny of the Gibberella fujikuroi species complex: detection of additional phylogenetic distinct species. Mycoscience 2000, 41, 61–78. [Google Scholar] [CrossRef]
  2. Palacios, S.A.; Susca, A.; Haidukowski, M.; Stea, G.; Cendoya, E.; Ramírez, M.L.; Chulze, S.N.; Farnochi, M.C.; Moretti, A.; Torres, A.M. Genetic variability and fumonisin production by Fusarium proliferatum isolated from durum wheat grains in Argentina. Int. J. Food Microbiol. 2015, 18, 35–41. [Google Scholar] [CrossRef]
  3. Kvas, M.; Marasas, W.F.O.; Wingfield, B.D.; Wingfield, M.J.; Steenkamp, E.T. Diversity and evolution of Fusarium species in the Gibberella fujikuroi complex. Fungal Divers. 2009, 34, 1–21. [Google Scholar]
  4. Logrieco, A.; Mulè, G.; Moretti, A.; Bottalico, A. Toxigenic Fusarium species and mycotoxins associated with maize ear rot in Europe. Eur. J. Plant Pathol. 2002, 108, 597–609. [Google Scholar] [CrossRef]
  5. Folcher, L.; Jarry, M.; Weissenberger, A.; Gérault, F.; Eychenne, N.; Delos, M.; Regnault-Roger, C. Comparative activity of agrochemical treatments on mycotoxin levels with regard to corn borers and Fusarium mycoflora in maize (Zea mays L.) fields. Crop Prot. 2009, 28, 302–308. [Google Scholar] [CrossRef]
  6. Bottalico, A. Fusarium diseases of cereals: Species complex and related mycotoxins profiles, in Europe. J. Plant Pathol. 1998, 80, 85–103. [Google Scholar]
  7. Oldenburg, E.; Höppner, F.; Ellner, F.; Weinert, J. Fusarium disease of maize associated with mycotoxin contamination of agricultural products intended to be used for food and feed. Mycotoxin Res. 2017, 33, 167–182. [Google Scholar] [CrossRef]
  8. Marín, S.; Ramos, A.J.; Cano-Sancho, G.; Sanchis, V. Reduction of mycotoxins and toxigenic fungi in the Mediterranean basin maize chain. Phytopathol. Mediterr. 2012, 51, 93–118. [Google Scholar]
  9. Fandohan, P.; Hell, K.; Marasas, W.F.O.; Wingfield, M.J. Infection of maize by Fusarium species and contamination with fumonisin in africa. Afr. J. Biotechnol. 2003, 2, 570–579. [Google Scholar]
  10. Mirzadi Gohari, A.M.; Javan-Nikkhah, M.; Hedjaroude, G.A.; Abbasi, M.; Rahjoo, V.; Sedaghat, N. Genetic diversity of Fusarium verticillioides isolates from maize in Iran based on vegetative compatibility grouping. J. Plant Pathol. 2008, 90, 113–116. [Google Scholar]
  11. Covarelli, L.; Beccari, G.; Salvi, S. Infection by mycotoxigenic fungal species and mycotoxin contamination of maize grain in Umbria, central Italy. Food Chem. Toxicol. 2011, 49, 2365–2369. [Google Scholar] [CrossRef] [PubMed]
  12. Venturini, G.; Assante, G.; Vercesi, A. Fusarium verticillioides contamination patterns in northern Italian maize during the growing season. Phytopathologia Mediterr. 2011, 50, 110–120. [Google Scholar]
  13. Lazzaro, I.; Moretti, A.; Giorni, P.; Brera, C.; Battilani, P. Organic vs conventional farming: differences in infection by mycotoxin-producing fungi on maize and wheat in Northern and Central Italy. Crop Prot. 2015, 72, 22–30. [Google Scholar] [CrossRef]
  14. Sala, N.; Sanchis, V.; Vilaro, P.; Viladrich, R.; Torres, M.; Viñas, I.; Canela, R. Fumonisin producing capacity of Fusarium strains isolated from cereals in Spain. J. Food Prot. 1994, 57, 915–917. [Google Scholar] [CrossRef]
  15. Ariño, A.; Juan, T.; Estopañan, G.; González-Cabo, J.F. Natural occurrence of Fusarium species, fumonisin production by toxigenic strains, and concentrations of fumonisins B1 and B2 in conventional and organic maize grown in Spain. J. Food Protect. 2007, 70, 151–156. [Google Scholar] [CrossRef]
  16. Aguín, O.; Cao, A.; Pintos, C.; Santiago, R.; Mansilla, P.; Butrón, A. Occurence of Fusarium species in maize kernels grown in northwestern Spain. Plant Pathol. 2014, 63, 946–951. [Google Scholar] [CrossRef] [Green Version]
  17. Fadl Allah, E.M. Occurrence and toxigenicity of Fusarium moniliforme from freshly harvested maize ears with special references to fumonisin production in Egypt. Mycopathologia 1998, 140, 99–103. [Google Scholar] [CrossRef]
  18. Aboul-Nasr, M.B.; Obied-Allah, M.R.A. Biological and chemical detection of fumonisins produced on agar medium by Fusarium verticillioides isolates collected from corn in Sohag, Egypt. Microbiology 2013, 159, 1720–1724. [Google Scholar] [CrossRef] [Green Version]
  19. Abd El-Fatah, S.I.; Naguib, M.M.; El-Hossiny, E.N.; Sultan, Y.Y. Occurrence of Fusarium species and the potential accumulation of its toxins in Egyptian maize grains. Int. J. Adv. Res. 2015, 3, 1435–1444. [Google Scholar]
  20. Abd-El Fatah, S.I.; Naguib, M.M.; El-Hossiny, E.N.; Sultan, Y.Y.; Abodalam, T.H.; Yli-Mattila, T. Molecular versus morphological identification of Fusarium spp. isolated from Egyptian corn. Res. J. Pharm. Biol. Chem. Sci. 2015, 6, 1813–1822. [Google Scholar]
  21. Hussien, T.; Carlobos-Lopez, A.L.; Cumagun, C.J.R.; Yli-Mattila, T. Identification and quantification of fumonisin-producing Fusarium species in grain and soil samples from Egypt and the Philippines. Phytopathol. Mediterr. 2017, 56, 146–153. [Google Scholar]
  22. Ghiasian, S.A.; Rezayat, S.M.; Kord-Bacheh, P.; Hossein, M.; Yazdanpanah, H.; Shephard, G.S.; van der Westhuizen, L.; Vismer, H.; Marasas, W.F.O. Fumonisin production by Fusarium species isolated from freshly harvested corn in Iran. Mycopathologia 2005, 159, 31–40. [Google Scholar] [CrossRef]
  23. Gelderblom, W.C.A.; Jaskiewicz, J.; Marasas, W.F.O.; Thiel, P.G.; Horak, R.M.; Vleggar, R.; Kriek, N.P.J. Fumonisins—Novel mycotoxins with cancer-promoting activity produced by Fusarium moniliforme. Appl. Environ. Microbiol. 1988, 54, 1806–1811. [Google Scholar] [CrossRef] [Green Version]
  24. Ferrigo, D.; Raiola, A.; Causin, R. Fusarium toxins in cereals: Occurrence, legislation, factors promoting the appearance and their management. Molecules 2016, 21, 627. [Google Scholar] [CrossRef] [Green Version]
  25. Shephard, G.S.; Marasas, W.F.O.; Leggott, N.L.; Yazdanpanah, H.; Rahimian, H. Natural occurrence of fumonisins in corn from Iran. J. Agric. Food Chem. 2000, 48, 1860–1864. [Google Scholar] [CrossRef]
  26. African Development Bank Group. Annual Core Data. Available online: http://high5.opendataforafrica.org (accessed on 28 June 2018).
  27. Food and Agriculture Organization of the United Nations. Statistic Division Database 2014. Available online: http://faostat.fao.org (accessed on 3 January 2018).
  28. Lanubile, A.; Maschietto, V.; Borrelli, V.M.; Stagnati, L.; Logrieco, A.F.; Marocco, A. Molecular basis of resistance to Fusarium ear rot in maize. Front. Plant Sci. 2017, 8, 1774. [Google Scholar] [CrossRef]
  29. Marasas, W.F.O. Discovery and occurrence of the fumonisins: A historical perspective. Environ. Health Perspect. 2011, 109, 239–243. [Google Scholar]
  30. Rheeder, J.P.; Marasas, W.O.; Vismer, H.F. Production of fumonisin analogs by Fusarium species. Appl. Environ. Microbiol. 2002, 68, 2101–2105. [Google Scholar] [CrossRef] [Green Version]
  31. Summary and Conclusions. In Proceedings of the Eighty-Third Meeting, Joint FAO/WHO Expert Committee on Food Additives, Rome, Italy, 8–17 November 2016; p. 15.
  32. Bondy, G.; Mehta, R.; Caldwell, D.; Coady, L.; Armstrong, C.; Savard, M.; Miller, J.D.; Chomyshyn, E.; Bronson, R.; Zitomer, N.; et al. Effect of long term exposure to the mycotoxin fumonisin B1 in p53 heterozygous and p53 homozygous transgenic mice. Food Chem. Toxicol. 2012, 50, 3604–3613. [Google Scholar] [CrossRef]
  33. Escriva, L.; Font, G.; Manyes, L. In vivo studies of fusarium mycotoxins in the last decade: A review. Food Chem. Toxicol. 2015, 78, 185–206. [Google Scholar] [CrossRef]
  34. Müller, S.; Dekant, W.; Mally, A. Fumonisin B1 and the kidney: Modes of action for renal tumor formation by fumonisin B1 in rodents. Food Chem. Toxicol. 2012, 50, 3833–3846. [Google Scholar]
  35. Missmer, S.A.; Suarez, L.; Felkner, M.; Wang, E.; Merril, A.H., Jr.; Rothman, K.J.; Hendricks, K.A. Exposure to fumonisins and the occurrence of neural tube defects along the Texas-Mexico border. Environ. Health Perspect. 2006, 114, 237–241. [Google Scholar] [CrossRef] [PubMed]
  36. European Commission. Commission Recommendation (EC) 2006/576/CE on the presence of deoxynivalenol, zearalenone, ocharatoxin A, T-2 and HT-2 and fumonisins in products intended for animal feeding. Off. J. Eur. Union 2006, L229, 7–9. [Google Scholar]
  37. European Commission. Commission Regulation (EC) No. 1126/2007 on maximum levels for certain contaminants in foodstuffs as regards Fusarium toxins in maize and maize products. Off. J. Eur. Union 2007, L255, 14–17. [Google Scholar]
  38. Silva, J.J.; Viaro, H.P.; Ferranti, L.S.; Oliveira, A.L.M.; Ferreira, J.M.; Ruas, C.F.; Ono, E.Y.S.; Fungaro, M.H.P. Genetic structure of Fusarium verticillioides populations and occurrence of fumonisins in maize grown in Southern Brazil. Crop Prot. 2017, 99, 160–167. [Google Scholar] [CrossRef]
  39. Sewram, V.; Mshicileli, N.; Shephard, G.S.; Vismer, H.F.; Rheeder, J.P.; Lee, Y.; Leslie, J.F.; Marasas, W.F.O. Production of fumonisin B and C analogues by several Fusarium species. J. Agric. Food Chem. 2005, 53, 4861–4866. [Google Scholar] [CrossRef]
  40. Logrieco, A.; Moretti, A.; Perrone, G.; Mulè, G. Biodiversity of complexes of mycotoxigenic fungal species associated with Fusarium ear rot of maize and Aspergillus rot of grape. Int. J. Food Microbiol. 2007, 119, 11–16. [Google Scholar] [CrossRef]
  41. Lanza, F.E.; Zambolim, L.; da Costa, R.V.; Queiroz, V.A.V.; Cota, L.V.; da Silva, D.D.; de Souza, A.G.C.; Figueiredo, J.E.F. Prevalence of fumonisin-producing Fusarium species in Brazilian corn grains. Crop Prot. 2014, 65, 232–237. [Google Scholar] [CrossRef]
  42. Falavigna, C.; Lazzaro, I.; Galaverna, G.; Dall’Asta, C.; Battilani, P. Oleoyl and linoleoyl esters of fumonisin B1 are differently produced by Fusarium verticillioides on maize and rice based media. Int. J. Food Microbiol. 2016, 217, 79–84. [Google Scholar] [CrossRef]
  43. Marín, S.; Magan, N.; Ramos, A.J.; Sanchis, V. Fumonisin-producing strains of Fusarium: A review of their ecophysiology. J. Food Prot. 2004, 67, 1792–1805. [Google Scholar]
  44. Rocha, L.O.; Barroso, V.M.; Andrade, L.J.; Pereira, G.H.A.; Ferreira-Castro, F.L.; Duarte, A.P.; Michelotto, M.D.; Correa, B. FUM gene expression profile and fumonisin production by Fusarium verticillioides inoculated in Bt and non-Bt Maize. Front. Microbiol. 2015, 6, 1503. [Google Scholar] [CrossRef] [PubMed]
  45. Proctor, R.H.; Brown, D.W.; Plattner, R.D.; Desjardins, A.E. Co-expression of 15 contiguous genes delineates a fumonisin biosynthetic gene cluster in Gibberella moniliformis. Fungal Genet. Biol. 2003, 38, 237–249. [Google Scholar] [CrossRef]
  46. Proctor, R.H.; Plattner, R.D.; Desjardins, A.E.; Busman, M.; Butchko, R.A.E. Fumonisin production in the maize pathogen Fusarium verticillioides: Genetic basis of naturally occurring chemical variation. J. Agric. Food Chem. 2006, 54, 2424–2430. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  47. Stępień, Ł.; Koczyk, G.; Waśkiewicz, A. FUM cluster divergence in fumonisins-producing Fusarium species. Fungal Biol. 2011, 115, 112–123. [Google Scholar] [CrossRef]
  48. Moretti, A.; Mulè, G.; Susca, A.; González-Jaén, M.T.; Logrieco, A. Toxin profile, fertility and AFLP analysis of Fusarium verticillioides from banana fruits. Eur. J. Plant Pathol. 2004, 110, 601–609. [Google Scholar] [CrossRef]
  49. da Silva, V.N.; Fernandes, F.M.C.; Cortez, A.; Ribeiro, D.H.B.; de Almeida, A.P.; Hassegawa, R.H.; Corrêa, B. Characterization and genetic variability of Fusarium verticillioides strains isolated from corn and sorghum in Brazil based on fumonisins production, microsatellites, mating type locus, and mating cross. Can. J. Microbiol. 2006, 52, 798–804. [Google Scholar] [CrossRef]
  50. Covarelli, L.; Stifano, S.; Beccari, G.; Raggi, L.; Lattanzio, V.M.T.; Albertini, E. Characterization of Fusarium verticillioides strains isolated from maize in Italy: Fumonisins production, pathogenicity and genetic variability. Food Microbiol. 2012, 31, 17–24. [Google Scholar] [CrossRef]
  51. Reynoso, M.M.; Chulze, S.N.; Zeller, K.A.; Torres, A.M.; Leslie, J.F. Genetic structure of Fusarium verticillioides populations isolated from maize in Argentina. Eur. J. Plant Pathol. 2009, 123, 207–215. [Google Scholar] [CrossRef]
  52. Momeni, H.; Nazari, F. Population genetic structure among Iranian isolates of Fusarium verticillioides. J. Plant Pathol. Microbiol. 2016, 7, 6. [Google Scholar] [CrossRef]
  53. Tsehaye, H.; Elameen, A.; Tronsmo, A.M.; Sundheim, L.; Tronsmo, A.; Assefa, D.; Brurberg, M.B. Genetic variation among Fusarium verticillioides isolates associated with Ethiopian maize kernels as revealed by AFLP analysis. Eur. J. Plant Pathol. 2016, 146, 807–816. [Google Scholar] [CrossRef]
  54. Olowe, O.M.; Odebode, A.C.; Olawuyi, O.J.; Sobowale, A.A. Molecular variability of Fusarium verticillioides (Sacc.) in maize from three agro-ecological zones of southwest Nigeria. Am. J. Mol. Biol. 2017, 7, 30–40. [Google Scholar] [CrossRef] [Green Version]
  55. Reynoso, M.M.; Torres, A.M.; Chulze, S.N. Fusaproliferin, beauvericin and fumonisin production by different mating populations among Gibberella fujikuroi complex isolated from maize. Mycol. Res. 2004, 108, 154–160. [Google Scholar] [CrossRef]
  56. Beccari, G.; Caproni, L.; Tini, F.; Uhlig, S.; Covarelli, L. Presence of Fusarium species and other toxigenic fungi in malting barley and multi-mycotoxin analysis by liquid chromatography-high-resolution mass spectrometry. J. Agric. Food Chem. 2016, 64, 4390–4399. [Google Scholar] [CrossRef]
  57. Beccari, G.; Colasante, V.; Tini, F.; Senatore, M.T.; Prodi, A.; Sulyok, M.; Covarelli, L. Causal agents of Fusarium head blight of durum wheat (Triticum durum Desf.) in central Italy and their in vitro biosynthesis of secondary metabolites. Food Microbiol. 2018, 70, 17–27. [Google Scholar] [CrossRef]
  58. Patiño, B.; Mirete, S.; González-Jaén, M.T.; Mulé, G.; Rodríguez, M.T.; Vázquez, C. PCR detection assay of fumonisin-producing Fusarium verticillioides strains. J. Food Prot. 2004, 67, 1278–1283. [Google Scholar] [CrossRef]
  59. SANTE/12089/2016. Guidance Document on Identification of Mycotoxins in Food and Feed; SANTE: Warszawa, Poland, 2016. [Google Scholar]
  60. Stępień, Ł.; Jestoi, M.; Chełkowski, J. Cyclic hexadepsipeptides in wheat field samples and esyn1 gene divergence among enniatin producing Fusarium avenaceum strains. World Mycotoxin J. 2013, 6, 399–409. [Google Scholar] [CrossRef]
  61. Waśkiewicz, A.; Stępień, Ł.; Wilman, K.; Kachlicki, P. Diversity of pea-associated F. proliferatum and F. verticillioides populations revealed by FUM1 sequence analysis and fumonisin biosynthesis. Toxins 2013, 5, 488–503. [Google Scholar] [CrossRef] [Green Version]
  62. Stępień, Ł.; Waśkiewicz, A.; Wilman, K. Host extract modulates metabolism and fumonisin biosynthesis by the plant-pathogenic fungus Fusarium proliferatum. Int. J. Food Microbiol. 2015, 193, 74–81. [Google Scholar] [CrossRef]
  63. Hall, T. BioEdit: An important software for molecular biology. GERF Bull. Biosci. 2011, 2, 60–61. [Google Scholar]
  64. Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 2011, 28, 2731–2739. [Google Scholar] [CrossRef] [Green Version]
  65. Pinheiro, J.C.; Bates, D.M. Mixed-Effects Models in S and S-Plus; Springer: New York, NY, USA, 2000. [Google Scholar]
  66. R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2017; Available online: https://www.R-project.org (accessed on 10 September 2018).
  67. Welch, B.L. The generalization of “Student’s” problem when several different population variances are involved. Biometrika 1947, 34, 28–35. [Google Scholar] [CrossRef]
  68. Segvic, M.; Pepeljnjak, S. Distribution and fumonisin B1 production capacity of Fusarium moniliforme isolated from corn in Croatia. Period. Biol. 2003, 105, 275–279. [Google Scholar]
  69. Castella, G.; Bragulat, M.R.; Cabañes, F.J. Mycoflora and fumonisin-producing strains of Fusarium moniliforme in mixed poultry and component raw material. Mycopathologia 1996, 133, 181–184. [Google Scholar] [CrossRef]
  70. Lee, U.S.; Lee, M.Y.; Shin, W.S.; Min, Y.S.; Cho, C.M.; Yoshio, U. Production of fumonisin B1 and B2 by Fusarium moniliforme isolated from Korean corn kernels for feed. Mycotoxin Res. 1994, 10, 67–72. [Google Scholar]
  71. Nelson, P.E.; Plattner, R.D.; Shackelford, D.D.; Desjardins, A.E. Production of fumonisins by Fusarium moniliforme strains from various substrates and geographic areas. Appl. Environ. Microbiol. 1991, 57, 2410–2412. [Google Scholar] [CrossRef] [Green Version]
  72. Chulze, S.; Ramirez, M.L.; Pascale, M.; Visconti, A. Fumonisin production by, and mating type population of, Fusarium section Liseola isolates from maize in Argentina. Mycol. Res. 1998, 102, 141–144. [Google Scholar] [CrossRef]
  73. Cvetnić, Z.; Pepeljkjak, S.; šegvić, M. Toxigenic potential of Fusarium species isolated from non-harvested maize. Arh. Hig. Rada. Toksikol. 2005, 56, 275–280. [Google Scholar]
  74. Tseng, T.C.; Lee, K.L.; Deng, T.S.; Liu, T.S.; Liu, C.Y.; Huang, J.W. Production of fumonisins by Fusarium species of Taiwan. Mycopathologia 1995, 130, 117–121. [Google Scholar] [CrossRef]
  75. Sanchis, V.; Abadias, M.; Oncins, L.; Sala, N.; Viñas, I.; Canela, R. Fumonisins B1 and B2 and toxigenic Fusarium strains in feeds from the Spanish market. Int. J. Food Microbiol. 1995, 27, 37–44. [Google Scholar] [CrossRef]
  76. Moretti, A.; Bennett, G.A.; Logrieco, A.; Bottalico, A.; Beremand, M.N. Fertility of Fusarium moniliforme from maize and sorghum related to fumonisin production in Italy. Mycopathologia 1995, 131, 25–29. [Google Scholar] [CrossRef]
  77. Plattner, R.D.; Desjardins, A.E.; Leslie, J.F.; Nelson, P.E. Identification and characterization of strains of Gibberella fujikuroi mating population A with rare fumonisin production phenotypes. Mycologia 1996, 88, 416–424. [Google Scholar] [CrossRef]
  78. Vogelgsang, S.; Sulyok, M.; Bäzinger, I.; Krska, R.; Schuhmacher, R.; Forrer, H.R. Effect of fungal strain and cereal susbtrate on in vitro mycotoxin production by Fusarium poae and Fusarium avenaceum. Food Add. Contam. 2008, 25, 745–757. [Google Scholar] [CrossRef] [PubMed]
  79. Ortiz, C.S.; Richards, C.; Terry, A.; Parra, J.; Won-Bo, S. Genetic variability and geographical distribution of mycotoxigenic Fusarium verticillioides strains isolated from maize fields in Texas. Plant Pathol. J. 2015, 31, 203–211. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  80. Gálvez, L.; Urbaniak, M.; Waśkiewicz, A.; Stępień, Ł.; Palmero, D. Fusarium proliferatum – Causal agent of garlic bulb rot in Spain: Genetic variability and mycotoxin production. Food Microbiol. 2017, 67, 41–48. [Google Scholar] [CrossRef]
  81. Stępień, Ł.; Koczyk, G.; Waśkiewicz, A. Genetic and phenotypic variation of Fusarium proliferatum isolates from different host species. J. Appl. Genet. 2011, 52, 487–496. [Google Scholar] [CrossRef] [Green Version]
  82. Glenn, A.E.; Zitomer, N.C.; Zimeri, A.M.; Williams, L.D.; Riley, R.T.; Proctor, R.H. Transformation-mediated complementation of a FUM gene cluster deletion in Fusarium verticillioides restores both fumonisin production and pathogenicity on maize seedlings. Mol. Plant Microbe Interact. 2008, 21, 87–97. [Google Scholar] [CrossRef] [Green Version]
Microorganisms 08 00241 g001 550
Figure 1. Countries of origin (red dots) of the Fusarium verticillioides strains used in this study. Map downloaded from www.google.com/maps and modified by the authors.
Figure 1. Countries of origin (red dots) of the Fusarium verticillioides strains used in this study. Map downloaded from www.google.com/maps and modified by the authors.
Microorganisms 08 00241 g001
Microorganisms 08 00241 g002 550
Figure 2. Fusarium verticillioides strains (%) isolated from maize kernels harvested in five Mediterranean countries that showed in vitro production of detectable (fumonisin producers) and non-detectable levels (fumonisin non-producers) of total fumonisins. Italy, n = 22; Spain, n = 9; Tunisia, n = 16; Egypt, n = 28; Iran, n = 15.
Figure 2. Fusarium verticillioides strains (%) isolated from maize kernels harvested in five Mediterranean countries that showed in vitro production of detectable (fumonisin producers) and non-detectable levels (fumonisin non-producers) of total fumonisins. Italy, n = 22; Spain, n = 9; Tunisia, n = 16; Egypt, n = 28; Iran, n = 15.
Microorganisms 08 00241 g002
Microorganisms 08 00241 g003 550
Figure 3. Average of total fumonisins (μg/g) biosynthesized by Fusarium verticillioides fumonisin-producing strains isolated from maize kernels harvested in each of the five countries analyzed in this study. Means with different letters are significantly different (p < 0.05).
Figure 3. Average of total fumonisins (μg/g) biosynthesized by Fusarium verticillioides fumonisin-producing strains isolated from maize kernels harvested in each of the five countries analyzed in this study. Means with different letters are significantly different (p < 0.05).
Microorganisms 08 00241 g003
Microorganisms 08 00241 g004 550
Figure 4. A most parsimonious tree calculated based on the partial FUM1 sequences of 90 Fusarium verticillioides strains isolated from Zea mays of different origins using the maximum parsimony setting, bootstrap set to 50%, and 1000 replications were done. Five reference strains isolated from Pisum sativum (F.v. F1.8.I.I; F.v. 10 I 3), Z. mays (F.v. KF3477; F.v. F1M1.1) and Ananas comosus (F.v. KF3537) were added to the analysis, as well as the NCBI GenBank-deposited FUM cluster sequences (AF155773). Four Fusarium proliferatum sequences were also included as outgroup (15; Gar3.2; Gar1; Gar3.0).
Figure 4. A most parsimonious tree calculated based on the partial FUM1 sequences of 90 Fusarium verticillioides strains isolated from Zea mays of different origins using the maximum parsimony setting, bootstrap set to 50%, and 1000 replications were done. Five reference strains isolated from Pisum sativum (F.v. F1.8.I.I; F.v. 10 I 3), Z. mays (F.v. KF3477; F.v. F1M1.1) and Ananas comosus (F.v. KF3537) were added to the analysis, as well as the NCBI GenBank-deposited FUM cluster sequences (AF155773). Four Fusarium proliferatum sequences were also included as outgroup (15; Gar3.2; Gar1; Gar3.0).
Microorganisms 08 00241 g004
Table
Table 1. Strain ID, country of origin and fumonisin B1, fumonisin B2 and fumonisin B3 production (μg/g) with standard errors (±SE) by Fusarium verticillioides strains isolated from maize kernels harvested in five Mediterranean countries and analyzed in this study.
Table 1. Strain ID, country of origin and fumonisin B1, fumonisin B2 and fumonisin B3 production (μg/g) with standard errors (±SE) by Fusarium verticillioides strains isolated from maize kernels harvested in five Mediterranean countries and analyzed in this study.
Strain IDOriginFumonisin Production (μg/g) *
Fumonisin B1Fumonisin B2Fumonisin B3Total Fumonisins **,§
PG 21CItalynd †-nd-nd-nd--
PG 39BItalynd-nd-nd-nd--
ITEM 9313Italy0.03(±0.01)nd-nd-0.03(±0.01)a
ITEM 9319Italy0.16(±0.08)0.03(±0.01)0.05(±0.02)0.24(±0.11)ab
PG 60A1Italy0.20(±0.02)0.04(±0.01)0.05(±0.01)0.29(±0.02)b
ITEM 9330Italy0.30(±0.08)0.05(±0.01)0.06(±0.01)0.41(±0.09)ab
ITEM 9320Italy0.63(±0.60)0.10(±0.10)0.08(±0.07)0.81(±0.77)ab
ITEM 9300Italy0.65(±0.37)0.11(±0.06)0.11(±0.05)0.87(±0.48)ab
PG 28AItaly1.01(±0.40)0.22(±0.10)0.25(±0.08)1.49(±0.58)ab
ITEM 9318Italy1.03(±0.68)0.22(±0.15)0.35(±0.24)1.59(±1.07)ab
PG 22AItaly1.67(±1.52)0.24(±0.23)0.25(±0.22)2.16(±1.97)ab
PG 20AItaly2.81(±1.50)0.66(±0.35)0.40(±0.16)3.87(±2)abc
ITEM 9310Italy6.56(±3.09)2.46(±1.19)0.68(±0.29)9.69(±4.56)abcd
PG 5AItaly6.99(±0.89)2.35(±0.37)0.85(±0.06)10.19(±1.27)cd
ITEM 9309Italy7.70(±3.45)2.23(±1)0.80(±0.30)10.74(±4.74)abcd
PG 76A1Italy8.78(±4.50)2.32(±1.29)1.24(±0.60)12.34(±6.39)abcde
PG 30BItaly10.36(±1.25)2.95(±0.45)1.26(±0.26)14.57(±1.92)d
ITEM 9329Italy10.71(±2.32)3.04(±0.71)0.84(±0.16)14.59(±3.16)cd
PG 35AItaly13.30(±6.96)4.39(±2.26)1.78(±0.80)19.47(±10)abcde
PG 58A1Italy19.39(±5.28)7.51(±1.73)2.16(±0.15)29.07(±7.05)abcde
ITEM 10027Italy23.64(±1.57)7.22(±0.44)2.49(±0.05)33.35(±1.99)e
PG 36BItaly23.87(±0.44)5.63(±1.56)4.23(±0.19)33.73(±1.49)e
03-2/ASpain0.24(±0.17)nd-nd-0.24(±0.17)
FVMM 3-2Spain0.78(±0.29)0.03(±0.03)0.01(±0.01)0.82(±0.33)a
C1-2 SEVSpain2.24(±1.19)0.53(±0.42)0.01-2.77(±1.61)ab
FVMM 2-1Spain2.60(±1.60)0.55(±0.46)0.24(±0.13)3.38(±2.17)ab
FVMM AD 2-4Spain6.38(±3.28)1.61(±0.91)0.20(±0.05)8.19(±4.19)ab
03-5/B SEV.1Spain6.63(±1.08)1.31(±0.31)0.31(±0.05)8.24(±1.43)b
03-5/B SEVSpain7.70(±3.57)1.81(±0.92)1.06(±0.66)10.57(±5.01)ab
FVMM 1-1Spain15.63(±4.19)4.68(±1.25)1.77(±0.33)22.08(±5.74)ab
0-C-1-3 2/2Spain56.12(±5.31)10.67(±1.35)3.04(±0.21)69.84(±6.57)c
M16Tunisiand-nd-nd-nd--
M11Tunisia0.29(±0.07)0.04(±0.02)nd-0.33(±0.09)a
M19Tunisia0.30(±0.07)0.03(±0.02)0.11(±0.03)0.45(±0.11)a
M12Tunisia0.56(±0.23)0.12(±0.05)0.06(±0.02)0.74(±0.30)ab
M15Tunisia0.47(±0.17)0.06(±0.02)0.27(±0.08)0.80(±0.28)ab
M20Tunisia0.92(±0.13)nd-0.01-0.93(±0.13)b
M17Tunisia0.91(±0.21)0.12(±0.03)0.55(±0.12)1.58(±0.36)ab
M5Tunisia2.55(±1.43)0.27(±0.26)nd-2.83(±1.69)ab
M2Tunisia3.21(±1.32)0.61(±0.31)0.01-3.82(±1.63)ab
M8Tunisia3.53(±1.80)1.01(±0.58)0.01-4.55(±2.39)abc
M7Tunisia3.80(±3.05)0.77(±0.75)0.40(±0.32)4.97(±4.11)abc
M22Tunisia6.85(±3.59)1.15(±0.40)2.07(±0.47)10.07(±4.45)abc
M21Tunisia7.10(±4.93)1.47(±1.24)1.72(±1.09)10.29(±7.24)abc
M1Tunisia8.82(±1.28)2.16(±0.35)0.68(±0.23)11.66(±1.81)c
M14Tunisia10.50(±0.10)1.72(±0.12)1.07(±0.10)13.28(±0.18)c
M10Tunisia11.07(±1.71)2.48(±0.55)0.04(±0.03)13.59(±2.23)c
F2Egyptnd-nd-nd-nd--
F6Egyptnd-nd-nd-nd--
F7Egyptnd-nd-nd-nd--
F10Egyptnd-nd-nd-nd--
F12Egyptnd-nd-nd-nd--
F19Egyptnd-nd-nd-nd--
F22Egyptnd-nd-nd-nd--
F23Egyptnd-nd-nd-nd--
F25Egyptnd-nd-nd-nd--
F26Egyptnd-nd-nd-nd--
F27Egyptnd-nd-nd-nd--
F30Egyptnd-nd-nd-nd--
F36Egyptnd-nd-nd-nd--
F38Egyptnd-nd-nd-nd--
F41Egyptnd-nd-nd-nd--
F39Egypt0.22(±0.02)nd-nd-0.22(±0.02)a
F29Egypt0.81(±0.05)0.19(±0.04)0.12(±0.03)1.12(±0.11)b
F8Egypt0.96(±0.90)0.34(±0.33)nd-1.29(±1.23)ab
F4Egypt1.18(±0.08)0.10(±0.02)0.08-1.35(±0.11)b
F28Egypt1.08(±0.69)0.21(±0.13)0.09(±0.05)1.38(±0.87)ab
F9Egypt1.14(±0.79)0.15(±0.13)0.32(±0.25)1.61(±1.17)ab
F32Egypt1.11(±0.34)0.72(±0.27)0.38(±0.20)2.21(±0.80)ab
F5Egypt4.10(±2.16)0.70(±0.40)0.05(±0.03)4.85(±2.60)abc
F11Egypt3.56(±1.88)0.70(±0.44)0.58(±0.37)4.85(±2.68)abc
F17Egypt4.35(±3.24)2.03(±1.57)nd-6.38(±4.81)abc
F13Egypt6.02(±1.45)0.88(±0.11)0.33(±0.12)7.23(±1.67)abc
F15Egypt6.32(±4.25)1.29(±0.98)0.38(±0.22)7.99(±5.45)abc
F3Egypt7.52(±0.08)1.95(±0.15)1.75(±0.15)11.23(±0.32)c
35Irannd-nd-nd-nd--
4Iran0.03(±0.02)nd-nd-0.03(±0.02)a
25Iran0.10(±0.02)nd-nd-0.10(±0.02)b
2Iran0.27(±0.08)nd-nd-0.27(±0.08)ab
9Iran0.47(±0.37)nd-nd-0.47(±0.37)ab
18Iran1.21(±0.25)0.10(±0.05)0.09(±0.04)1.40(±0.35)abc
39Iran1.65(±0.45)0.19(±0.18)0.42(±0.12)2.26(±0.73)abc
56Iran2.21(±1.12)0.34(±0.18)0.30(±0.16)2.85(±1.42)abc
1Iran3.94(±0.76)0.56(±0.18)0.22(±0.07)4.72(±1)c
3Iran4.48(±1.22)0.76(±0.22)0.47(±0.16)5.71(±1.59)abc
22Iran4.61(±1.38)1.65(±0.53)nd-6.26(±1.91)abc
16Iran4.66(±1.63)1.48(±0.58)0.40(±0.18)6.55(±2.39)abc
5Iran9.92(±5.52)2.15(±1.35)1.17(±0.71)13.25(±7.59)abcd
7Iran13.65(±4.74)3.23(±1.15)1.45(±0.50)18.33(±6.40)abcd
89Iran30.81(±4.39)7.23(±1.01)1.75(±0.28)39.79(±5.25)d
* values represent the average (±SE) of three biological replicates. ** sum of fumonisin B1, fumonisin B2 and fumonisin B3. † nd: not detected (<0.002 μg/g for fumonisin B1 and <0.001 μg/g for fumonisin B2 and fumonisin B3). § within the same country of origin, means followed by different letters are significantly different (p < 0.05).

Share and Cite

MDPI and ACS Style

Beccari, G.; Stępień, Ł.; Onofri, A.; Lattanzio, V.M.T.; Ciasca, B.; Abd-El Fatah, S.I.; Valente, F.; Urbaniak, M.; Covarelli, L. In Vitro Fumonisin Biosynthesis and Genetic Structure of Fusarium verticillioides Strains from Five Mediterranean Countries. Microorganisms 2020, 8, 241. https://0-doi-org.brum.beds.ac.uk/10.3390/microorganisms8020241

AMA Style

Beccari G, Stępień Ł, Onofri A, Lattanzio VMT, Ciasca B, Abd-El Fatah SI, Valente F, Urbaniak M, Covarelli L. In Vitro Fumonisin Biosynthesis and Genetic Structure of Fusarium verticillioides Strains from Five Mediterranean Countries. Microorganisms. 2020; 8(2):241. https://0-doi-org.brum.beds.ac.uk/10.3390/microorganisms8020241

Chicago/Turabian Style

Beccari, Giovanni, Łukasz Stępień, Andrea Onofri, Veronica M. T. Lattanzio, Biancamaria Ciasca, Sally I. Abd-El Fatah, Francesco Valente, Monika Urbaniak, and Lorenzo Covarelli. 2020. "In Vitro Fumonisin Biosynthesis and Genetic Structure of Fusarium verticillioides Strains from Five Mediterranean Countries" Microorganisms 8, no. 2: 241. https://0-doi-org.brum.beds.ac.uk/10.3390/microorganisms8020241

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop