Next Article in Journal
Comparison of Two Hepatitis B Vaccination Strategies Targeting Vertical Transmission: A 10-Year Japanese Multicenter Prospective Cohort Study
Next Article in Special Issue
Immunogenicity Assessment of Different Segments and Domains of Group A Streptococcal C5a Peptidase and Their Application Potential as Carrier Protein for Glycoconjugate Vaccine Development
Previous Article in Journal
Liposomal Nanovaccine Containing α-Galactosylceramide and Ganglioside GM3 Stimulates Robust CD8+ T Cell Responses via CD169+ Macrophages and cDC1
Previous Article in Special Issue
Recombinant Baculovirus-Produced Grass Carp Reovirus Virus-Like Particles as Vaccine Candidate That Provides Protective Immunity against GCRV Genotype II Infection in Grass Carp
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Refinement of a Live Attenuated Salmonella enterica Serovar Newport Vaccine with Improved Safety

Center for Vaccine Development and Global Health, Department of Medicine, University of Maryland School of Medicine, Baltimore, MD 21201, USA
*
Author to whom correspondence should be addressed.
Submission received: 17 December 2020 / Revised: 8 January 2021 / Accepted: 13 January 2021 / Published: 16 January 2021
(This article belongs to the Special Issue Evaluation of Vaccine Immunogenicity)

Abstract

:
Non-typhoidal Salmonella (NTS) is a major cause of gastroenteritis and is responsible for approximately 93 million cases annually. In healthy individuals, gastroenteritis caused by NTS is usually self-limiting, however, NTS can cause severe invasive disease in immunocompromised patients. Very little research has been directed towards development of vaccines against Salmonella serogroups O:6,7 or O:8. We have constructed a live attenuated serogroup O:8 vaccine, CVD 1979, by deleting guaBA, htrA, and aroA from the genome of S. Newport. We have shown that the candidate vaccine is well tolerated in mice and elicits serum immunoglobulin G (IgG) antibodies against core O-polysaccharide (COPS) when administered orally. Immunized mice were challenged intraperitoneally with wild-type S. Newport and bacterial burden in the liver and spleen was found to be significantly reduced in the livers of immunized mice compared to control mice. We also observed moderate vaccine efficacy (45%) against lethal challenge with the serogroup O:8 serovar, S. Muenchen, but low vaccine efficacy (28%) following lethal challenge with a serogroup O:6,7 serovar, S. Virchow. In vitro, we have shown that antibodies generated by CVD 1979 only recognize lipopolysaccharide (LPS) from serogroup O:8 but not serogroup O:6,7 serovars, and that they mediate opsonophagocytic antibody (OPA) activity against serogroup O:8 but not serogroup O:6,7 serovars. We also showed that OPA activity can be blocked by pre-incubating the antisera with serogroup O:8 lipopolysaccharide. Taken together, our data demonstrate that we have constructed a well-tolerated, effective live attenuated S. Newport vaccine which elicits functional antibodies against serogroup O:8 but not O:6,7 serovars.

1. Introduction

Non-typhoidal Salmonella (NTS) are a major cause of gastroenteritis worldwide and are estimated to cause 93.8 million cases of illness globally each year, with 155,000 deaths [1]. A substantial proportion of cases are foodborne [1] and, in the United States, NTS are responsible for multiple foodborne outbreaks each year [2]. In most cases, NTS cause self-limiting gastroenteritis that does not require any therapeutic intervention, however, they can cause severe invasive infections in children under 5 years of age living in low resource countries, the elderly, and immunocompromised patients [3,4,5,6,7].
Serogroup O:4 (B), which includes S. Typhimurium, and serogroup O:9 (D), which includes S. Enteritidis, are the most common serogroups accounting for approximately 50% of all reported human NTS isolates in the United States [8]. Serogroups O:6,7 (C1) and O:8 (C2–C3), are becoming more prevalent in humans and animals [8]. Together, O:4, O:6,7, O:8, and O:9, are the most commonly reported serogroups from human cases in the United States and European Union [9,10]. In Asia and Africa, the NTS burden is underestimated due to lack of surveillance, yet serogroups O:6,7 and O:8 are the second (27.3% of NTS cases) and third (19.5% of NTS cases) leading causes of Salmonella infections in humans, respectively [8]. In countries like Taiwan and Ethiopia, certain serovars (e.g., S. Choleraesuis and S. Concord) from group O:6,7 are more frequently isolated from blood and have been found to be invasive in 30–56% of cases [11,12,13]. S. Choleraesuis is known to be associated with severe invasive infections in humans including bacteremia, extraintestinal localized infections in multiple organs, and more likely to require hospitalization [8,13]. Salmonella Newport (O:8), is one of the most common etiological agents of gastroenteritis in the United States [8,9,14,15]. S. Newport is also associated with severe invasive infections in humans [13]. The incidence of serovar Newport has increased during the period 1996–2011 in the USA [9].
Little research has been performed on S. Newport to date. Most NTS vaccine development has focused on S. Typhimurium and S. Enteritidis and several live attenuated and conjugate vaccines against these serovars have shown promising vaccine efficacy in pre-clinical studies [16,17]. Our group has developed both glycoconjugate [18] and live attenuated [19] S. Newport vaccines that have shown protection against S. Newport infection in mouse models. We previously constructed the S. Newport live attenuated vaccine CVD 1966 by deleting the guaBA (encodes guanine biosynthesis) and htrA (encodes a heat shock response protein) genes which are known to have a strong attenuating effect in various Salmonella serovars (e.g., Typhimurium and Typhi) [20,21]. The candidate S. Newport vaccine, CVD 1966 (ΔguaBA ΔhtrA) was attenuated, yet immunogenic in mice [19]. Following intraperitoneal immunization, CVD 1966 elicited robust immune responses against core-O polysaccharide (COPS), flagellin and outer membrane proteins and significantly reduced the bacterial burden in the liver and spleen of infected animals. However, a few animals experienced impaired balance following oral immunization with CVD 1966. Thus, we sought to improve the safety and tolerability of this S. Newport candidate vaccine by deleting an additional aromatic amino acid biosynthesis gene, aroA, which has previously been used to reduce the virulence of S. Typhimurium [22]. Deletion of genes in the aromatic amino acid biosynthesis pathway (e.g., aroA, aroC, and aroD) makes the bacteria auxotrophic for para-aminobenzoic acid (PABA) and 2,3-dihydrobenzoate and aro mutants are unable to scavenge sufficient PABA and dihydrobenzoate to replicate in mice [22]. Several live attenuated Salmonella ΔaroA vaccines have been developed for S. Typhimurium [23], S. Bovismorbificans [24], and S. Choleraesuis [25]; pre-clinical studies have shown that those vaccines elicit strong immune responses and protect animals against lethal challenge.
The goal of the present study was to refine our S. Newport vaccine, CVD 1966 (ΔguaBA ΔhtrA) by incorporating an additional deletion in aroA to develop a safe and effective live attenuated vaccine that can protect against infections caused by serovars of serogroup O:8 (C2–C3). Additionally, we examined efficacy of this vaccine in mice against heterologous challenge with S. Virchow, an O:6,7 (C1) serovar. We also investigated the specificity of vaccine-induced antibodies against O:6,7, and O:8 serovars and the opsonophagocytic antibody activity of anti-lipopolysaccharide (LPS) antibodies. We report herein the development and assessment of an oral live attenuated S. Newport candidate vaccine, CVD 1979.

2. Materials and Methods

2.1. Bacterial Strains, Plasmids, and Culture Conditions

The bacterial strains used in this study are listed in Table 1. Plasmids pKD13, pKD46, and pCP20 were used to delete genes from specific chromosomal loci. All Salmonella strains were maintained in animal-product-free Hy-Soy (HS) medium (10 g/L Soytone (Teknova, Hollister, CA), 5 g/L Hy-yest (Kerry BioScience, Beloit, WI, USA) and 5 g/L sodium chloride (American Bio, Natick, MA, USA)) at 37 °C. When needed, agar (American Bio) was added at 15 g/L. Medium was supplemented with guanine (0.005% (w/v) final concentration; Sigma–Aldrich, St. Louis, MO, USA) for mutants harboring ΔguaBA deletions. Carbenicillin (Corning, Glendale, AZ, USA) or kanamycin (Sigma–Aldrich) at a final concentration of 50 µg/mL were added when necessary.

2.2. Construction of S. Newport Mutants

S. Newport CVD 1966 was previously generated by Fuche et al. [19] derived from S. Newport Chile 361, an invasive clinical isolate, and harbors deletions in guaBA and htrA. Mutants were constructed by deleting the aroA gene from the chromosome of wild-type (WT) Salmonella Newport Chile 361 [26] and CVD 1966 using lambda red-mediated homologous recombination [29]. The entire open reading frame (ORF) was deleted and the deletion was confirmed genotypically by PCR and sequencing using primers that were located at least 500 bp upstream and downstream of the targeted gene. Primers used to construct these mutants in this study are aroAmutF (GTCCATCCTCGACTACACCG), aroAmutRkan (GAAGCAGCTCCAGCCTACACTAAAAACCCCACAGACTGGC), aroAmutFkan (GGTCGACGGATCCCCGGAATAAGTCTTCTGTTGCGCCAGT), aroAmutR (TGCGTTGATATCGCTGGTCA).

2.3. 50% Lethal Dose (LD50) Analysis

All animal procedures were approved by the Institutional Animal Care and Use Committee of the University of Maryland School of Medicine. Work was performed under protocol #0816019 approved on 11 October 2016 and #0619004 approved on 25 July 2019. We evaluated the virulence of the aroA mutant by determining the 50% lethal dose (LD50) in mice. The mutant strain was streaked onto HS medium and grown for 18–20 h at 37 °C. Bacterial colonies were then resuspended in sterile phosphate buffered saline (PBS) to an optical density (OD) at 600 nm of 1.25 (1 × 109 colony-forming units (CFU)/mL). Groups of five 6 to 8-week-old female BALB/c (Charles River Laboratories, Wilmington, MA) mice were infected intraperitoneally (i.p.) with six ten-fold dilutions of (1 × 104 to 1 × 109 CFU) of the S. Newport ΔaroA mutant. Viable counts were performed to verify the number of bacteria administered to mice. Following infection, mice were weighed and monitored daily for 28 days for signs of illness and weight loss. Any mouse that lost more than 20% of its body weight as compared to its weight at the time of infection or that showed signs of extreme morbidity (e.g., shallow breathing or hunched posture) was euthanized and scored as a death. The LD50 of the strain was calculated by linear regression analysis.

2.4. Mouse Immunization and Protection against Challenge

The 6 to 8-week-old female BALB/c mice (Charles River Laboratories) were immunized per orally with 100 μL PBS containing 109 CFU of live attenuated S. Newport vaccine CVD 1979 or PBS alone, three times with three weeks between each immunization, and monitored for clinical signs. Then, four weeks after the last immunization mice were challenged i.p. with WT Salmonella strains to assess the homologous and heterologous protection elicited by the live attenuated S. Newport vaccine CVD 1979. For homologous protection experiments, CVD 1979-vaccinated or PBS-treated mice (n = 10) were challenged with low (4 × 105 CFU) and high (1 × 107 CFU) doses of S. Newport Chile 361. Then, two days post-infection, mice were euthanized, and their liver and spleen were collected. Organs were homogenized, and dilutions were spread onto HS plates to determine the CFU/g. To determine the heterologous protection elicited by the live attenuated S. Newport CVD 1979 vaccine, vaccinated or PBS-treated mice were challenged i.p. (n = 20) with an LD100 of S. Muenchen ATCC 8344 (3 × 107 CFU) or S. Virchow Q23 (5 × 107 CFU). After challenge, mice were monitored for 28 days for weight loss and mortality as described for the 50% lethal dose analysis.

2.5. Measurement of Serum Antibodies

One day before each vaccination (day—1, 20, 42) or challenge (day 66), blood was collected from each mouse to determine the levels of serum IgG against core-O-polysaccharide (COPS) by enzyme-linked immunosorbent assay (ELISA) as described previously [19]. S. Newport COPS was purified as previously described [19]. Briefly, medium-binding 96-well microtiter plates (Greiner Bio-One, Monroe, NC, USA) were coated with 100 μL/well of S. Newport COPS antigen at a concentration of 5 μg/mL. COPS was diluted in carbonate-bicarbonate buffer (pH 9.6) and coated plates were incubated overnight at 4 °C. After incubation, plates were washed 6 times with 0.05% Tween 20 in PBS (PBST) and blocked with 200 μL/well of 10% non-fat dry milk (NFDM) in PBS for 1 h at 37 °C. Individual mouse serum was diluted in 10% NFDM in PBST and was tested in duplicate wells. Plates were incubated at 37 °C for 1 h then washed 6 times with PBST. Horse radish peroxidase (HRP)-conjugated goat anti-mouse IgG antibody (Bio-Rad Laboratories, Carlsbad, CA) secondary antibody was used according to the manufacturer’s instructions. Following six washes with PBST, antibody binding was detected using the TMB Microwell Peroxidase Substrate system (KPL, Gaithersburg, MD, USA). The ELISA titers (ELISA units (EU) per milliliter for antigen-specific antibodies) were calculated by linear regression analysis. Seroconversion was defined as a four-fold increase in titer after immunization, compared to pre-immunization titers.

2.6. Lipopolysaccharide (LPS) and Whole Cell Lysate Extractions

Lipopolysaccharide (LPS) and whole cell lysates were extracted from an equal number of bacterial cells as described [18]. LPS and crude proteins from five different serovars, S. Virchow Q23, S. Choleraesuis var Kunzendorf CDC 06-0894, S. Newport Chile 361, S. Muenchen ATCC 8344, S. Hadar 700093 and S. Newport ΔrfaL were separated on a 4–12% NuPAGE® Bis-Tris acrylamide gel (Thermo Fisher Scientific, Waltham, MA, USA). LPS was visualized by staining the gel with Pro-Q Emerald 300 LPS Gel Stain (Molecular Probes, Eugene, OR, USA) per the manufacturer’s instructions and proteins were stained using the gel-code blue Coomassie reagent. Both LPS and proteins were visualized with a ChemiDoc™ MP instrument using Image Lab 5.1 software (BioRad Laboratories, Hercules, CA, USA). Specificity of the anti-COPS antibodies to LPS and whole cell lysates of Salmonella serovars were determined by immunoblotting. LPS was transferred onto a polyvinylidene fluoride (PVDF) membrane (BioRad Laboratories, Hercules, CA, USA) using a mini Trans-Blot Electrophoretic Cell system (BioRad) at 35 V overnight at 4 °C. Proteins were transferred onto the PVDF membrane by the Trans-Blot Turbo Transfer system (BioRad) at 1.3 A 25 V for 7 min based on the manufacturer’s instructions. PVDF membranes were then blocked with 5% bovine serum albumin (BSA) in tris-buffered saline containing Tween-20 (TBST) for 2 h at room temperature and washed 3 times with TBST. Following washes, membranes were probed with pooled sera collected from animals immunized with live attenuated S. Newport vaccine overnight at 4 °C. Bound antibodies were detected by incubating the blots with HRP-conjugated goat anti-mouse IgG for 1 h at room temperature and developed with Clarity ECL substrate (BioRad).

2.7. Opsonophagocytic Uptake by Macrophages

Mouse macrophage J774A.1 (hereafter referred to as J774) cells were used to perform an opsonophagocytic antibody activity assay as previously described [21]. Briefly, stationary phase cultures of Salmonella strains (~2.5 × 105 CFU/50 μL) were incubated with 5 μL of heat-inactivated pre-immune mouse sera or sera collected from mice immunized with live S. Newport CVD 1979 vaccine (immune sera) for 30 min at room temperature to allow antibodies to opsonize the bacteria. After incubation, 10 μL of the opsonized bacteria were added to the 24-well tray seeded with 1 mL of 4.5 × 105 /well J774 cells (multiplicity of infection (MOI) of 0.11) and incubated for 45 min at 37 °C in the presence of 5% CO2. Intracellular bacteria were enumerated by viable counts and percent phagocytosis was calculated by dividing the number of bacteria that survived after the gentamicin treatment by the initial inoculum and multiplying by 100. Each strain was tested at least three times in duplicate wells. The contribution of anti-COPS antibodies to OPA activity was assessed by preincubating sera collected from pre-immunized and immunized mice with 200, 400, and 800 µg/mL concentrations of COPS for 30 min at room temperature. Following incubation, opsonophagocytic uptake of S. Newport Chile 361 was determined as described above.

2.8. Statistical Analysis

Data were analyzed and plotted using GraphPad Prism 7 Software (La Jolla, CA, USA) and were shown as mean ± standard error of the mean (SEM). ELISA data was analyzed by Tukey’s multiple comparisons test and the OPA data were analyzed by Student’s t-test. Survival curves between the vaccinated and control groups for each challenge strain were compared with log rank test and vaccine efficacy was analyzed by Fisher’s exact test. For data that was not normally distributed, two-tailed Mann–Whitney rank-sum test was used instead of Student’s t-test. A p-value below 0.05 was considered significant for each test.

3. Results

3.1. Construction of Salmonella Newport aroA Mutant and Refined Vaccine Strain

The aroA gene was deleted from Salmonella Newport Chile 361 and CVD 1966 strains using the lambda red-mediated homologous recombination system [29]. The aroA gene was deleted from S. Newport Chile 361 to construct a mutant, SNE-aroA, with a single gene deletion (Table 1). To construct the refined live attenuated vaccine CVD 1979, we deleted the aroA gene from the genome of S. Newport CVD 1966 which harbors mutations in guaBA and htrA [19] (Table 1). PCR and sequencing analysis showed that the entire aroA open reading frame had been deleted in SNE-aroA and S. Newport CVD 1979. We have previously shown that the double mutant, CVD 1966, is attenuated as compared to the parental S. Newport strain, however, we observed impaired balance in the mice following oral (but not intraperitoneal) immunization with CVD 1966. Therefore, in order to further attenuate the vaccine strain, we deleted an additional gene, aroA, to construct our refined candidate S. Newport vaccine strain, CVD 1979, which harbors mutations in guaBA, htrA and aroA.

3.2. Assessment of Attenuation of Strains in the Mouse Model

We previously determined that the optimal infection route for S. Newport Chile 361 in BALB/c mice was the intraperitoneal route and that the LD50 was 5 × 106 CFU [19]. The LD50 of CVD 1966 was also determined previously and was found to be 6.1 × 108 CFU [19]. In this study, we showed that the deletion of aroA from S. Newport Chile 361 had a strong attenuating effect in BALB/c mice; the i.p. LD50 was 1.4 × 108 CFU which is 100-fold higher than that of the parental strain.

3.3. Immunogenicity Elicited by S. Newport CVD 1979

Mice were immunized with three doses of CVD 1979 or PBS three weeks apart via the oral route. Serum IgG titers against core-O polysaccharide (COPS) were measured prior to each immunization and before challenge. We found that the CVD 1979 vaccine was safe, there were no adverse side effects following immunization and animals that received CVD 1979 elicited strong immune responses following each immunization. The geometric mean titer (GMT) increased significantly after three doses of vaccine (Figure 1A) as compared to the first and second doses with 95% anti-COPS seroconversion (19 out of 20 mice receiving CVD 1979). However, the COPS-specific antibody titers for mice receiving PBS remained undetectable (data not shown).

3.4. Protective Efficacy of Live Attenuated S. Newport CVD 1979 Vaccine

To determine homologous protection, mice were challenged i.p. one month after the third immunization, with S. Newport Chile 361. A low (4.3 × 105 CFU) and a high (1.7 × 107 CFU) challenge dose were used. Then, two days post-infection, mice were euthanized, and the bacterial loads in the liver and spleen were determined. The bacterial load (CFU/gram of organ) in the liver of PBS-immunized animals was significantly higher than the bacterial load in animals that received CVD 1979 vaccine (p < 0.05) in mice that were administered either the low or high challenge doses. In contrast, bacterial burden in the spleen of the PBS and CVD 1979-vaccinated animals were not significantly different on day 2 post-infection (Figure 1B,C).
To determine the cross protective efficacy of CVD 1979 against other O:8 (C2–C3) and O:6,7 (C1) serovars, CVD 1979-immunized (n = 20) and PBS-immunized (n = 20) mice were challenged (i.p.) with 100 × LD50 of S. Muenchen ATCC 8344 (O:8; C2–C3) or S. Virchow Q23 (O:6,7; C1) at 4 weeks post-immunization. All PBS-immunized mice succumbed to infection three to six days after challenge with S. Muenchen ATCC 8344, whereas mice immunized with CVD 1979 survived longer (p < 0.0001, log-rank test). We calculated a vaccine efficacy of 45% following challenge (Figure 2; p = 0.001). In contrast, vaccine CVD 1979 only protected 28% of the mice following challenge with a serogroup O:6,7 (C1) serovar, S. Virchow (p = 0.043). Taken together, our data indicate that the vaccine CVD 1979 was able to reduce the bacterial burden in mice challenged with S. Newport and showed moderate protection against lethal challenge with another O:8 (C2–C3) serovar, S. Muenchen, but poor protection against an O:6,7 (C1) serovar, S. Virchow.

3.5. Specificity of CVD 1979 Vaccine-Induced Antibodies

To determine if the reduced protection against the heterologous serogroup was potentially due to anti-COPS antibodies and differences in the O polysaccharide, we assessed the recognition pattern of CVD 1979 vaccine-induced antibodies to LPS and whole cell proteins of O:6,7 (C1) and O:8 (C2–C3) serovars by Western blot. LPS and total crude protein were extracted from Salmonella O:6,7 (C1) serovars Virchow and Choleraesuis and serogroup O:8 (C2–C3) serovars Newport, Muenchen and Hadar as well as a S. Newport ΔrfaL mutant, which does not produce O-side chain polymers. We found that vaccine-induced antibodies can specifically recognize the O antigen in LPS of the O:8 (C2–C3) serovars (Newport, Muenchen and Hadar) but not the O:6,7 (C1) serovars (Virchow and Choleraesuis; Figure 3 and Figure S1). As expected, the S. Newport ΔrfaL mutant, which lacks O side chain polymers, showed no O antigen bands. Additionally, the CVD 1979 antisera showed similar reactivity to whole cell proteins of O:6,7 and O:8 serovars (Figure 3 and Figure S1). Taken together, the anti-COPS antibodies raised by the live attenuated vaccine are specific to the O antigen of serogroup O:8 and do not show any cross-reactivity with serogroup O:6,7.

3.6. Opsonophagocytic Antibody (OPA) Activity

We next assessed whether vaccine-induced antibodies were capable of opsonizing and promoting phagocytosis of serogroup O:6,7 (C1) and O:8 (C2–C3) serovars by mouse macrophages. We found that sera from mice immunized with CVD 1979 was able to significantly (p < 0.0001, Student’s t-test) promote phagocytosis of O:8 (C2–C3) serovars (e.g., S. Muenchen and S. Hadar) by J774 macrophages in vitro, compared to pre-immunization antisera (Figure 4A). In contrast, the CVD 1979 vaccine-induced sera did not promote phagocytosis of O:6,7 (C1) serovars (S. Virchow and S. Choleraesuis) as compared to the sera of pre-immunized mice (Figure 4B). Our data suggests that antibodies generated by the O:8 (C2–C3) vaccine can mediate opsonophagocytic uptake of O:8 but not O:6,7 serovars.
We also determined the opsonophagocytic capability of CVD 1979-induced antibodies for S. Newport ΔrfaL compared to S. Newport WT. We found that the sera from vaccinated mice did not significantly promote phagocytic uptake of the ΔrfaL mutant strain suggesting that anti-O-polysaccharide antibodies are important for opsonophagocytic uptake of S. Newport (Figure 5A). To confirm that the observed OPA activity elicited by CVD 1979 against S. Newport was mediated by anti-OPS antibodies, we adsorbed the antisera with increasing amounts of purified COPS and then measured the percent phagocytosis of S. Newport following opsonization. We observed a dose-dependent reduction in phagocytosis when COPS-specific antibodies were sequestered, as compared to the unabsorbed sera from immunized mice (Figure 5B).

4. Discussion

The goal of this study was to develop an oral live attenuated Salmonella Group O:8 (C2–C3) vaccine that could protect against infections caused by O:6,7 (C1) and O:8 (C2–C3) serovars. Live attenuated vaccines have a variety of advantages over other approaches in that they can induce local mucosal immunity, are economical to produce, and can easily be administered in an oral formulation. Live attenuated vaccine strains can be constructed by incorporating multiple independent defined mutations in bacterial strains using various genetic engineering tools, however, balancing reactogenicity while maintaining, or enhancing, their immunogenicity is challenging [30]. Our initial attempts to develop a live attenuated S. Newport vaccine by deleting guaBA and htrA resulted in an immunogenic vaccine that was well tolerated when administered intraperitoneally to mice but produced some side effects when given perorally. To construct a safer vaccine, we subsequently deleted the aroA gene such that there are now three independent attenuating mutations in S. Newport and found that the candidate vaccine CVD 1979 was safe and well-tolerated in mice following peroral immunization. As has been shown for other Salmonella serovars, we also observed that deletion of aroA had an attenuating effect in S. Newport as the LD50 of the ΔaroA mutant in BALB/c mice was found to be 100-fold higher than that of the parental wild-type strain.
Oral immunization of mice with three doses of CVD 1979 produced strong S. Newport COPS-specific antibody responses and showed an increase in serum antibody titers after each immunization and reached 95% seroconversion after three immunizations. Importantly, the CVD 1979 vaccine offered protection against colonization of the liver after challenge with wild-type S. Newport. We also found that CVD 1979 conferred moderate protection (vaccine efficacy of 45%) against lethal challenge with S. Muenchen (another O:8 (C2–C3) serovar) but poor protection (vaccine efficacy of 28%) against S. Virchow which is an O:6,7 (C1) serovar. Likewise, we have previously shown that an S. Newport COPS:FliC glycoconjugate vaccine was able to confer protection against S. Muenchen [18]. Moreover, our in vitro data confirmed that CVD 1979-induced antibodies can only recognize LPS of O:8 (C2–C3) serovars but not O:6,7 (C1) serovars. Both serogroups share the O:6 epitope in their O polysaccharide but we believe that it is a minor epitope that is poorly immunogenic and not a major target of immune responses [18]. We have observed much poorer vaccine efficacy elicited by live attenuated and conjugate S. Newport vaccines than for S. Typhimurium or S. Enteritidis vaccines [21,31]. The pathogenesis of O:8 and O:6,7 strains is very different to other serovars (e.g., Typhimurium) [32,33] and that might play a role in the reduced vaccine efficacy we observed for our S. Newport vaccines.
Antibody-mediated bacterial clearance by professional phagocytic cells is an important initial host defense against Salmonella infection. Antibodies generated by our live S. Newport vaccine CVD 1979 were capable of protecting the host by opsonizing O:8 strains and thus facilitating phagocytosis. However, antibodies generated by the S. Newport vaccine were not able to promote uptake of serogroup O:6,7 (C1) serovars (S. Virchow and S. Choleraesuis) or of an S. Newport ΔrfaL mutant. We also determined the contribution of COPS to opsonophagocytic uptake by preincubating sera with increasing concentrations of purified S. Newport COPS antigen. We observed a dose-dependent reduction in phagocytosis when COPS-specific antibodies were sequestered, as compared to the unabsorbed sera from immunized mice. These data suggest that an S. Newport live attenuated vaccine elicits opsonophagocytic antibodies that are primarily specific for the O polysaccharide. Importantly, our data suggests that a live attenuated S. Newport vaccine cannot mediate cross-protection against lethal challenge with an O:6,7 serovar such as S. Virchow and that antibodies generated by the S. Newport vaccine cannot mediate opsonophagocytic activity of O:6,7 serovars. The low protection that we observed against challenge with S. Virchow might be mediated by cell mediated immunity or IgA or bactericidal antibody.
Our data suggests that separate Salmonella O:6,7 and O:8 vaccines might be needed to confer protection against infections caused by serovars of these serogroups. We anticipate that a multivalent vaccine containing live attenuated vaccines that target serogroups O:4, O:9, O:6,7, and O:8 would be needed to provide protection against the majority of NTS serovars that are circulating in humans worldwide.

5. Conclusions

In summary, we have developed a safe, oral, live attenuated S. Newport vaccine, CVD 1979. Additional experiments are needed to understand the duration of immunity and the mechanism of protection elicited by this vaccine. We have previously developed safe and effective live oral S. Typhimurium (O:4) and S. Enteritidis (O:9) vaccines. Our next step is to develop a live oral Salmonella O:6,7 vaccine which can be combined with the S. Typhimurium, S. Enteritidis and S. Newport vaccines to create a multivalent vaccine effective against O:4, O:9, O:6,7, and O:8 infections.

Supplementary Materials

The following are available online at https://0-www-mdpi-com.brum.beds.ac.uk/2076-393X/9/1/57/s1, Figure S1 Unmodified Western bots showing specificity of antibodies elicited by live attenuated S. Newport CVD 1979 vaccine to (A) LPS and (B) whole cell lysates.

Author Contributions

Conceptualization, S.M.T., R.S. and M.M.L.; Investigation, S.N., F.J.F., J.A.J. and K.T.S.; Analysis, S.N.; Writing—Original Draft Preparation, S.N.; Writing—Review and Editing, F.J.F., K.T.S., S.M.T., R.S. and M.M.L.; Supervision, S.M.T.; Project Administration, S.M.T.; Funding Acquisition, S.M.T., R.S. and M.M.L. All authors have read and agreed to the published version of the manuscript.

Funding

This work was funded by National Institutes of Health (NIH)/ National Institute of Allergy and Infectious Diseases (NIAID) under Project 4: Vaccine strategy for broad spectrum protection against non-typhoidal Salmonella (project leaders: Sharon M. Tennant and Raphael Simon) NIH/NIAID Centers for Excellence in Translation Research grant U19 AI109776-01 awarded to Myron M. Levine. Additionally, Shamima Nasrin was funded by NIH T32 research training in Gastroenterology grant 5T32DK067872-15.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are contained within this article and supplementary material.

Conflicts of Interest

Myron M. Levine, Raphael Simon and Sharon M. Tennant are holders of the following patents that describe development of NTS vaccines: US patent 9,050,283, “Broad spectrum vaccine against non-typhoidal Salmonella”; US patent 9,011,871, “Broad spectrum vaccine against typhoidal and non-typhoidal Salmonella disease”; and European Patent Number 2387417, “Broad spectrum vaccine against non-typhoidal Salmonella”. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

References

  1. Majowicz, S.E.; Musto, J.; Scallan, E.; Angulo, F.J.; Kirk, M.; O’Brien, S.J.; Jones, T.F.; Fazil, A.; Hoekstra, R.M. The global burden of nontyphoidal Salmonella gastroenteritis. Clin. Infect. Dis. 2010, 50, 882–889. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Scallan, E.; Hoekstra, R.M.; Angulo, F.J.; Tauxe, R.V.; Widdowson, M.A.; Roy, S.L.; Jones, J.L.; Griffin, P.M. Foodborne illness acquired in the United States--major pathogens. Emerg. Infect. Dis. 2011, 17, 7–15. [Google Scholar] [CrossRef] [PubMed]
  3. Feasey, N.A.; Dougan, G.; Kingsley, R.A.; Heyderman, R.S.; Gordon, M.A. Invasive non-typhoidal Salmonella disease: An emerging and neglected tropical disease in Africa. Lancet 2012, 379, 2489–2499. [Google Scholar] [CrossRef]
  4. Gordon, M.A.; Graham, S.M.; Walsh, A.L.; Wilson, L.; Phiri, A.; Molyneux, E.; Zijlstra, E.E.; Heyderman, R.S.; Hart, C.A.; Molyneux, M.E. Epidemics of invasive Salmonella enterica serovar Enteritidis and S. enterica serovar Typhimurium infection associated with multidrug resistance among adults and children in Malawi. Clin. Infect. Dis. 2008, 46, 963–969. [Google Scholar] [CrossRef] [Green Version]
  5. Vugia, D.J.; Samuel, M.; Farley, M.M.; Marcus, R.; Shiferaw, B.; Shallow, S.; Smith, K.; Angulo, F.J. Invasive Salmonella infections in the United States, FoodNet, 1996–1999: Incidence, serotype distribution, and outcome. Clin. Infect. Dis. 2004, 38 Suppl 3, S149–S156. [Google Scholar] [CrossRef] [Green Version]
  6. Gal-Mor, O.; Boyle, E.C.; Grassl, G.A. Same species, different diseases: How and why typhoidal and non-typhoidal Salmonella enterica serovars differ. Front. Microbiol. 2014, 5, 391. [Google Scholar] [CrossRef] [Green Version]
  7. Gilchrist, J.J.; MacLennan, C.A. Invasive nontyphoidal Salmonella disease in Africa. EcoSal Plus 2019, 8. [Google Scholar] [CrossRef] [Green Version]
  8. Fuche, F.J.; Sow, O.; Simon, R.; Tennant, S.M. Salmonella serogroup C: Current status of vaccines and why they are needed. Clin. Vaccine Immunol. 2016, 23, 737–745. [Google Scholar] [CrossRef] [Green Version]
  9. Boore, A.L.; Hoekstra, R.M.; Iwamoto, M.; Fields, P.I.; Bishop, R.D.; Swerdlow, D.L. Salmonella enterica infections in the United States and assessment of coefficients of variation: A novel approach to identify epidemiologic characteristics of individual serotypes, 1996–2011. PLoS ONE 2015, 10, e0145416. [Google Scholar] [CrossRef] [Green Version]
  10. The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2017. EFSA J. 2018, 16, e05500.
  11. Beyene, G.; Nair, S.; Asrat, D.; Mengistu, Y.; Engers, H.; Wain, J. Multidrug resistant Salmonella Concord is a major cause of salmonellosis in children in Ethiopia. J. Infect. Dev. Ctries. 2011, 5, 23–33. [Google Scholar] [CrossRef] [PubMed]
  12. Hendriksen, R.S.; Bangtrakulnonth, A.; Pulsrikarn, C.; Pornruangwong, S.; Noppornphan, G.; Emborg, H.D.; Aarestrup, F.M. Risk factors and epidemiology of the ten most common Salmonella serovars from patients in Thailand: 2002–2007. Foodborne Pathog. Dis. 2009, 6, 1009–1019. [Google Scholar] [CrossRef] [PubMed]
  13. Jones, T.F.; Ingram, L.A.; Cieslak, P.R.; Vugia, D.J.; Tobin-D’Angelo, M.; Hurd, S.; Medus, C.; Cronquist, A.; Angulo, F.J. Salmonellosis outcomes differ substantially by serotype. J. Infect. Dis. 2008, 198, 109–114. [Google Scholar] [CrossRef] [PubMed]
  14. Cheng, R.A.; Eade, C.R.; Wiedmann, M. Embracing diversity: Differences in virulence mechanisms, disease severity, and host adaptations contribute to the success of nontyphoidal Salmonella as a foodborne pathogen. Front. Microbiol. 2019, 10, 1368. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Crim, S.M.; Chai, S.J.; Karp, B.E.; Judd, M.C.; Reynolds, J.; Swanson, K.C.; Nisler, A.; McCullough, A.; Gould, L.H. Salmonella enterica serotype Newport infections in the United States, 2004–2013: Increased incidence investigated through four surveillance systems. Foodborne Pathog. Dis. 2018, 15, 612–620. [Google Scholar] [CrossRef] [PubMed]
  16. MacLennan, C.A.; Martin, L.B.; Micoli, F. Vaccines against invasive Salmonella disease: Current status and future directions. Hum. Vaccines Immunother. 2014, 10, 1478–1493. [Google Scholar] [CrossRef] [Green Version]
  17. Baliban, S.M.; Lu, Y.J.; Malley, R. Overview of the nontyphoidal and paratyphoidal Salmonella vaccine pipeline: Current status and future prospects. Clin. Infect. Dis. 2020, 71, S151–S154. [Google Scholar] [CrossRef]
  18. Schuster, O.; Sears, K.T.; Ramachandran, G.; Fuche, F.J.; Curtis, B.; Tennant, S.M.; Simon, R. Immunogenicity and protective efficacy against Salmonella C2-C3 infection in mice immunized with a glycoconjugate of S. Newport Core-O polysaccharide linked to the homologous serovar FliC protein. Hum. Vaccines Immunother. 2019, 15, 1436–1444. [Google Scholar] [CrossRef]
  19. Fuche, F.J.; Jones, J.A.; Ramachandran, G.; Higginson, E.E.; Simon, R.; Tennant, S.M. Deletions in guaBA and htrA but not clpX or rfaL constitute a live-attenuated vaccine strain of Salmonella Newport to protect against serogroup C2-C3 Salmonella in mice. Hum. Vaccines Immunother. 2019, 15, 1427–1435. [Google Scholar] [CrossRef] [Green Version]
  20. Chatfield, S.N.; Strahan, K.; Pickard, D.; Charles, I.G.; Hormaeche, C.E.; Dougan, G. Evaluation of Salmonella Typhimurium strains harbouring defined mutations in htrA and aroA in the murine salmonellosis model. Microb. Pathog. 1992, 12, 145–151. [Google Scholar] [CrossRef]
  21. Tennant, S.M.; Wang, J.Y.; Galen, J.E.; Simon, R.; Pasetti, M.F.; Gat, O.; Levine, M.M. Engineering and preclinical evaluation of attenuated nontyphoidal Salmonella strains serving as live oral vaccines and as reagent strains. Infect. Immun. 2011, 79, 4175–4185. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  22. Hoiseth, S.K.; Stocker, B.A. Aromatic-dependent Salmonella Typhimurium are non-virulent and effective as live vaccines. Nature 1981, 291, 238–239. [Google Scholar] [CrossRef] [PubMed]
  23. Hormaeche, C.E. Live attenuated Salmonella vaccines and their potential as oral combined vaccines carrying heterologous antigens. J. Immunol. Methods 1991, 142, 113–120. [Google Scholar] [CrossRef]
  24. Mukkur, T.K.; Stocker, B.A.; Walker, K.H. Genetic manipulation of Salmonella serotype Bovismorbificans to aromatic-dependence and evaluation of its vaccine potential in mice. J. Med. Microbiol. 1991, 34, 57–62. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Nnalue, N.A.; Stocker, B.A. Test of the virulence and live-vaccine efficacy of auxotrophic and galE derivatives of Salmonella Choleraesuis. Infect. Immun. 1987, 55, 955–962. [Google Scholar] [CrossRef] [Green Version]
  26. Levine, M.M.; Ferreccio, C.; Black, R.E.; Germanier, R. Large-scale field trial of Ty21a live oral typhoid vaccine in enteric-coated capsule formulation. Lancet 1987, 1, 1049–1052. [Google Scholar] [CrossRef]
  27. Kotloff, K.L.; Nataro, J.P.; Blackwelder, W.C.; Nasrin, D.; Farag, T.H.; Panchalingam, S.; Wu, Y.; Sow, S.O.; Sur, D.; Breiman, R.F.; et al. Burden and aetiology of diarrhoeal disease in infants and young children in developing countries (the Global Enteric Multicenter Study, GEMS): A prospective, case-control study. Lancet 2013, 382, 209–222. [Google Scholar] [CrossRef]
  28. Fuche, F.J.; Sen, S.; Jones, J.A.; Nkeze, J.; Permala-Booth, J.; Tapia, M.D.; Sow, S.O.; Tamboura, B.; Touré, A.; Onwuchekwa, U.; et al. Characterization of invasive Salmonella serogroup C1 infections in Mali. Am. J. Trop. Med. Hyg. 2018, 98, 589–594. [Google Scholar] [CrossRef] [Green Version]
  29. Datsenko, K.A.; Wanner, B.L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 2000, 97, 6640–6645. [Google Scholar] [CrossRef] [Green Version]
  30. Galen, J.E.; Curtiss, R., 3rd. The delicate balance in genetically engineering live vaccines. Vaccine 2014, 32, 4376–4385. [Google Scholar] [CrossRef] [Green Version]
  31. Simon, R.; Tennant, S.M.; Wang, J.Y.; Schmidlein, P.J.; Lees, A.; Ernst, R.K.; Pasetti, M.F.; Galen, J.E.; Levine, M.M. Salmonella enterica serovar Enteritidis core O polysaccharide conjugated to H:g,m flagellin as a candidate vaccine for protection against invasive infection with S. Enteritidis. Infect. Immun. 2011, 79, 4240–4249. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  32. Huang, K.Y.; Wang, Y.H.; Chien, K.Y.; Janapatla, R.P.; Chiu, C.H. Hyperinvasiveness of Salmonella enterica serovar Choleraesuis linked to hyperexpression of type III secretion systems in vitro. Sci. Rep. 2016, 6, 37642. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Chiu, C.H.; Su, L.H.; Chu, C. Salmonella enterica serotype Choleraesuis: Epidemiology, pathogenesis, clinical disease, and treatment. Clin. Microbiol. Rev. 2004, 17, 311–322. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Figure 1. Immunogenicity and protective efficacy of live attenuated Salmonella Newport vaccine CVD 1979 in BALB/c mice. (A) Anti-LPS serum IgG titers in mice immunized orally with 3 doses of 109 CFU of vaccine. Mice were bled before each immunization and challenge. Serum anti-LPS IgG antibody titer was determined for individual mice by ELISA. Black bars represent the geometric mean. Significant differences were determined using Tukey’s multiple comparisons test. (B) Bacterial burden in the liver and spleen of mice immunized with PBS or CVD 1979. One month after the 3rd immunization, mice were challenged intraperitoneally with a low dose (4.3 × 105 CFU) of S. Newport Chile 361. (C) Bacterial burden in the liver and spleen of mice immunized with PBS or CVD 1979 and subsequently challenged with a high dose (1.4 × 107 CFU) of S. Newport Chile 361. Two days post-infection, mice were euthanized, and their liver and spleen were collected. Organs were homogenized, and dilutions were spread onto HS plates for colony (CFU) counting. Bacterial loads are expressed as CFU per gram of organ. Black bars represent the median; significant difference was determined using two-tailed Mann–Whitney test. * p < 0.05; ns, not significant.
Figure 1. Immunogenicity and protective efficacy of live attenuated Salmonella Newport vaccine CVD 1979 in BALB/c mice. (A) Anti-LPS serum IgG titers in mice immunized orally with 3 doses of 109 CFU of vaccine. Mice were bled before each immunization and challenge. Serum anti-LPS IgG antibody titer was determined for individual mice by ELISA. Black bars represent the geometric mean. Significant differences were determined using Tukey’s multiple comparisons test. (B) Bacterial burden in the liver and spleen of mice immunized with PBS or CVD 1979. One month after the 3rd immunization, mice were challenged intraperitoneally with a low dose (4.3 × 105 CFU) of S. Newport Chile 361. (C) Bacterial burden in the liver and spleen of mice immunized with PBS or CVD 1979 and subsequently challenged with a high dose (1.4 × 107 CFU) of S. Newport Chile 361. Two days post-infection, mice were euthanized, and their liver and spleen were collected. Organs were homogenized, and dilutions were spread onto HS plates for colony (CFU) counting. Bacterial loads are expressed as CFU per gram of organ. Black bars represent the median; significant difference was determined using two-tailed Mann–Whitney test. * p < 0.05; ns, not significant.
Vaccines 09 00057 g001
Figure 2. Survival of mice after lethal challenge with S. Muenchen (O:8 [C2–C3]) and S. Virchow (O:6,7 [C1]). Mice immunized with PBS or CVD 1979, three weeks apart and subsequently challenged intraperitoneally with an LD100 of S. Muenchen ATCC 8344 and S. Virchow Q23. Statistically significant differences in survival curves between the vaccinated and control mice for each challenge strain were determined by log rank test. *** p < 0.001; **** p < 0.0001.
Figure 2. Survival of mice after lethal challenge with S. Muenchen (O:8 [C2–C3]) and S. Virchow (O:6,7 [C1]). Mice immunized with PBS or CVD 1979, three weeks apart and subsequently challenged intraperitoneally with an LD100 of S. Muenchen ATCC 8344 and S. Virchow Q23. Statistically significant differences in survival curves between the vaccinated and control mice for each challenge strain were determined by log rank test. *** p < 0.001; **** p < 0.0001.
Vaccines 09 00057 g002
Figure 3. Specificity of antibodies elicited by live attenuated S. Newport CVD 1979 vaccine to Lipopolysaccharide (LPS) and whole cell lysates of Salmonella strains. LPS and whole cell lysates were extracted from group O:6,7 (C1) and O:8 (C2–C3) serovars. Overnight cultures of S. Virchow Q23 (O:6,7), S. Choleraesuis var Kunzendorf (O:6,7), S. Newport Chile 361 (O:8), S. Muenchen ATCC 8344 (O:8), S. Hadar 700093 (O:8) and S. Newport ΔrfaL strains were suspended in PBS and an equal number of cells was harvested to extract LPS and whole cell lysates. After extractions, LPS and cell lysates were separated on a 4–12% NuPAGE® Bis–Tris acrylamide gel. (A) Western blot showing reactivity against LPS from group O:8 serovars after probing with pooled sera collected from mice immunized with live attenuated CVD 1979 vaccine. (B) Western blot of whole cell lysates probed with pooled immune sera. (C) LPS gel stained using the Pro–Q Emerald 300 LPS gel staining kit. (D) Whole cell lysates were stained using the gel-code blue Coomassie reagent. M—Marker, Np—Newport, Δr—Newport ΔrfaL mutant, Mu—Muenchen, H—Hadar, V—Virchow, C—Choleraesuis var Kunzendorf.
Figure 3. Specificity of antibodies elicited by live attenuated S. Newport CVD 1979 vaccine to Lipopolysaccharide (LPS) and whole cell lysates of Salmonella strains. LPS and whole cell lysates were extracted from group O:6,7 (C1) and O:8 (C2–C3) serovars. Overnight cultures of S. Virchow Q23 (O:6,7), S. Choleraesuis var Kunzendorf (O:6,7), S. Newport Chile 361 (O:8), S. Muenchen ATCC 8344 (O:8), S. Hadar 700093 (O:8) and S. Newport ΔrfaL strains were suspended in PBS and an equal number of cells was harvested to extract LPS and whole cell lysates. After extractions, LPS and cell lysates were separated on a 4–12% NuPAGE® Bis–Tris acrylamide gel. (A) Western blot showing reactivity against LPS from group O:8 serovars after probing with pooled sera collected from mice immunized with live attenuated CVD 1979 vaccine. (B) Western blot of whole cell lysates probed with pooled immune sera. (C) LPS gel stained using the Pro–Q Emerald 300 LPS gel staining kit. (D) Whole cell lysates were stained using the gel-code blue Coomassie reagent. M—Marker, Np—Newport, Δr—Newport ΔrfaL mutant, Mu—Muenchen, H—Hadar, V—Virchow, C—Choleraesuis var Kunzendorf.
Vaccines 09 00057 g003
Figure 4. Opsonophagocytic uptake of Salmonella group O:6,7 (C1) and O:8 (C2–C3) serovars by J774 macrophages. (A) Serogroup O:8 (C2–C3) strains (S. Hadar and S. Muenchen) were opsonized with PBS, pre-immune or CVD 1979-immune sera prior to testing for uptake by J774 cells. (B) Serogroup O:6,7 (C1) strains (S. Choleraesuis and S. Virchow) were opsonized with PBS, pre-immune or CVD 1979-immune sera prior to testing for uptake by J774 cells. Data shown is the mean of three independent experiments and is presented as mean ± SEM. **** p < 0.0001; ns, not significant (unpaired two-tailed Student’s t-test).
Figure 4. Opsonophagocytic uptake of Salmonella group O:6,7 (C1) and O:8 (C2–C3) serovars by J774 macrophages. (A) Serogroup O:8 (C2–C3) strains (S. Hadar and S. Muenchen) were opsonized with PBS, pre-immune or CVD 1979-immune sera prior to testing for uptake by J774 cells. (B) Serogroup O:6,7 (C1) strains (S. Choleraesuis and S. Virchow) were opsonized with PBS, pre-immune or CVD 1979-immune sera prior to testing for uptake by J774 cells. Data shown is the mean of three independent experiments and is presented as mean ± SEM. **** p < 0.0001; ns, not significant (unpaired two-tailed Student’s t-test).
Vaccines 09 00057 g004
Figure 5. Contribution of anti-LPS antibodies to opsonophagocytic uptake by J774 macrophages. (A) S. Newport WT and ΔrfaL mutant were treated with PBS, pre-immune or CVD 1979-immune sera and uptake by J774 cells was determined. *** p <0.001; ns, not significant (two-tailed Student’s t-test). (B) Serum from CVD 1979-immunized mice was pre-adsorbed with COPS prior to incubation with S. Newport WT and then added to J774 cells to determine uptake. Data shown is the mean uptake of three independent experiments and represented as mean ± SEM.
Figure 5. Contribution of anti-LPS antibodies to opsonophagocytic uptake by J774 macrophages. (A) S. Newport WT and ΔrfaL mutant were treated with PBS, pre-immune or CVD 1979-immune sera and uptake by J774 cells was determined. *** p <0.001; ns, not significant (two-tailed Student’s t-test). (B) Serum from CVD 1979-immunized mice was pre-adsorbed with COPS prior to incubation with S. Newport WT and then added to J774 cells to determine uptake. Data shown is the mean uptake of three independent experiments and represented as mean ± SEM.
Vaccines 09 00057 g005
Table 1. Salmonella strains used in this study.
Table 1. Salmonella strains used in this study.
SerogroupSerovarStrainCharacteristicsReference
O:8 (C2–C3)S. NewportChile 361Clinical isolate[26]
S. NewportSNE-rfaLChile 361 ΔrfaL[19]
S. NewportSNE-aroAChile 361 ΔaroAThis work
S. NewportCDV 1966Chile 361 ΔguaBA ΔhtrA [19]
S. NewportCVD 1979Chile 361 ΔguaBA ΔhtrA ΔaroAThis work
S. MuenchenATCC 8344Wild-typeAmerican Type Culture Collection
S. Hadar700093Clinical isolate[27]
O:6,7 (C1)S. VirchowQ23Clinical isolate[28]
S. Choleraesuis var KunzendorfCDC-06-0894Wild-typeU.S. Centers for Disease Control and Prevention
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Nasrin, S.; Fuche, F.J.; Sears, K.T.; Jones, J.A.; Levine, M.M.; Simon, R.; Tennant, S.M. Refinement of a Live Attenuated Salmonella enterica Serovar Newport Vaccine with Improved Safety. Vaccines 2021, 9, 57. https://0-doi-org.brum.beds.ac.uk/10.3390/vaccines9010057

AMA Style

Nasrin S, Fuche FJ, Sears KT, Jones JA, Levine MM, Simon R, Tennant SM. Refinement of a Live Attenuated Salmonella enterica Serovar Newport Vaccine with Improved Safety. Vaccines. 2021; 9(1):57. https://0-doi-org.brum.beds.ac.uk/10.3390/vaccines9010057

Chicago/Turabian Style

Nasrin, Shamima, Fabien J. Fuche, Khandra T. Sears, Jennifer A. Jones, Myron M. Levine, Raphael Simon, and Sharon M. Tennant. 2021. "Refinement of a Live Attenuated Salmonella enterica Serovar Newport Vaccine with Improved Safety" Vaccines 9, no. 1: 57. https://0-doi-org.brum.beds.ac.uk/10.3390/vaccines9010057

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop