Comparative Analysis of the Productivity and Immunogenicity of an Attenuated Classical Swine Fever Vaccine (LOM) and an Attenuated Live Marker Classical Swine Fever Vaccine (Flc-LOM-BErns) from Laboratory to Pig Farm
Abstract
:1. Introduction
2. Materials and Methods
2.1. CSF and SE Vaccines
2.2. Vaccination of Pigs with the Flc-LOM-BErns + SE and LOM + SE Vaccines at the APQA Laboratory
2.2.1. Neutralization Tests and CSFV E2 c-ELISA
2.2.2. CSFV Erns ELISA and BVDV Erns ELISAs
2.2.3. Cytokine Expression in Pig Blood
2.3. Vaccination of Pigs on a Pig Farm with Flc-LOM-BErns + SE and LOM + SE
2.4. Statistical Analysis
3. Results
3.1. Changes in Body Weight and Feed Intake after Administration of the Two CSF Vaccines at the APQA Laboratory
3.2. Positive Seroconversion and Differences in Erns Antibody Production
3.3. Changes in Body Temperature and Leukocyte Counts
3.4. Changes in Cytokine Gene Expression
3.5. Reproducibility of the Results on a Breeding Pig Farm
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Becher, P.; Avalos Ramirez, R.; Orlich, M.; Cedillo Rosales, S.; Konig, M.; Schweizer, M.; Stalder, H.; Schirrmeier, H.; Thiel, H.J. Genetic and antigenic characterization of novel pestivirus genotypes: Implications for classification. Virology 2003, 311, 96–104. [Google Scholar] [CrossRef] [Green Version]
- Blome, S.; Wernike, K.; Reimann, I.; Konig, R.; Mob, C.; Beer, M. A decade of research into classical swine fever marker vaccine CP7_E2alf (Suvaxyn® CSF Marker): A review of vaccine properities. Vet. Res. 2017, 48, 51. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lim, S.I.; Choe, S.; Kim, K.S.; Jeoung, H.Y.; Cha, R.M.; Park, G.S.; Shin, J.; Park, G.N.; Cho, I.S.; Song, J.Y.; et al. Assessment of the efficacy of an attenuated live marker classical swine fever vaccine (Flc-LOM-BErns) in pregnant sows. Vaccine 2019, 37, 3598–3604. [Google Scholar] [CrossRef] [PubMed]
- Choe, S.; Shin, J.; Kim, K.S.; Song, S.; Cha, R.M.; Jung, B.I.; Hyun, B.H.; Park, B.K.; An, D.J. Protection of Piglets with Maternally Derived Antibodies from Sows Inoculated with an Attenuated Live Marker Classical Swine Fever Vaccine (Flc-LOM-BErns). Pathogens 2020, 9, 608. [Google Scholar] [CrossRef]
- Ganges, L.; Crooke, H.R.; Boh’orquez, J.A.; Postel, A.; Sakoda, Y.; Becher, P.; Ruggli, N. Classical swine fever virus: The past, present and future. Virus Res. 2020, 289, 198151. [Google Scholar] [CrossRef]
- Kristensena, C.S.; Baadsgaarda, N.P.; Toft, N. A meta-analysis comparing the effect of PCV2 vaccines on average daily weight gain and mortality rate in pigs from weaning to slaughter. Prev. Vet. Med. 2011, 98, 250–258. [Google Scholar] [CrossRef]
- Peiponen, K.S.; Tirkkonen, B.T.; Junnila, J.J.T.; Heinonen, M.L. Effect of a live attenuated vaccine against Lawsonia intracellularis in weaned and finishing pig settings in Finland. Acta Vet. Scand. 2018, 60, 18. [Google Scholar] [CrossRef] [Green Version]
- Park, S.; Lee, J.B.; Kim, K.J.; Oh, Y.S.; Kim, M.O.; Oh, Y.R.; Hwang, M.A.; Lee, J.A.; Lee, S.W. Efficacy of a commercial live attenuated Lawsonia intracellularis vaccine in a large scale field trial in Korea. Clin. Exp. Vaccine Res. 2013, 2, 135–139. [Google Scholar] [CrossRef] [PubMed]
- Tarradas, J.; Argilaguet, J.M.; Rosell, R.; Nofrarias, M.; Crisci, E.; Cordoba, L.; Perez-Martin, E.; Diaz, I.; Rodriguez, F.; Domingo, M.; et al. Interferon-gamma induction correlates with protection by DNA vaccine expressing E2 glycoprotein against classical swine fever virus infection in domestic pigs. Vet. Microbiol. 2010, 142, 51–58. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Renson, P.; Le Dimna, M.; Keranflech, A.; Cariolet, R.; Koenen, F.; Le Potier, M.F. CP7_E2alf oral vaccination confers partial protection against early classical swine fever virus challenge and interferes with pathogeny-related cytokine responses. Vet. Res. 2013, 44, 9. [Google Scholar] [CrossRef] [Green Version]
- Lim, S.I.; Song, J.Y.; Kim, J.; Hyun, B.H.; Kim, H.Y.; Cho, I.S.; Kim, B.; Woo, G.H.; Lee, J.B.; An, D.J. Safety of classical swine fever virus vaccine strain LOM in pregnant sows and their offspring. Vaccine 2016, 34, 2021–2026. [Google Scholar] [CrossRef]
- Choe, S.; Kim, J.H.; Kim, K.S.; Song, S.; Cha, R.M.; Kang, W.C.; Kim, H.J.; Park, G.N.; Shin, J.; Jo, H.N.; et al. Adverse Effects of Classical Swine Fever Virus LOM Vaccine and Jeju LOM Strains in Pregnant Sows and Specific Pathogen-Free Pigs. Pathogens 2019, 9, 18. [Google Scholar] [CrossRef] [Green Version]
- Choe, S.; Kim, J.H.; Kim, K.S.; Song, S.; Kang, W.C.; Kim, H.J.; Park, G.N.; Cha, R.M.; Cho, I.S.; Hyun, B.H.; et al. Impact of a Live Attenuated Classical Swine Fever Virus Introduced to Jeju Island, a CSF-Free Area. Pathogens 2019, 8, 251. [Google Scholar] [CrossRef] [Green Version]
- Lim, S.I.; Jeoung, H.Y.; Kim, B.; Song, J.Y.; Kim, J.; Kim, H.Y.; Cho, I.S.; Woo, G.H.; Lee, J.B.; An, D.J. Impact of porcine reproductive and respiratory syndrome virus and porcine circovirus-2 infection on the potency of the classical swine fever vaccine (LOM strain). Vet. Microbiol. 2016, 193, 36–41. [Google Scholar] [CrossRef] [PubMed]
- Song, J.Y.; Lim, S.I.; Jeoung, H.Y.; Choi, E.J.; Hyun, B.H.; Kim, B.; Kim, J.; Shin, Y.K.; Dela Pena, R.C.; Kim, J.B.; et al. Prevalence of classical swine fever virus in domestic pigs in South Korea: 1999–2011. Transbound. Emerg. Dis. 2013, 60, 546–551. [Google Scholar] [CrossRef] [PubMed]
- Gabriel, C.; Blome, S.; Urniza, A.; Juanola, S.; Koenen, F.; Beer, M. Towards licensing of CP7_E2alf as marker vaccine against classical swine fever duration of immunity. Vaccine 2012, 30, 2928–2936. [Google Scholar] [CrossRef]
- Koenig, P.; Hoffmann, B.; Depner, K.R.; Reimann, I.; Teifke, J.P.; Beer, M. Detection of classical swine fever vaccine virus in blood and tissue samples of pigs vaccinated either with a conventional C-strain vaccine or a modified live marker vaccine. Vet. Microbiol. 2007, 120, 343–351. [Google Scholar] [CrossRef] [PubMed]
- Sanchez-Cordon, P.J.; Nunez, A.; Salguero, F.J.; Carrasco, L.; Gomez-Villamandos, J.C. Evolution of T lymphocytes and cytokine expression in classical swine fever (CSF) virus infection. J. Comp. Pathol. 2005, 132, 249–260. [Google Scholar] [CrossRef] [PubMed]
- Suradhat, S.; Intrakamhaeng, M.; Damrongwatanapokin, S. The correlation of virus-specific interferon-gamma pro¬duction and protection against classical swine fever virus infection. Vet. Immunol. Immunopathol. 2001, 83, 177–189. [Google Scholar] [CrossRef]
- Graham, S.P.; Everett, H.E.; Haines, F.J.; Johns, H.L.; Sosan, O.A.; Salguero, F.J.; Clifford, D.J.; Steinbach, F.; Drew, T.W.; Crooke, H.R. Challenge of pigs with classical swine fever viruses after C-strain vaccination reveals remarkably rapid protection and insights into early immunity. PLoS ONE 2012, 7, e29310. [Google Scholar] [CrossRef] [Green Version]
- Blackburn, S.D.; Wherry, E.J. IL-10, T cell exhaustion and viral persistence. Trends Microbiol. 2007, 15, 143–146. [Google Scholar] [CrossRef] [PubMed]
- Couper, K.N.; Blount, D.G.; Riley, E.M. IL-10: The master regula¬tor of immunity to infection. J. Immunol. 2008, 180, 5771–5777. [Google Scholar] [CrossRef] [PubMed]
- Khatoon, E.; Barman, N.N.; Deka, M.; Hussanin, M.D.I.; Borah, P.; Kumar, S. Cyotokine responses in pigs after natural infection with classical swine fever virus. Acta Virol. 2019, 63, 60–69. [Google Scholar] [CrossRef]
- Drew, T. Classical swine fever (hog cholera). In Manual of Diagnostic Tests and Vaccines for Terrestrial Animals: Mammals, 6th ed.; Office International des Epizooties (OIE), Ed.; Birds and Bees; OIE: Paris, France, 2008; pp. 1092–1106. [Google Scholar]
- Duvigneau, J.C.; Hartl, R.T.; Groiss, S.; Gemeiner, M. Quantitative simultaneous multiplex real-time PCR for the detection of porcine cytokines. J. Immunol. Methods 2005, 306, 16–27. [Google Scholar] [CrossRef] [PubMed]
- Petrov, A.; Beer, M.; Blome, S. Development and Validation of a Harmonized TaqMan-Based Triplex Real-Time RT-PCR Protocol for the Quantitative Detection of Normalized Gene Expression Profiles of Seven Porcine Cytokines. PLoS ONE 2014, 9, e108910. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Gene | Primer (5′–3′) | Probe (5′FAM and 3′BHQ-1) | Size (bp) | Reference |
---|---|---|---|---|
IFN-γ | F: CGATCCTAAAGGACTATTTTAATGCAA R: TTTTGTCACTCTCCTCTTTCCAAT | ACCTCAGATGTACCTAATGGTGGACCTCTT | 102 | [12] |
IL-6 | F: CTGGCAGAAAACAACCTGAACC R: TGATTCTCATCAAGCAGGTCTCC | TGGCAGAAAAAGACGGATGC | 93 | [13] |
IL-10 | F: CGGCGCTGTCATCAATTTCTG R: CCCCTCTCTTGGAGCTTGCTA | AGGCACTCTTCACCTCCTCCACGGC | 89 | [12] |
TNF-α | F: AACCTCAGATAAGCCCGTCG R: ACCACCAGCTGGTTGTCTTT | CCAATGCCCTCCTGGCCAAC | 128 | [13] |
β-Actin (control) | F: AGCGCAAGTACTCCGTGTG R: CGGACTCATCGTACTCCTGCTT | TCGCTGTCCACCTTCCAGCAGATGT | 105 | [13] |
GAPDH (control) | F: ACATGGCCTCCAAGGAGTAAGA R: GATCGAGTTGGGGCTGTGACT | CCACCAACCCCAGCAAGAGCACGC | 105 | [13] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Choe, S.; Kim, K.-S.; Shin, J.; Song, S.; Park, G.-N.; Cha, R.M.; Choi, S.-H.; Jung, B.-I.; Lee, K.-W.; Hyun, B.-H.; et al. Comparative Analysis of the Productivity and Immunogenicity of an Attenuated Classical Swine Fever Vaccine (LOM) and an Attenuated Live Marker Classical Swine Fever Vaccine (Flc-LOM-BErns) from Laboratory to Pig Farm. Vaccines 2021, 9, 381. https://0-doi-org.brum.beds.ac.uk/10.3390/vaccines9040381
Choe S, Kim K-S, Shin J, Song S, Park G-N, Cha RM, Choi S-H, Jung B-I, Lee K-W, Hyun B-H, et al. Comparative Analysis of the Productivity and Immunogenicity of an Attenuated Classical Swine Fever Vaccine (LOM) and an Attenuated Live Marker Classical Swine Fever Vaccine (Flc-LOM-BErns) from Laboratory to Pig Farm. Vaccines. 2021; 9(4):381. https://0-doi-org.brum.beds.ac.uk/10.3390/vaccines9040381
Chicago/Turabian StyleChoe, SeEun, Ki-Sun Kim, Jihye Shin, Sok Song, Gyu-Nam Park, Ra Mi Cha, Sung-Hyun Choi, Byung-Il Jung, Kyung-Won Lee, Bang-Hun Hyun, and et al. 2021. "Comparative Analysis of the Productivity and Immunogenicity of an Attenuated Classical Swine Fever Vaccine (LOM) and an Attenuated Live Marker Classical Swine Fever Vaccine (Flc-LOM-BErns) from Laboratory to Pig Farm" Vaccines 9, no. 4: 381. https://0-doi-org.brum.beds.ac.uk/10.3390/vaccines9040381