Protective Efficacy of Novel Oral Biofilm Vaccines against Lactococcus garvieae Infection in Mullet, Mugil cephalus
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethical Considerations
2.2. Experimental Fish
2.2.1. Chitosan Particles
2.2.2. Bacterial Strains
2.2.3. Cultured and Quantified L. garvieae Biofilm
2.2.4. Preparation of L. garvieae Biofilm and Whole-Cell Vaccines
2.3. Preparation of Feed-Based Biofilm and Whole-Cell Vaccines
2.4. Vaccination
2.4.1. Experimental Design 1
2.4.2. Experimental Design 2
2.5. Immunohistochemistry
2.6. Phagocytic Ability and Albumin–Globulin Ratio Analyses
2.7. Antibody Detection
2.8. RNA Isolation and Real-time Quantitative PCR (RT-qPCR)
2.9. Challenge with L. garvieae in Experiments 1 and 2
2.10. Statistical Analysis
3. Results
3.1. SEM Observation of Biofilm Formation
3.2. Confirmation of Adsorbed Biofilm Antigen in Intestine, Head Kidney and Spleen via Immunohistochemistry
3.3. Innate Immune Response after Vaccination
3.4. Antibody Production
3.5. Immune-Related Gene Analysis
3.6. Relative Percentage Survival
3.7. Long-Term Analysis of Serum Antibody Titres and Relative Percentage Survival
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Vendrell, D.; Balcazar, J.L.; Ruiz-Zarzuela, I.; de Blas, I.; Girones, O.; Muzquiz, J.L. Lactococcus garvieae in fish: A review. Comp. Immunol. Microbiol. Infect. Dis. 2006, 29, 177–198. [Google Scholar] [CrossRef]
- Evans, J.J.; Klesius, P.H.; Shoemaker, C.A. First isolation and characterization of Lactococcus garvieae from Brazilian Nile tilapia, Oreochromis niloticus (L.), and pintado, Pseudoplathystoma corruscans (Spix & Agassiz). J. Fish Dis. 2009, 32, 943–951. [Google Scholar]
- Chen, S.C.; Liaw, L.L.; Su, H.Y.; Ko, S.C.; Wu, C.Y.; Chaung, H.C.; Tsai, Y.H.; Yang, K.L.; Chen, Y.C.; Chen, T.H.; et al. Lactococcus garvieae, a cause of disease in grey mullet, Mugil cephalus L., in Taiwan. J. Fish Dis. 2002, 25, 727–732. [Google Scholar] [CrossRef]
- Parsek, M.R.; Singh, P.K. Bacterial Biofilms: An Emerging Link to Disease Pathogenesis. Annu. Rev. Microbiol. 2003, 57, 677–701. [Google Scholar] [CrossRef] [PubMed]
- Le, Y.K.; Park, M.D.; Otto, M. Immune evasion mechanisms of Staphylococcus epidermidis biofilm infection. Front. Microbiol. 2018, 9, 359. [Google Scholar] [CrossRef] [PubMed]
- Watters, C.; Fleming, D.; Bishop, D.; Rumbaugh, K. Host responses to biofilm. Prog. Mol. Biol. Transl. Sci. 2016, 142, 193–239. [Google Scholar] [PubMed]
- Sanchez, C.J.; Hurtgen, B.J.; Lizcano, A.; Shivshankar, P.; Cole, G.T.; Orihuela, C.J. Biofilm and planktonic pneumococci demonstrate disparate immunoreactivity to human convalescent sera. BMC Microbiol. 2011, 11, 245. [Google Scholar] [CrossRef] [Green Version]
- Loera-Muro, A.; Guerrero-Barrera, A.; Tremblay DN, Y.; Hathroubi, S.; Angulo, C.J.E.R.o.V. Bacterial biofilm-derived antigens: A new strategy for vaccine development against infectious diseases. Expert Rev. Vaccines 2021, 1–15. [Google Scholar]
- Mckenney, D.; Pouliot, K.; Wang, Y.; Murthy, V.; Ulrich, M.; Döring, G.; Lee, J.C.; Goldmann, D.A.; Pier, G.B. Vaccine potential of poly-1-6 β-DN-succinylglucosamine, an immunoprotective surface polysaccharide of Staphylococcus aureus and Staphylococcus epidermidis. J. Biotechnol. 2000, 83, 37–44. [Google Scholar] [CrossRef]
- Corsini, B.; Aguinagalde, L.; Ruiz, S.; Domenech, M.; Antequera, M.L.; Fenoll, A.; García, P.; García, E.; Yuste, J.J.V. Immunization with LytB protein of Streptococcus pneumoniae activates complement-mediated phagocytosis and induces protection against pneumonia and sepsis. Vaccine 2016, 34, 6148–6157. [Google Scholar] [CrossRef] [Green Version]
- Forchielli, M.L.; Walker, W.A. The role of gut-associated lymphoid tissues and mucosal defence. Br. J. Nutr. 2005, 93, S41–S48. [Google Scholar] [CrossRef] [Green Version]
- Azad, I.; Shankar, K.; Mohan, C.; Kalita, B.J.D.o.a.o. Uptake and processing of biofilm and free-cell vaccines of Aeromonas hydrophila in Indian major carps and common carp following oral vaccination antigen localization by a monoclonal antibody. Dis. Aquat. Org. 2000, 43, 103–108. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vinay, T.; Girisha, S.; D’souza, R.; Jung, M.-H.; Choudhury, T.; Patil, S.S. Bacterial biofilms as oral vaccine candidates in aquaculture. Indian J. Comp. Microbiol. Immunol. Infect. Dis. 2016, 37, 57. [Google Scholar] [CrossRef]
- Rombout, J.; Kiron, V.J.F.v. Mucosal vaccination of fish. In Fish Vaccination; Blackwell: Chichester, UK, 2014; pp. 56–67. [Google Scholar]
- Azad, I.; Shankar, K.; Mohan, C.; Kalita, B. Biofilm vaccine of Aeromonas hydrophila–standardization of dose and duration for oral vaccination of carps. Fish Shellfish. Immunol. 1999, 9, 519–528. [Google Scholar] [CrossRef]
- Nayak, D.; Asha, A.; Shankar, K.; Mohan, C.J.F. Evaluation of biofilm of Aeromonas hydrophila for oral vaccination of Clarias batrachus—A carnivore model. Fish Shellfish. Immunol. 2004, 16, 613–619. [Google Scholar] [CrossRef] [PubMed]
- Kaur, B.; Kumar, B.N.; Tyagi, A.; Holeyappa, S.A.; Singh, N.K.J.F. Identification of novel vaccine candidates in the whole-cell Aeromonas hydrophila biofilm vaccine through reverse vaccinology approach. Fish Shellfish. Immunol. 2021, 114, 132–141. [Google Scholar] [CrossRef]
- Kahieshesfandiari, M.; Sabri, M.; Ina-Salwany, M.; Hassan, M.; Noraini, O.; Ajadi, A.; Isiaku, A. Streptococcosis in Oreochromis sp.: Is feed-based biofilm vaccine of Streptococcus agalactiae effective? Aquac. Int. 2019, 27, 817–832. [Google Scholar] [CrossRef]
- Ram, M.K.; Kumar, B.N.; Poojary, S.R.; Abhiman, P.; Patil, P.; Ramesh, K.; Shankar, K.J.F. Evaluation of biofilm of Vibrio anguillarum for oral vaccination of Asian seabass, Lates calcarifer (BLOCH, 1790). Fish Shellfish. Immunol. 2019, 94, 746–751. [Google Scholar] [CrossRef]
- Kitiyodom, S.; Trullàs, C.; Rodkhum, C.; Thompson, K.D.; Katagiri, T.; Temisak, S.; Namdee, K.; Yata, T.; Pirarat, N.J.F. Modulation of the mucosal immune response of red tilapia (Oreochromis sp.) against columnaris disease using a biomimetic-mucoadhesive nanovaccine. Fish Shellfish. Immunol. 2021, 112, 81–91. [Google Scholar] [CrossRef]
- Kitiyodom, S.; Yata, T.; Yostawornkul, J.; Kaewmalun, S.; Nittayasut, N.; Suktham, K.; Surassmo, S.; Namdee, K.; Rodkhum, C.; Pirarat, N.J.F.; et al. Enhanced efficacy of immersion vaccination in tilapia against columnaris disease by chitosan-coated “pathogen-like” mucoadhesive nanovaccines. Fish Shellfish. Immunol. 2019, 95, 213–219. [Google Scholar] [CrossRef]
- Zlotkin, A.; Eldar, A.; Ghittino, C.; Bercovier, H. Identification of Lactococcus garvieae by PCR. J. Clin. Microbiol. 1998, 36, 983–985. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Oushani, A.K.; Soltani, M.; Sheikhzadeh, N.; Mehrgan, M.S.; Islami, H.R.J.F. Effects of dietary chitosan and nano-chitosan loaded clinoptilolite on growth and immune responses of rainbow trout (Oncorhynchus mykiss). Fish Shellfish. Immunol. 2020, 98, 210–217. [Google Scholar] [CrossRef]
- Tote, K.; Berghe, D.V.; Maes, L.; Cos, P. A new colorimetric microtitre model for the detection of Staphylococcus aureus biofilms. Lett. Appl. Microbiol. 2007, 46, 249–254. [Google Scholar] [CrossRef]
- Park, H.K.; Jeong, H.D. Enhanced resistance against Edwardsiella tarda infection in tilapia (Oreochromis niloticus) by administration of protein-bound polysaccharide. Aquaculture 1996, 143, 135–143. [Google Scholar] [CrossRef]
- Thanga Viji, V.; Deepa, K.; Velmurugan, S.; Donio, M.B.; Adlin Jenifer, J.; Babu, M.M.; Citarasu, T. Vaccination strategies to protect goldfish Carassius auratus against Aeromonas hydrophila infection. Dis. Aquat. Org. 2013, 104, 45–57. [Google Scholar] [CrossRef] [Green Version]
- Byadgi, O.; Chen, Y.-C.; Barnes, A.C.; Tsai, M.-A.; Wang, P.-C.; Chen, S.-C.J.F. Transcriptome analysis of grey mullet (Mugil cephalus) after challenge with Lactococcus garvieae. Fish Shellfish. Immunol. 2016, 58, 593–603. [Google Scholar] [CrossRef] [Green Version]
- Benton, A.K.; Everson, M.P.; Briles, D.E. A pneumolysin-negative mutant of Streptococcus pneumoniae causes chronic bacteremia rather than acute sepsis in mice. Infect. Immun. 1995, 63, 448–455. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stewart, S.P.; Costerton, J.W. Antibiotic resistance of bacteria in biofilms. Lancet 2001, 358, 135–138. [Google Scholar] [CrossRef]
- Thurlow, L.R.; Hanke, M.L.; Fritz, T.; Angle, A.; Aldrich, A.; Williams, S.H.; Engebretsen, I.L.; Bayles, K.W.; Horswill, A.R.; Kielian, T. Staphylococcus aureus biofilms prevent macrophage phagocytosis and attenuate inflammation in vivo. J. Immunol. 2011, 186, 6585–6596. [Google Scholar] [CrossRef] [Green Version]
- Costerton, J.W.; Cheng, K.; Geesey, G.G.; Ladd, T.I.; Nickel, J.C.; Dasgupta, M.; Marrie, T.J.J.A.R.i.M. Bacterial biofilms in nature and disease. Annu. Rev. Microbiol. 1987, 41, 435–464. [Google Scholar] [CrossRef] [PubMed]
- Anderson, D.P. Adjuvants and immunostimulants for enhancing vaccine potency in fish. Dev. Boil. Stand. 1997, 90, 257–265. [Google Scholar]
- Wong, G.; Kaattari, S.L.; Christensen, J.M. Effectiveness of an oral enteric coated vibrio vaccine for use in salmonid fish. Immunol. Investig. 1992, 21, 353–364. [Google Scholar] [CrossRef]
- Jenkins, P.; Wrathmell, A.; Harris, J.; Pulsford, A. The effects of different adjuvants on intestinal antigen absorption and subsequent immune responses of the tilapian Oreochromis mossambicus. Fish Shellfish. Immunol. 1994, 4, 167–177. [Google Scholar] [CrossRef]
- Davidson, G.; Ellis, A.; Secombes, C. Route of immunization influences the generation of antibody secreting cells in the gut of rainbow trout (Oncorhynchus mykiss). Dev. Comp. Immunol. 1993, 17, 373–376. [Google Scholar] [CrossRef]
- Firdaus-Nawi, M.; Yusoff, S.M.; Yusof, H.; Abdullah, S.Z.; Zamri-Saad, M. Efficacy of feed-based adjuvant vaccine against Streptococcus agalactiae in Oreochromis spp. in Malaysia. Aquac. Res. 2013, 45, 87–96. [Google Scholar] [CrossRef]
- Tafalla, C.; Bøgwald, J.; Dalmo, R.A. Adjuvants and immunostimulants in fish vaccines: Current knowledge and future perspectives. Fish Shellfish. Immunol. 2013, 35, 1740–1750. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tian, J.; Yu, J.; Sun, X. Chitosan microspheres as candidate plasmid vaccine carrier for oral immunisation of Japanese flounder (Paralichthys olivaceus). Veter- Immunol. Immunopathol. 2008, 126, 220–229. [Google Scholar] [CrossRef]
- Plant, P.K.; LaPatra, S.E. Advances in fish vaccine delivery. Dev. Comp. Immunol. 2011, 35, 1256–1262. [Google Scholar] [CrossRef]
- Siripornadulsil, S.; Dabrowski, K.; Sayre, R. Microalgal vaccines. Transgenic microalgae as green cell factories. In Transgenic Microalgae as Green Cell Factories; Springer: Berlin/Heidelberg, Germany, 2007; pp. 122–128. [Google Scholar]
- Patel, P.; Patel, B.; Amaresan, N.; Joshi, B.; Shah, R.; Krishnamurthy, R. Isolation and characterization of Lactococcus garvieae from the fish gut for in vitro fermentation with carbohydrates from agro-industrial waste. Biotechnol. Rep. 2020, 28, e00555. [Google Scholar] [CrossRef]
- Ranjan, R.; Prasad, K.P.; Vani, T.; Kumar, R. Effect of dietary chitosan on haematology, innate immunity and disease resistance of Asian seabass Lates calcarifer (Bloch). Aquac. Res. 2014, 45, 983–993. [Google Scholar] [CrossRef]
- Zhang, J.; Kong, X.; Zhou, C.; Li, L.; Nie, G.; Li, X.J.F. Toll-like receptor recognition of bacteria in fish: Ligand specificity and signal pathways. Fish Shellfish. Immunol. 2014, 41, 380–388. [Google Scholar] [CrossRef] [PubMed]
- Fan, J.Z.; Jia, Q.J.; Yao, C.L. Characterization and expression analysis of Toll-like receptor 2 gene in large yellow croaker, Larimichthys crocea. Fish Shellfish. Immunol. 2015, 44, 129–137. [Google Scholar] [CrossRef]
- Yin, Z.; Kwang, J. Carp interleukin-1β in the role of an immuno-adjuvant. Fish Shellfish. Immunol. 2000, 10, 375–378. [Google Scholar] [CrossRef] [PubMed]
- Clay, H.; Volkman, H.E.; Ramakrishnan, L. Tumor necrosis factor signaling mediates resistance to mycobacteria by inhibiting bacterial growth and macrophage death. Immunity 2008, 29, 283–294. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rao, S.; Byadgi, O.; Pulpipat, T.; Wang, P.C.; Chen, S.C. Efficacy of a formalin-inactivated Lactococcus garvieae vaccine in farmed grey mullet Mugil cephalus. J. Fish Dis. 2020, 43, 1579–1589. [Google Scholar] [CrossRef] [PubMed]
- Mutoloki, S.; Munang’andu, H.M.; Evensen, Ø. Oral Vaccination of Fish—Antigen Preparations, Uptake, and Immune Induction. Front. Immunol. 2015, 6, 519. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mao, Z.; Ye, J.; Li, M.; Xu, H.; Chen, J. Vaccination efficiency of surface antigens and killed whole cell of Pseudomonas putida in large yellow croaker (Pseudosciaena crocea). Fish Shellfish. Immunol. 2013, 35, 375–381. [Google Scholar] [CrossRef]
- Siriyappagouder, P.; Shankar, K.M.; Naveen Kumar, B.T.; Patil, R.; Byadgi, O.V. Evaluation of biofilm of Aeromonas hydrophila for oral vaccination of Channa striatus. Fish Shellfish. Immunol. 2014, 41, 581–585. [Google Scholar] [CrossRef] [PubMed]
- Halimi, M.; Alishahi, M.; Abbaspour, M.R.; Ghorbanpoor, M.; Tabandeh, M.R. Valuable method for production of oral vaccine by using alginate and chitosan against Lactococcus garvieae/Streptococcus iniae in rainbow trout (Oncorhynchus mykiss). Fish Shellfish. Immunol. 2019, 90, 431–439. [Google Scholar] [CrossRef] [PubMed]
Name | Sequence | Tm (°C) | Reference |
---|---|---|---|
IL-1β-F | GAGGAGCTTGGTGCAGAACA | 61.4 | [27] |
IL-1β-R | CTTTGTTCGTCACCTCCTCCA | ||
C3-F | GCATCACGCTCCTTGTCTTT | 61.4 | [27] |
C3-R | ACCACTATGCCACAAGAACATC | ||
EGF1α-F | CTTCTTCTGGGCCTTCTCT | 60 | this paper |
EGF1α-R | CTTGGACGTTTCGCTGTC | ||
TLR2-F | CTTTCTCCTCGTCCCTCTG | 60 | this paper |
TLR2-R | CGTGTTTGTTGTGGTCT | ||
TNF-α-F | GCGCAGTCTGTCATTGGTT | 60 | [27] |
TNF-α-R | ACTGGACACGCTCACTGTAGTG |
Group | Final Mortality (%) | RPS (%) | |
---|---|---|---|
Biofilm vaccine | n = 20 | 25 | 74 |
Whole-cell vaccine | n = 20 | 55 | 42 |
Chitosan particle | n = 20 | 70 | 26 |
PBS | n = 20 | 95 |
Group | Final Mortality (%) | RPS (%) | |
---|---|---|---|
Biofilm vaccine | n = 25 | 20 | 77 |
Whole-cell vaccine | n = 25 | 72 | 18 |
Chitosan particle | n = 25 | 88 | 0 |
PBS | n = 25 | 88 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Su, F.-J.; Chen, M.-M. Protective Efficacy of Novel Oral Biofilm Vaccines against Lactococcus garvieae Infection in Mullet, Mugil cephalus. Vaccines 2021, 9, 844. https://0-doi-org.brum.beds.ac.uk/10.3390/vaccines9080844
Su F-J, Chen M-M. Protective Efficacy of Novel Oral Biofilm Vaccines against Lactococcus garvieae Infection in Mullet, Mugil cephalus. Vaccines. 2021; 9(8):844. https://0-doi-org.brum.beds.ac.uk/10.3390/vaccines9080844
Chicago/Turabian StyleSu, Feng-Jie, and Meei-Mei Chen. 2021. "Protective Efficacy of Novel Oral Biofilm Vaccines against Lactococcus garvieae Infection in Mullet, Mugil cephalus" Vaccines 9, no. 8: 844. https://0-doi-org.brum.beds.ac.uk/10.3390/vaccines9080844