Pravastatin Promotes Endothelial Colony-Forming Cell Function, Angiogenic Signaling and Protein Expression In Vitro
Abstract
:1. Introduction
2. Material and Methods
2.1. ECFC Isolation, Culture and Characterization
2.2. Chemotaxis Assay
2.3. Scratch Wound Healing Assay
2.4. In Vitro Angiogenesis Assay
2.5. Proliferation Assay
2.6. Apoptosis Assay
2.7. Isolation of Proteins and Immunoblotting:
2.8. Quantitative Real-Time PCR (qRT-PCR)
2.9. Statistical Analysis
3. Results
3.1. Pravastatin Increases ECFC Migration
3.2. Pravastatin Enhances ECFC Angiogenic Capacity
3.3. Pravastatin Has a Biphasic Impact on ECFC Proliferation
3.4. Pravastatin Enhances AKT and eNOS Phosphorylation and Increases HO-1 Expression
3.5. Pravastatin Affects mRNA and Protein Expression of Pro-Angiogenic and Anti-Angiogenic Factors
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Benjamin, E.J.; Muntner, P.; Alonso, A.; Bittencourt, M.S.; Callaway, C.W.; Carson, A.P.; Chamberlain, A.M.; Chang, A.R.; Cheng, S.; Das, S.R.; et al. Heart disease and stroke statistics—2019 update: A report from the American heart association. Circulation 2019, 139, e56–e528. [Google Scholar] [CrossRef] [PubMed]
- Mensah, G.A.; Roth, G.A.; Fuster, V. The global burden of cardiovascular diseases and risk factors. J. Am. Coll. Cardiol. 2019, 74, 2529–2532. [Google Scholar] [CrossRef]
- Favero, G.; Paganelli, C.; Buffoli, B.; Rodella, L.F.; Rezzani, R. Endothelium and Its Alterations in Cardiovascular Diseases: Life Style Intervention. BioMed Res. Int. 2014, 2014, 801896. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Libby, P.; Theroux, P. Pathophysiology of coronary artery disease. Circulation 2005, 111, 3481–3488. [Google Scholar] [CrossRef] [Green Version]
- Ylä-Herttuala, S.; Bridges, C.; Katz, M.G.; Korpisalo, P. Angiogenic gene therapy in cardiovascular diseases: Dream or vision? Eur. Heart J. 2017, 38, 1365–1371. [Google Scholar] [CrossRef]
- Faris, P.; Negri, S.; Perna, A.; Rosti, V.; Guerra, G.; Moccia, F. Therapeutic Potential of Endothelial Colony-Forming Cells in Ischemic Disease: Strategies to Improve their Regenerative Efficacy. Int. J. Mol. Sci. 2020, 21, 7406. [Google Scholar] [CrossRef] [PubMed]
- Asahara, T.; Murohara, T.; Sullivan, A.; Silver, M.; Van Der Zee, R.; Li, T.; Witzenbichler, B.; Schatteman, G.; Isner, J.M. Isolation of putative progenitor endothelial cells for angiogenesis. Science 1997, 275, 964–966. [Google Scholar] [CrossRef]
- Ligi, I.; Simoncini, S.; Tellier, E.; Grandvuillemin, I.; Marcelli, M.; Bikfalvi, A.; Buffat, C.; Dignat-George, F.; Anfosso, F.; Simeoni, U. Altered angiogenesis in low birth weight individuals: A role for anti-angiogenic circulating factors. J. Matern. Neonatal Med. 2013, 27, 233–238. [Google Scholar] [CrossRef]
- Mund, J.A.; Estes, M.L.; Yoder, M.C.; Ingram, D.A.; Case, J. Flow Cytometric Identification and Functional Characterization of Immature and Mature Circulating Endothelial Cells. Arter. Thromb. Vasc. Biol. 2012, 32, 1045–1053. [Google Scholar] [CrossRef] [Green Version]
- Premer, C.; Kanelidis, A.J.; Hare, J.M.; Schulman, I.H. Rethinking Endothelial Dysfunction as a Crucial Target in Fighting Heart Failure. Mayo Clin. Proc. Innov. Qual. Outcomes 2019, 3, 1–13. [Google Scholar] [CrossRef] [Green Version]
- Michowitz, Y.; Goldstein, E.; Wexler, D.; Sheps, D.; Keren, G.; George, J. Circulating endothelial progenitor cells and clinical outcome in patients with congestive heart failure. Heart 2007, 93, 1046–1050. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Andreou, I.; Tousoulis, D.; Tentolouris, C.; Antoniades, C.; Stefanadis, C. Potential role of endothelial progenitor cells in the pathophysiology of heart failure: Clinical implications and perspectives. Atherosclerosis 2006, 189, 247–254. [Google Scholar] [CrossRef] [PubMed]
- Luo, S.; Xia, W.; Chen, C.; Robinson, E.A.; Tao, J. Endothelial progenitor cells and hypertension: Current concepts and future implications. Clin. Sci. 2016, 130, 2029–2042. [Google Scholar] [CrossRef] [PubMed]
- Thum, T.; Fraccarollo, D.; Schultheiss, M.; Froese, S.; Galuppo, P.; Widder, J.D.; Tsikas, D.; Ertl, G.; Bauersachs, J. Endothelial Nitric Oxide Synthase Uncoupling Impairs Endothelial Progenitor Cell Mobilization and Function in Diabetes. Diabetes 2007, 56, 666–674. [Google Scholar] [CrossRef] [Green Version]
- De Pascale, M.R.; Bruzzese, G.; Crimi, E.; Grimaldi, V.; Liguori, A.; Brongo, S.; Barbieri, M.; Picascia, A.; Schiano, C.; Sommese, L.; et al. Severe Type 2 Diabetes Induces Reversible Modifications of Endothelial Progenitor Cells Which are Ameliorate by Glycemic Control. Int. J. Stem Cells 2016, 9, 137–144. [Google Scholar] [CrossRef] [Green Version]
- Yue, W.-S.; Lau, K.; Siu, C.-W.; Wang, M.; Yan, G.-H.; Yiu, K.-H.; Tse, H.F. Impact of glycemic control on circulating endothelial progenitor cells and arterial stiffness in patients with type 2 diabetes mellitus. Cardiovasc. Diabetol. 2011, 10, 113. [Google Scholar] [CrossRef] [Green Version]
- Von Versen-Höynck, F.; Brodowski, L.; Dechend, R.; Myerski, A.C.; Hubel, C.A. Vitamin D Antagonizes Negative Effects of Preeclampsia on Fetal Endothelial Colony Forming Cell Number and Function. PLoS ONE 2014, 9, e98990. [Google Scholar] [CrossRef]
- Muñoz-Hernandez, R.; Miranda, M.L.; Stiefel, P.; Lin, R.-Z.; Praena-Fernández, J.M.; Dominguez-Simeon, M.J.; Villar, J.; Moreno-Luna, R.; Melero-Martin, J.M. Decreased Level of Cord Blood Circulating Endothelial Colony–Forming Cells in Preeclampsia. Hypertension 2014, 64, 165–171. [Google Scholar] [CrossRef] [Green Version]
- Vasa-Nicotera, M.; Fichtlscherer, S.; Aicher, A.; Adler, K.; Urbich, C.; Martin, H.; Zeiher, A.M.; Dimmeler, S. Number and Migratory Activity of Circulating Endothelial Progenitor Cells Inversely Correlate with Risk Factors for Coronary Artery Disease. Circ. Res. 2001, 89, e1–e7. [Google Scholar] [CrossRef] [Green Version]
- Hill, J.M.; Zalos, G.; Halcox, J.P.J.; Schenke, W.H.; Waclawiw, M.A.; Quyyumi, A.A.; Finkel, T. Circulating en-dothelial progenitor cells, vascular function, and cardiovascular risk. New Engl. J. Med. 2003, 348, 593–600. [Google Scholar] [CrossRef]
- Sen, S.; McDonald, S.P.; Coates, P.T.H.; Bonder, C.S. Endothelial progenitor cells: Novel biomarker and promising cell therapy for cardiovascular disease. Clin. Sci. 2010, 120, 263–283. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ingram, D.A.; Mead, L.E.; Tanaka, H.; Meade, V.; Fenoglio, A.; Mortell, K.; Pollok, K.; Ferkowicz, M.J.; Gilley, D.; Yoder, M.C. Identification of a novel hierarchy of endothelial progenitor cells using human peripheral and umbilical cord blood. Blood 2004, 104, 2752–2760. [Google Scholar] [CrossRef] [PubMed]
- Collett, J.A.; Mehrotra, P.; Crone, A.; Shelley, W.C.; Yoder, M.C.; Basile, D.P. Endothelial colony-forming cells ameliorate endothelial dysfunction via secreted factors following ischemia-reperfusion injury. Am. J. Physiol. 2017, 312, F897–F907. [Google Scholar] [CrossRef] [PubMed]
- Du, F.; Zhou, J.; Gong, R.; Huang, X.; Pansuria, M.; Virtue, A.; Li, X.; Wang, H.; Yang, X.-F. Endothelial progeni-tor cells in atherosclerosis. Front. Biosci. 2012, 17, 2327–2349. [Google Scholar] [CrossRef] [Green Version]
- Smadja, D.M. Vasculogenic Stem and Progenitor Cells in Human: Future Cell Therapy Product or Liquid Biop-sy for Vascular Disease. In Stem Cells: Therapeutic Applications; Ratajczak, M.Z., Ed.; Springer: Cham, Switzerland, 2020; pp. 215–237. [Google Scholar]
- Patschan, D.; Schwarze, K.; Tampe, B.; Zeisberg, M.; Patschan, S.; Müller, G.A. Endothelial Colony Forming Cells (ECFCs) in murine AKI-implications for future cell-based therapies. BMC Nephrol. 2017, 18, 53. [Google Scholar] [CrossRef] [Green Version]
- Critser, P.J.; Yoder, M.C. Endothelial colony-forming cell role in neoangiogenesis and tissue repair. Curr. Opin. Organ Transplant. 2010, 15, 68–72. [Google Scholar] [CrossRef]
- Au, P.; Daheron, L.M.; Duda, D.G.; Cohen, K.S.; Tyrrell, J.A.; Lanning, R.M.; Fukumura, D.; Scadden, D.T.; Jain, R.K. Differential in vivo potential of endothelial progenitor cells from human umbilical cord blood and adult peripheral blood to form functional long-lasting vessels. Blood 2008, 111, 1302–1305. [Google Scholar] [CrossRef] [Green Version]
- Keighron, C.; Lyons, C.J.; Creane, M.; O’Brien, T.; Liew, A. Recent advances in endothelial progenitor cells toward their use in clinical translation. Front. Med. 2018, 5, 354. [Google Scholar] [CrossRef] [Green Version]
- Taylor, F.; Huffman, M.D.; Macedo, A.F.; Moore, T.H.M.; Burke, M.; Smith, G.D.; Ward, K.; Ebrahim, S. Statins for the primary prevention of cardiovascular disease. Cochrane Database Syst. Rev. 2013, 2013, CD004816. [Google Scholar] [CrossRef]
- Scandinavian Simvastatin Survival Study Group. Randomised trial of cholesterol lowering in 4444 patients with coronary heart disease: The Scandinavian Simvastatin Survival Study (4S). Lancet 1994, 344, 1383–1389. [Google Scholar]
- Goldstein, J.L.; Brown, M.S. Regulation of the mevalonate pathway. Nat. Cell Biol. 1990, 343, 425–430. [Google Scholar] [CrossRef] [PubMed]
- Shepherd, J.; Cobbe, S.M.; Ford, I.; Isles, C.G.; Lorimer, A.R.; Macfarlane, P.W.; McKillop, J.H.; Packard, C.J. Prevention of Coronary Heart Disease with Pravastatin in Men with Hypercholesterolemia. N. Engl. J. Med. 1995, 333, 1301–1308. [Google Scholar] [CrossRef] [PubMed]
- Kwak, B.; Mulhaupt, F.; Myit, S.; Mach, F. Statins as a newly recognized type of immunomodulator. Nat. Med. 2000, 6, 1399–1402. [Google Scholar] [CrossRef] [PubMed]
- Maltese, W.A. Posttranslational modification of proteins by isoprenoids in mammalian cells. FASEB J. 1990, 4, 3319–3328. [Google Scholar] [CrossRef]
- D’Audigier, C.; Gautier, B.; Yon, A.; Alili, J.-M.; Guerin, C.; Evrard, S.M.; Godier, A.; Haviari, S.; Reille-Serroussi, M.; Huguenot, F.; et al. Targeting VEGFR1 on endothelial progenitors modulates their differentiation potential. Angiogenesis 2014, 17, 603–616. [Google Scholar] [CrossRef]
- Lacoste, L.; Lam, J.Y.; Hung, J.; Letchacovski, G.; Solymoss, C.B.; Waters, D. Hyperlipidemia and Coronary Disease. Circulation 1995, 92, 3172–3177. [Google Scholar] [CrossRef]
- Bustos, C.; Hernández-Presa, M.A.; Ortego, M.; Tuñón, J.; Ortega, L.; Pérez, F.; Díaz, C.; Hernández, G.; Egido, J. HMG-CoA reductase inhibition by atorvastatin reduces neointimal inflammation in a rabbit model of atherosclerosis. J. Am. Coll. Cardiol. 1998, 32, 2057–2064. [Google Scholar] [CrossRef] [Green Version]
- Rosenson, R.S.; Tangney, C.C. Antiatherothrombotic Properties of Statins. JAMA 1998, 279, 1643–1650. [Google Scholar] [CrossRef] [Green Version]
- Nakao, T.; Shiota, M.; Tatemoto, Y.; Izumi, Y.; Iwao, H. Pravastatin Induces Rat Aortic Endothelial Cell Proliferation and Migration via Activation of PI3K/Akt/mTOR/p70 S6 Kinase Signaling. J. Pharmacol. Sci. 2007, 105, 334–341. [Google Scholar] [CrossRef] [Green Version]
- Hayashi, S.; Takamiya, R.; Yamaguchi, T.; Matsumoto, K.; Tojo, S.J.; Tamatani, T.; Kitajima, M.; Makino, N.; Ishimura, Y.; Suematsu, M. Induction of Heme Oxygenase-1 Suppresses Venular Leukocyte Adhesion Elicited by Oxidative Stress. Circ. Res. 1999, 85, 663–671. [Google Scholar] [CrossRef] [Green Version]
- Gerber, H.-P.; McMurtrey, A.; Kowalski, J.; Yan, M.; Keyt, B.A.; Dixit, V.M.; Ferrara, N. Vascular Endothelial Growth Factor Regulates Endothelial Cell Survival through the Phosphatidylinositol 3′-Kinase/Akt Signal Transduction Pathway. J. Biol. Chem. 1998, 273, 30336–30343. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kolluru, G.K.; Siamwala, J.H.; Chatterjee, S. eNOS phosphorylation in health and disease. Biochimie 2010, 92, 1186–1198. [Google Scholar] [CrossRef] [PubMed]
- Saad, A.F.; Kechichian, T.; Yin, H.; Sbrana, E.; Longo, M.; Wen, M.; Tamayo, E.; Hankins, G.D.V.; Saade, G.R.; Costantine, M.M. Effects of Pravastatin on Angiogenic and Placental Hypoxic Imbalance in a Mouse Model of Preeclampsia. Reprod. Sci. 2013, 21, 138–145. [Google Scholar] [CrossRef] [PubMed]
- Kusuyama, T.; Omura, T.; Nishiya, D.; Enomoto, S.; Matsumoto, R.; Murata, T.; Takeuchi, K.; Yoshikawa, J.; Yoshiyama, M. The Effects of HMG-CoA Reductase Inhibitor on Vascular Progenitor Cells. J. Pharmacol. Sci. 2006, 101, 344–349. [Google Scholar] [CrossRef] [Green Version]
- Cudmore, M.; Ahmad, S.; Al-Ani, B.; Fujisawa, T.; Coxall, H.; Chudasama, K.; Devey, L.; Wigmore, S.J.; Abbas, A.; Hewett, P.W.; et al. Negative Regulation of Soluble Flt-1 and Soluble Endoglin Release by Heme Oxygenase-1. Circulation 2007, 115, 1789–1797. [Google Scholar] [CrossRef] [Green Version]
- Kumasawa, K.; Ikawa, M.; Kidoya, H.; Hasuwa, H.; Saito-Fujita, T.; Morioka, Y.; Takakura, N.; Kimura, T.; Okabe, M. Pravastatin induces placental growth factor (PGF) and ameliorates preeclampsia in a mouse model. Proc. Natl. Acad. Sci. USA 2010, 108, 1451–1455. [Google Scholar] [CrossRef] [Green Version]
- Noris, M.; Perico, N.; Remuzzi, G. Mechanisms of Disease: Pre-eclampsia. Nat. Clin. Pract. Nephrol. 2005, 1, 98–114. [Google Scholar] [CrossRef] [Green Version]
- Ahmad, S.; Ahmed, A. Elevated Placental Soluble Vascular Endothelial Growth Factor Receptor-1 Inhibits Angiogenesis in Preeclampsia. Circ. Res. 2004, 95, 884–891. [Google Scholar] [CrossRef] [Green Version]
- American College of Obstetricians and Gynecologists; Task Force on Hypertension in Pregnancy. Hypertension in Pregnancy. Obstet. Gynecol. 2013, 122, 1122–1131. [Google Scholar] [CrossRef]
- Grundmann, M.; Haidar, M.; Placzko, S.; Niendorf, R.; Darashchonak, N.; Hubel, C.A.; Von Versen-Höynck, F. Vitamin D improves the angiogenic properties of endothelial progenitor cells. Am. J. Physiol. Physiol. 2012, 303, C954–C962. [Google Scholar] [CrossRef]
- Schröder-Heurich, B.; Von Hardenberg, S.; Brodowski, L.; Kipke, B.; Meyer, N.; Borns, K.; Von Kaisenberg, C.S.; Brinkmann, H.; Claus, P.; Versen-Höynck, F. Vitamin D improves endothelial barrier integrity and counteracts inflammatory effects on endothelial progenitor cells. FASEB J. 2019, 33, 9142–9153. [Google Scholar] [CrossRef] [PubMed]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-Dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Zhang, M.; Malik, A.B.; Rehman, J. Endothelial progenitor cells and vascular repair. Curr. Opin. Hematol. 2014, 21, 224–228. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Haider, K.H.; Aziz, S.; Al-Reshidi, M.A. Endothelial progenitor cells for cellular angiogenesis and repair: Lessons learned from experimental animal models. Regen. Med. 2017, 12, 969–982. [Google Scholar] [CrossRef]
- Takahashi, T.; Kalka, C.; Masuda, H.; Chen, D.; Silver, M.; Kearney, M.; Magner, M.; Isner, J.M.; Asahara, T. Ischemia- and cytokine-induced mobilization of bone marrow-derived endothelial progenitor cells for neovascularization. Nat. Med. 1999, 5, 434–438. [Google Scholar] [CrossRef]
- Edwards, N.; Langford-Smith, A.W.W.; Wilkinson, F.L.; Alexander, M.Y. Endothelial Progenitor Cells: New Targets for Therapeutics for Inflammatory Conditions With High Cardiovascular Risk. Front. Med. 2018, 5, 200. [Google Scholar] [CrossRef] [Green Version]
- Banno, K.; Yoder, M.C. Tissue regeneration using endothelial colony-forming cells: Promising cells for vascular repair. Pediatr. Res. 2018, 83, 283–290. [Google Scholar] [CrossRef] [Green Version]
- Piechota-Polanczyk, A.; Jozkowicz, A. The Role of Statins in the Activation of Heme Oxygenase-1 in Cardiovascular Diseases. Curr. Drug Targets 2017, 17, 1. [Google Scholar] [CrossRef]
- Higashi, Y.; Matsuoka, H.; Umei, H.; Sugano, R.; Fujii, Y.; Soga, J.; Kihara, Y.; Chayama, K.; Imaizumi, T. Endothelial function in subjects with isolated low HDL cholesterol: Role of nitric oxide and circulating progenitor cells. Am. J. Physiol. Metab. 2010, 298, E202–E209. [Google Scholar] [CrossRef]
- Urbich, C.; Heeschen, C.; Aicher, A.; Sasaki, K.-I.; Bruhl, T.; Farhadi, M.R.; Vajkoczy, P.; Hofmann, W.K.; Peters, C.; Pennacchio, L.A.; et al. Cathepsin L is required for endothelial progenitor cell–induced neovascularization. Nat. Med. 2005, 11, 206–213. [Google Scholar] [CrossRef] [Green Version]
- Urbich, C.; Dernbach, E.; Zeiher, A.M.; Dimmeler, S. Double-edged role of statins in angiogenesis signaling. Circ. Res. 2002, 90, 737–744. [Google Scholar] [CrossRef] [Green Version]
- Weis, M.; Heeschen, C.; Glassford, A.J.; Cooke, J.P. Statins Have Biphasic Effects on Angiogenesis. Circulation 2002, 105, 739–745. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dimmeler, S.; Aicher, A.; Vasa, M.; Mildner-Rihm, C.; Adler, K.; Tiemann, M.; Rütten, H.; Fichtlscherer, S.; Martin, H.; Zeiher, A.M. HMG-CoA reductase inhibitors (statins) increase endothelial progenitor cells via the PI 3-kinase/Akt pathway. J. Clin. Investig. 2001, 108, 391–397. [Google Scholar] [CrossRef] [PubMed]
- Assmus, B.; Urbich, C.; Aicher, A.; Hofmann, W.K.; Haendeler, J.; Rössig, L.; Spyridopoulos, I.; Zeiher, A.M.; Dimmeler, S. HMG-CoA Reductase Inhibitors Reduce Senescence and Increase Proliferation of Endothelial Progenitor Cells via Regulation of Cell Cycle Regulatory Genes. Circ. Res. 2003, 92, 1049–1055. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hu, K.; Wan, Q. Biphasic influence of pravastatin on human cardiac microvascular endothelial cell functions under pathological and physiological conditions. Biochem. Biophys. Res. Commun. 2019, 511, 476–481. [Google Scholar] [CrossRef] [PubMed]
- Brownfoot, F.C.; Tong, S.; Hannan, N.J.; Binder, N.K.; Walker, S.P.; Cannon, P.; Hastie, R.; Onda, K.; Kaitu’U-Lino, T.J. Effects of Pravastatin on Human Placenta, Endothelium, and Women with Severe Preeclampsia. Hypertension 2015, 66, 687–697. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brownfoot, F.C.; Tong, S.; Hannan, N.J.; Hastie, R.; Cannon, P.; Kaitu’U-Lino, T.J. Effects of simvastatin, rosuvastatin and pravastatin on soluble fms-like tyrosine kinase 1 (sFlt-1) and soluble endoglin (sENG) secretion from human umbilical vein endothelial cells, primary trophoblast cells and placenta. BMC Pregnancy Childbirth 2016, 16, 117. [Google Scholar] [CrossRef]
- Llevadot, J.; Asahara, T. Effects of statins on angiogenesis and vasculogenesis. Rev. Española Cardiol. 2002, 55, 838–844. [Google Scholar] [CrossRef]
- Somanath, P.R.; Razorenova, O.V.; Chen, J.; Byzova, T.V. Akt1 in endothelial cell and angiogenesis. Cell Cycle 2006, 5, 512–518. [Google Scholar] [CrossRef] [Green Version]
- Morales-Ruiz, M.; Fulton, D.; Sowa, G.; Languino, L.R.; Fujio, Y.; Walsh, K.; Sessa, W.C. Vascular Endothelial Growth Factor–Stimulated Actin Reorganization and Migration of Endothelial Cells Is Regulated via the Serine/Threonine Kinase Akt. Circ. Res. 2000, 86, 892–896. [Google Scholar] [CrossRef]
- Kureishi, Y.; Luo, Z.; Shiojima, I.; Bialik, A.; Fulton, D.; Lefer, D.J.; Sessa, W.C.; Walsh, K. The HMG-CoA reductase inhibitor simvastatin activates the protein kinase Akt and promotes angiogenesis in normocholesterolemic animals. Nat. Med. 2000, 6, 1004–1010. [Google Scholar] [CrossRef] [PubMed]
- Llevadot, J.; Murasawa, S.; Kureishi, Y.; Uchida, S.; Masuda, H.; Kawamoto, A.; Walsh, K.; Isner, J.M.; Asahara, T. HMG-CoA reductase inhibitor mobilizes bone marrow–derived endothelial progenitor cells. J. Clin. Investig. 2001, 108, 399–405. [Google Scholar] [CrossRef] [PubMed]
- Michell, B.; Griffiths, J.; Mitchelhill, K.; Rodriguez-Crespo, I.; Tiganis, T.; Bozinovski, S.; De Montellano, P.; Kemp, B.; Pearson, R. The Akt kinase signals directly to endothelial nitric oxide synthase. Curr. Biol. 1999, 9, p845–p848. [Google Scholar] [CrossRef] [Green Version]
- Goligorsky, M.S. Endothelial progenitor cells: From senescence to rejuvenation. Semin. Nephrol. 2014, 34, 365–373. [Google Scholar] [CrossRef] [Green Version]
- Sasaki, K.-I.; Heeschen, C.; Aicher, A.; Ziebart, T.; Honold, J.; Urbich, C.; Rossig, L.; Koehl, U.; Koyanagi, M.; Mohamed, A.; et al. Ex vivo pretreatment of bone marrow mononuclear cells with endothelial NO synthase enhancer AVE9488 enhances their functional activity for cell therapy. Proc. Natl. Acad. Sci. USA 2006, 103, 14537–14541. [Google Scholar] [CrossRef] [Green Version]
- Fraccarollo, D.; Widder, J.D.; Galuppo, P.; Thum, T.; Tsikas, D.; Hoffmann, M.; Ruetten, H.; Ertl, G.; Bauersachs, J. Improvement in Left Ventricular Remodeling by the Endothelial Nitric Oxide Synthase Enhancer AVE9488 After Experimental Myocardial Infarction. Circulation 2008, 118, 818–827. [Google Scholar] [CrossRef] [Green Version]
- Landmesser, U.; Engberding, N.; Bahlmann, F.H.; Schaefer, A.; Wiencke, A.; Heineke, A.; Spiekermann, S.; Hilfiker-Kleiner, D.; Templin, C.; Kotlarz, D.; et al. Statin-Induced Improvement of Endothelial Progenitor Cell Mobilization, Myocardial Neovascularization, Left Ventricular Function, and Survival After Experimental Myocardial Infarction Requires Endothelial Nitric Oxide Synthase. Circulation 2004, 110, 1933–1939. [Google Scholar] [CrossRef] [Green Version]
- Suh, J.-W.; Choi, D.-J.; Chang, H.; Cho, Y.-S.; Youn, T.-J.; Chae, I.-H.; Kim, K.-I.; Kim, C.-H.; Kim, H.-S.; Oh, B.-H.; et al. HMG-CoA Reductase Inhibitor Improves Endothelial Dysfunction in Spontaneous Hypertensive Rats Via Down-regulation of Caveolin-1 and Activation of Endothelial Nitric Oxide Synthase. J. Korean Med Sci. 2010, 25, 16–23. [Google Scholar] [CrossRef] [Green Version]
- Rossoni, L.V.; Wareing, M.; Wenceslau, C.F.; Al-Abri, M.; Cobb, C.; Austin, C.E. Acute simvastatin increases endothelial nitric oxide synthase phosphorylation via AMP-activated protein kinase and reduces contractility of isolated rat mesenteric resistance arteries. Clin. Sci. 2011, 121, 449–458. [Google Scholar] [CrossRef] [Green Version]
- Bornman, L.; Baladi, S.; Richard, M.-J.; Tyrrell, R.M.; Polla, B.S. Differential regulation and expression of stress proteins and ferritin in human monocytes. J. Cell. Physiol. 1999, 178, 1–8. [Google Scholar] [CrossRef]
- Otterbein, L.E.; Kolls, J.K.; Mantell, L.L.; Cook, J.L.; Alam, J.; Choi, A.M. Exogenous administration of heme oxygenase-1 by gene transfer provides protection against hyperoxia-induced lung injury. J. Clin. Investig. 1999, 103, 1047–1054. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Araujo, J.A.; Meng, L.; Tward, A.D.; Hancock, W.W.; Zhai, Y.; Lee, A.; Ishikawa, K.; Iyer, S.; Buelow, R.; Busuttil, R.W.; et al. Systemic Rather Than Local Heme Oxygenase-1 Overexpression Improves Cardiac Allograft Outcomes in a New Transgenic Mouse. J. Immunol. 2003, 171, 1572–1580. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brunt, K.R.; Wu, J.; Chen, Z.; Poeckel, D.; Dercho, R.A.; Melo, L.G.; Funk, C.D.; Ward, C.A.; Li, R.-K. Ex Vivo Akt/HO-1 Gene Therapy to Human Endothelial Progenitor Cells Enhances Myocardial Infarction Recovery. Cell Transplant. 2012, 21, 1443–1461. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hinkelmann, U.; Grosser, N.; Erdmann, K.; Schröder, H.; Immenschuh, S. Simvastatin-dependent up-regulation of heme oxygenase-1 via mRNA stabilization in human endothelial cells. Eur. J. Pharm. Sci. 2010, 41, 118–124. [Google Scholar] [CrossRef] [PubMed]
- Grochot-Przeczek, A.; Kotlinowski, J.; Kozakowska, M.; Starowicz, K.; Jagodzinska, J.; Stachurska, A.; Volger, O.L.; Bukowska-Strakova, K.; Florczyk, U.; Tertil, M.; et al. Heme oxygenase-1 is required for angiogenic function of bone marrow-derived progenitor cells: Role in therapeutic revascularization. Antioxid. Redox Signal. 2014, 20, 1677–1692. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Joo, H.J.; Song, S.; Seo, H.-R.; Shin, J.H.; Choi, S.-C.; Park, J.H.; Yu, C.W.; Hong, S.J.; Lim, D.-S. Human endothelial colony forming cells from adult peripheral blood have enhanced sprouting angiogenic potential through up-regulating VEGFR2 signaling. Int. J. Cardiol. 2015, 197, 33–43. [Google Scholar] [CrossRef] [PubMed]
- Carmeliet, P.; Ferreira, V.; Breier, G.; Pollefeyt, S.; Kieckens, L.; Gertsenstein, M.; Fahrig, M.; Vandenhoeck, A.; Harpal, K.; Eberhardt, C.; et al. Abnormal blood vessel development and lethality in embryos lacking a single VEGF allele. Nat. Cell Biol. 1996, 380, 435–439. [Google Scholar] [CrossRef]
- Dubois, C.; Liu, X.; Claus, P.; Marsboom, G.; Pokreisz, P.; Vandenwijngaert, S.; Dépelteau, H.; Streb, W.; Chaothawee, L.; Maes, F.; et al. Differential effects of progenitor cell populations on left ventricular remodeling and myocardial neovascularization after myocardial infarction. J. Am. Coll. Cardiol. 2010, 55, 2232–2243. [Google Scholar] [CrossRef]
- Di Marco, G.S.; Reuter, S.; Hillebrand, U.; Amler, S.; König, M.; Larger, E.; Oberleithner, H.; Brand, E.; Pavenstädt, H.; Brand, M. The Soluble VEGF Receptor sFlt1 Contributes to Endothelial Dysfunction in CKD. J. Am. Soc. Nephrol. 2009, 20, 2235–2245. [Google Scholar] [CrossRef] [Green Version]
- Ollauri-Ibáñez, C.; López-Novoa, J.M.; Pericacho, M. Endoglin-based biological therapy in the treatment of angiogenesis-dependent pathologies. Expert Opin. Biol. Ther. 2017, 17, 1053–1063. [Google Scholar] [CrossRef]
- Nachtigal, P.; Pospisilova, N.; Jamborova, G.; Pospechova, K.; Solichova, D.; Andrys, C.; Zdansky, P.; Semecky, V. Endothelial expression of endoglin in normocholesterolemic and hypercholesterolemic C57BL/6J mice before and after atorvastatin treatment. Can. J. Physiol. Pharmacol. 2007, 85, 767–773. [Google Scholar] [CrossRef] [PubMed]
- Zemankova, L.; Varejckova, M.; Dolezalova, E.; Fikrova, P.; Jezkova, K.; Rathouska, J.; Cerveny, L.; Botella, L.M.; Bernabeu, C.; Nemeckova, I.; et al. Atorvastatin-induced endothelial nitric oxide synthase expression in endothelial cells is mediated by endoglin. J. Physiol. Pharmacol. Off. J. Pol. Physiol. Soc. 2015, 66, 403–413. [Google Scholar]
- Rathouska, J.; Jezkova, K.; Němečková, I.; Nachtigal, P. Soluble endoglin, hypercholesterolemia and endothelial dysfunction. Atherosclerosis 2015, 243, 383–388. [Google Scholar] [CrossRef] [PubMed]
- Bergmann, A.; Ahmad, S.; Cudmore, M.; Gruber, A.D.; Wittschen, P.; Lindenmaier, W.; Christofori, G.; Gross, V.; Gonzalves, A.C.D.C.; Gröne, H.-J.; et al. Reduction of circulating soluble Flt-1 alleviates preeclampsia-like symptoms in a mouse model. J. Cell. Mol. Med. 2009, 14, 1857–1867. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Katsi, V.; Georgountzos, G.; Kallistratos, M.S.; Zerdes, I.; Makris, T.; Manolis, A.J.; Nihoyannopoulos, P.; Tousoulis, D. The Role of Statins in Prevention of Preeclampsia: A Promise for the Future? Front. Pharmacol. 2017, 8, 247. [Google Scholar] [CrossRef] [Green Version]
- Levine, R.J.; Maynard, S.E.; Qian, C.; Lim, K.-H.; England, L.J.; Yu, K.F.; Schisterman, E.F.; Thadhani, R.; Sachs, B.P.; Epstein, F.H.; et al. Circulating Angiogenic Factors and the Risk of Preeclampsia. N. Engl. J. Med. 2004, 350, 672–683. [Google Scholar] [CrossRef] [Green Version]
- Wang, A.; Rana, S.; Karumanchi, S.A. Preeclampsia: The Role of Angiogenic Factors in Its Pathogenesis. Physiology 2009, 24, 147–158. [Google Scholar] [CrossRef]
- Gajzlerska-Majewska, W.; Bomba-Opon, D.A.; Wielgos, M. Is pravastatin a milestone in the prevention and treatment of preeclampsia? J. Périnat. Med. 2018, 46, 825–831. [Google Scholar] [CrossRef] [Green Version]
- Ahmed, A.; Cudmore, M.J. Can the biology of VEGF and haem oxygenases help solve pre-eclampsia? Biochem. Soc. Trans. 2009, 37, 1237–1242. [Google Scholar] [CrossRef] [Green Version]
- Nanovskaya, T.N.; Patrikeeva, S.L.; Paul, J.; Costantine, M.M.; Hankins, G.D.; Ahmed, M.S. Transplacental transfer and distribution of pravastatin. Am. J. Obstet. Gynecol. 2013, 209, 373.e1–373.e5. [Google Scholar] [CrossRef] [Green Version]
- LeCarpentier, E.; Morel, O.; Fournier, T.; Elefant, E.; Chavatte-Palmer, P.; Tsatsaris, V. Statins and Pregnancy. Drugs 2012, 72, 773–788. [Google Scholar] [CrossRef] [PubMed]
- Balan, A.; Szaingurten-Solodkin, I.; Swissa, S.S.; Feinshtein, V.; Huleihel, M.; Holcberg, G.; Dukler, D.; Beharier, O. The effects of pravastatin on the normal human placenta: Lessons from ex-vivo models. PLoS ONE 2017, 12, e0172174. [Google Scholar] [CrossRef] [PubMed]
- Vahedian-Azimi, A.; Karimi, L.; Reiner, Ž.; Makvandi, S.; Sahebkar, A. Effects of statins on preeclampsia: A systematic review. Pregnancy Hypertens. 2021, 23, 123–130. [Google Scholar] [CrossRef]
- De Alwis, N.; Beard, S.; Mangwiro, Y.T.; Binder, N.K.; Kaitu’U-Lino, T.J.; Brownfoot, F.C.; Tong, S.; Hannan, N.J. Pravastatin as the statin of choice for reducing pre-eclampsia-associated endothelial dysfunction. Pregnancy Hypertens. 2020, 20, 83–91. [Google Scholar] [CrossRef] [PubMed]
- Weber, M.L. Pravastatin-Ein Lipidsenker zur Präeklampsie-Prophylaxe und Therapieoption? Z. Geburtshilfe Neonatol. 2018, 222, 31–33. [Google Scholar] [CrossRef]
- The Fetal Medicine Foundation. Research: New Randomized Trials. Available online: https://fetalmedicine.org/research/new-randomized-trials (accessed on 6 August 2020).
- Paradisi, G.; Bracaglia, M.; Basile, F.; Di’Ipolito, S.; Di Nicuolo, F.; Ianniello, F.; Quagliozzi, L.; Donati, L.; Labianca, A.; Di Cesare, C.; et al. Effect of pravastatin on endothelial function and endothelial progenitor cells in healthy postmenopausal women. Clin. Exp. Obstet. Gynecol. 2012, 39, 153–159. [Google Scholar]
Gene | Sense | Antisense |
---|---|---|
VEGF-A | TACCTCCACCATGCCAAGTG | GATGATTCTGCCCTCCTCCTT |
PlGF | CCTACGTGGAGCTGACGTTCT | CCTTTCCGGCTTCATCTTCTC |
sFlt-1 | CTGTCTTCCAGAAAGTGCATTCA | TCACCACGTTGTTCTCAGATAAAAG |
Eng | ACCTTTGGTGCCTTCCTCAT | CAATCCCTCAGAGGCTTCAC |
HO-1 | TTTCAGAAGGGCCAGGTGAC | GGAAGTAGACAGGGGCGAAG |
RNA18S1 | ACATCCAAGGAAGGCAGCAG | TTTTCGTCACTACCTCCCCG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Meyer, N.; Brodowski, L.; Richter, K.; von Kaisenberg, C.S.; Schröder-Heurich, B.; von Versen-Höynck, F. Pravastatin Promotes Endothelial Colony-Forming Cell Function, Angiogenic Signaling and Protein Expression In Vitro. J. Clin. Med. 2021, 10, 183. https://0-doi-org.brum.beds.ac.uk/10.3390/jcm10020183
Meyer N, Brodowski L, Richter K, von Kaisenberg CS, Schröder-Heurich B, von Versen-Höynck F. Pravastatin Promotes Endothelial Colony-Forming Cell Function, Angiogenic Signaling and Protein Expression In Vitro. Journal of Clinical Medicine. 2021; 10(2):183. https://0-doi-org.brum.beds.ac.uk/10.3390/jcm10020183
Chicago/Turabian StyleMeyer, Nadia, Lars Brodowski, Katja Richter, Constantin S. von Kaisenberg, Bianca Schröder-Heurich, and Frauke von Versen-Höynck. 2021. "Pravastatin Promotes Endothelial Colony-Forming Cell Function, Angiogenic Signaling and Protein Expression In Vitro" Journal of Clinical Medicine 10, no. 2: 183. https://0-doi-org.brum.beds.ac.uk/10.3390/jcm10020183