The Wide Range of Antibiotic Resistance and Variability of Genotypic Profiles in Escherichia coli from Domestic Animals in Eastern Sicily
Abstract
:1. Introduction
2. Results
2.1. Antimicrobial Resistance
2.2. DEC Phatotypes Detection
2.3. PFGE Analysis
3. Discussion
4. Materials and Methods
4.1. Source of E. coli Isolation
4.2. Susceptibility Test
4.3. DEC Pathotypes Investigation
4.4. Pulsed-Field Gel Electrophoresis (PFGE)
4.5. Data Analyses
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Croxen, M.A.; Law, R.J.; Scholz, R.; Keeney, K.M.; Wlodarska, M.; Finlay, B.B. Recent advances in understanding enteric pathogenic Escherichia coli. Clin. Microbiol. Rev. 2013, 26, 822–880. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guillaume Dalmasso, J.D. Escherichia coli: The Good, the Bad and the Ugly. Clin. Microbiol. 2015, 4, 2–4. [Google Scholar] [CrossRef]
- Anderson, M.A.; Whitlock, J.E.; Harwood, V.J. Diversity and distribution of Escherichia coli genotypes and antibiotic resistance phenotypes in feces of humans, cattle, and horses. Appl. Environ. Microbiol. 2006, 72, 6914–6922. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Moeller, A.H.; Suzuki, T.A.; Phifer-Rixey, M.; Nachman, M.W. Transmission modes of the mammalian gut microbiota. Science 2018, 362, 453–457. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Loayza, F.; Graham, J.P.; Trueb, G. Factors obscuring the role of E. coli from domestic animals in the global antimicrobial resistance crisis: An evidence-based review. Int. J. Environ. Res. Public Health 2020, 17, 3061. [Google Scholar] [CrossRef] [PubMed]
- Escribano-Vazquez, U.; Verstraeten, S.; Martin, R.; Chain, F.; Langella, P.; Thomas, M.; Cherbuy, C. The commensal Escherichia coli CEC15 reinforces intestinal defences in gnotobiotic mice and is protective in a chronic colitis mouse model. Sci. Rep. 2019, 7, 11431. [Google Scholar] [CrossRef]
- Nataro, J.P.; Kaper, J.B. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 1998, 11, 142–201. [Google Scholar] [CrossRef] [Green Version]
- Hauser, E.; Mellmann, A.; Semmler, T.; Stoeber, H.; Wieler, L.H.; Karch, H.; Kuebler, N.; Fruth, A.; Harmsen, D.; Weniger, T.; et al. Phylogenetic and molecular analysis of food-borne shiga toxin-producing Escherichia coli. Appl. Environ. Microbiol. 2013, 79, 2731–2740. [Google Scholar] [CrossRef] [Green Version]
- Poirel, L.; Madec, J.; Lupo, A.; Schink, A.; Kieffer, N.; Nordmann, P.; Schwarz, S. Antimicrobial resistance in Escherichia coli. Microbiol. Spectr. 2018, 6. [Google Scholar] [CrossRef] [Green Version]
- The European Union One Health Zoonoses Report. European Food Safety Authority and European Centre for Disease Prevention and Control. 2019. Available online: https://0-doi-org.brum.beds.ac.uk/10.2903/j.efsa.2019.5926 (accessed on 18 September 2020).
- Matthijs, M.G.; Ariaans, M.P.; Dwars, R.M.; van Eck, J.H.; Bouma, A.; Stegeman, A.; Vervelde, L. Course of infection and immune responses in the respiratory tract of IBV infected broilers after superinfection with E. coli. Vet. Immunol. Immunopathol. 2009, 127, 77–84. [Google Scholar] [CrossRef] [Green Version]
- Matter, L.; Barbieri, N.L.; Nordhoff, M.; Ewers, C.; Horn, F. Avian pathogenic Escherichia coli MT78 invades chicken fibroblast. Vet. Microbiol. 2011, 148, 51–59. [Google Scholar] [CrossRef] [PubMed]
- De Carli, S.; Ikuta, N.; Lehmann, F.K.; da Silveira, V.P.; de Melo Pedrebon, G.; Fonseca, A.S.; Lunge, V.R. Virulence gene content in Escherichia coli isolates from poultry flocks with clinical signs of colibacillosis in Brazil. Poult. Sci. 2015, 94, 2635–2640. [Google Scholar] [CrossRef] [PubMed]
- Luppi, A. Swine enteric colibacillosis: Diagnosis, therapy and antimicrobial resistance. Porc. Health Manag. 2017, 3, 16. [Google Scholar] [CrossRef] [PubMed]
- Sgariglia, E.; Aconiti Mandolini, N.; Napoleoni, M.; Medici, L.; Fraticelli, R.; Conquista, M.; Gianfelici, P.; Staffolani, M.; Fisichella, S.; Capuccella, M.; et al. Antibiotic resistance pattern and virulence genes in avian pathogenic Escherichia coli (APEC) from different breeding systems. Vet. Ital. 2019, 55, 27–33. [Google Scholar] [CrossRef]
- McEwen, S.A. Antibiotic use in animal agriculture: What have we learned and where are we going? Anim. Biotechnol. 2006, 17, 239–250. [Google Scholar] [CrossRef] [PubMed]
- Ungemach, F.R.; Muller-Bahrdt, D.; Abraham, G. Guidelines for prudent use of antimicrobials and their implications on antibiotic usage in veterinary medicine. Int. J. Med. Microbiol. 2006, 296, 33. [Google Scholar] [CrossRef] [PubMed]
- Shaheen, B.W.; Boothe, D.M.; Oyarzabal, O.A.; Smaha, T. Antimicrobial resistance profiles and clonal relatedness of canine and feline Escherichia coli pathogens expressing multidrug resistance in the United States. J. Vet. Intern. Med. 2010, 24, 323–330. [Google Scholar] [CrossRef]
- Lukjancenko, O.; Wassenaar, T.M.; Ussery, D.W. Comparison of 61 sequenced Escherichia coli genomes. Microb. Ecol. 2010, 60, 708–720. [Google Scholar] [CrossRef] [Green Version]
- Ventola, C.L. The Antibiotic Resistance Crisis: Part 1—Causes and Threats. Pharm. Ther. 2015, 40, 277–283. [Google Scholar]
- Agga, G.E.; Cook, K.L.; Netthisinghe, A.M.P.; Gilfillen, R.A.; Woosley, P.B.; Sistani, K.R. Persistence of antibiotic resistance genes in beef cattle backgrounding environment over two years after cessation of operation. PLoS ONE 2019, 14, e0212510. [Google Scholar] [CrossRef] [Green Version]
- Bacanli, M.; Başaran, N. Importance of antibiotic residues in animal food. Food Chem. Toxicol. 2019, 125, 462–466. [Google Scholar] [CrossRef] [PubMed]
- Hedman, H.D.; Vasco, K.A.; Zhang, L. A Review of Antimicrobial Resistance in Poultry Farming within Low-Resource Settings. Animals 2020, 10, 1264. [Google Scholar] [CrossRef] [PubMed]
- Kimera, I.Z.; Mshana, S.E.; Rweyemamu, M.M.; Mboera, L.E.G.; Matee, M.I.N. Antimicrobial use and resistance in food producing animals and the environment: An African perspective. Antimicrob. Resist. Infect. Control. 2020, 9, 37. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Paitan, Y. Current trends in antimicrobial resistance of Escherichia coli. In Escherichia coli, a Versatile Pathogen. Current Topics in Microbiology and Immunology; Frankel, G., Ron, E., Eds.; Springer: Cham, Switzerland, 2018; Volume 416. [Google Scholar] [CrossRef]
- Singer, R.S.; Reid-Smith, R.; Sischo, W.M. Stakeholder position paper: Epidemiological perspectives on antibiotic use in animals. Prev. Vet. Med. 2006, 24, 153–161. [Google Scholar] [CrossRef] [PubMed]
- The European Committee on Antimicrobial Susceptibility Testing. The European Committee on Antimicrobial Susceptibility Testing Breakpoint Tables for Interpretation of MICs and Zone Diameters Version 10.0. Valid from 2020-01-01. Available online: http://www.eucast.org/clinical_breakpoints (accessed on 18 September 2020).
- Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Disk Susceptibility Approved Standard—30th Edition; CLSI Document M100; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2018. [Google Scholar]
- Stenske, A.K.; Bemis, D.A.; Gillespie, B.A.; Doris, M.S.; D’Souza, H.; Oliver, S.P.; Draughon, F.A.; Matteson, K.J.; Bartges, J.W. Comparison of clonal relatedness and antimicrobial susceptibility of fecal Escherichia coli from healthy dogs and their owners. Am. J. Vet. Res. 2009, 70, 1108–1116. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Aarestrup, F.M.; Duran, C.O.; Burch, D.G.S. Antimicrobial resistance in swine production. Anim. Health Res. Rev. 2008, 9, 135–148. [Google Scholar] [CrossRef] [PubMed]
- Aarestrup, F.M. Monitoring of Antimicrobial Resistance among Food Animals: Principles and Limitations. J. Vet. Med. 2004, 51, 8–9. [Google Scholar] [CrossRef]
- Dziva, F.; Stevens, M.P. Colibacillosis in poultry: Unravelling the molecular basis of virulence of avian pathogenic Escherichia coli in their natural hosts. Avian Path. 2008, 37, 355–366. [Google Scholar] [CrossRef] [Green Version]
- Olesen, B. Characterization of Four Escherichia coli Clonal Groups. Ph.D. Thesis, Faculty of Health and Medical Sciences, University of Copenhagen, Copenhagen, Denmark, August 2017. [Google Scholar] [CrossRef] [Green Version]
- Ori, E.L.; Takagi, E.H.; Andrade, T.S.; Miguel, B.T.; Cergole-Novella, M.C.; Guth, B.E.C.; Hernandes, R.T.; Dias, R.C.B.; Pinheiro, S.R.S.; Camargo, C.H.; et al. Diarrhoeagenic Escherichia coli and Escherichia albertii in Brazil: Pathotypes and serotypes over a 6-year period of surveillance. Epidemiol. Infect. 2018, 147, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Obeng, A.S.; Rickard, H.; Ndi, O.; Sexton, M.; Barton, M. Antibiotic resistance, phylogenetic grouping and virulence potential of Escherichia coli isolated from the faeces of intensively farmed and free range poultry. Vet. Microbiol. 2012, 154, 305–315. [Google Scholar] [CrossRef]
- Saira, B.; Yasra, S.; Aamir, A.; Mashkoor, M.; Muhammad, A.S.; Ayesha, T. Multiple drug resistance patterns in various phylogenetic groups of Uropathogenic E. coli isolated from faisalabad region of Pakistan. Braz. J. Microbiol. 2011, 42, 1278–1283. [Google Scholar]
- Bukh, A.S.; Schonheyder, H.C.; Emmersen, J.M.; Sogaard, M.; Bastholm, S.; Roslev, P. Escherichia coli phylogenetic groups are associated with site of infection and level of antibiotic resistance in community-acquired bacteraemia: A 10 year population-based study in Denmark. J. Antimicrob. Chemother. 2009, 64, 163–168. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Molina-López, J.; Aparicio-Ozores, G.; Ribas-Aparicio, R.M.; Gavilanes-Parra, S.; Chávez-Berrocal, M.E.; Nataro, J.P.; Kaper, J.B. Drug resistance, serotypes, and phylogenetic groups among uropathogenic Escherichia coli including O25-ST131 in Mexico City. J. Infect. Dev. Ctries. 2011, 5, 840–849. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sayah, R.S.; Kaneene, J.B.; Johnson, Y.; Miller, R. Patterns of antimicrobial resistance observed in Escherichia coli isolates obtained from domestic- and wild-animal fecal samples, human septage, and surface water. Appl. Environ. Microbiol. 2005, 71, 1394–1404. [Google Scholar] [CrossRef] [Green Version]
- Kazemnia, A.; Ahmadi, M.; Dilmaghani, M. Antibiotic resistance pattern of different Escherichia coli phylogenetic groups isolated from human urinary tract infection and avian colibacillosis. Iran. Biomed. J. 2014, 18, 219–224. [Google Scholar] [CrossRef]
- Bonnet, R. Growing group of extended spectrum: The CTX-M enzymes. Antimicrob. Agent. Chemother. 2004, 48, 1–14. [Google Scholar] [CrossRef] [Green Version]
- Mathers, A.J.; Peirano, G.; Pitout, J.D.D. The role of epidemic resistance plasmids and international high- risk clones in the spread of multidrug-resistant Enterobacteriaceae. Clin. Microbiol. Rev. 2015, 28, 565–591. [Google Scholar] [CrossRef] [Green Version]
- Van den Bogaard, A.E.; London, N.; Driessen, C.; Stobberingh, E.E. Antibiotic resistance of faecal Escherichia coli in poultry, poultry farmers and poultry slaughterers. J. Antimicrob. Chemother. 2001, 47, 763–771. [Google Scholar] [CrossRef]
- Johura, F.T.; Tasnim, J.; Barman, I. Colistin-resistant Escherichia coli carrying mcr-1 in food, water, hand rinse, and healthy human gut in Bangladesh. Gut Pathog. 2020, 12, 5. [Google Scholar] [CrossRef] [Green Version]
- Matuschek, E.; Åhman, J.; Webster, C.; Kahlmeter, G. Antimicrobial susceptibility testing of colistin—Evaluation of seven commercial MIC products against standard broth microdilution for Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Acinetobacter spp. Clin. Microbiol. Infect. 2018, 24, 865. [Google Scholar] [CrossRef] [Green Version]
- The European Committee on Antimicrobial Susceptibility Testing. European Committee on Antimicrobial Susceptibility Testing Breakpoint Tables for Interpretation of MICs and Zone Diameters. 2017. Version 7.1 valid from 2017-03-10. Available online: http://www.eucast.org (accessed on 30 December 2020).
- Loose, M.; Naber, K.G.; Coates, A.; Wagenlehner, F.M.E.; Hu, Y. Effect of different media on the bactericidal activity of colistin and on the synergistic combination with azidothymidine against mcr-1-positive colistin-resistant Escherichia coli. Front. Microbiol. 2020, 11, 54. [Google Scholar] [CrossRef] [PubMed]
- Baron, S.; Hadjadj, L.; Rolain, J.M.; Olaitan, A.O. Molecular mechanism of polymxin resistance: Knows and unknows. Int. J. Antimicrob. Agents 2016, 48, 583–591. [Google Scholar] [CrossRef] [PubMed]
- Cannatelli, A.; D’Andrea, M.M.; Giani, T.; Di Pilato, V.; Arena, F.; Ambretti, S. In vivo emergence of colistin resistance in Klebsiella pneumoniae producing KPC-type carbapenemases mediated by insertional inactivating of the PhoQ/PhoP mgrB regulator. Antimicrob. Agents Chemother. 2016, 57, 5521–5526. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lui, Y.Y.; Wang, Y.; Walsh, T.R.; Yi, L.X.; Zhang, R.; Spencer, J. Emergence of plasmid-mediated colistin resistance mechanism mcr-1 in animals and human beings in China: A microbiological and molecular biological study. Lancet Infect. Dis. 2016, 16, 161–168. [Google Scholar] [CrossRef]
- Russo, N.; Pino, A.; Toscano, A.; Cirelli, G.L.; Caggia, C.; Arioli, S.; Randazzo, C.L. Occurrence, diversity, and persistence of antibiotic resistant enterococci in full-scale constructed wetlands treating urban wastewater in Sicily. Bioresour. Technol. 2019, 274, 468–478. [Google Scholar] [CrossRef] [PubMed]
- Du, Z. The prevalence of amphenicol resistance in Escherichia coli isolated from pigs in mainland China from 2000 to 2018: A systematic review and meta-analysis. PLoS ONE 2020, 15, e0228388. [Google Scholar] [CrossRef] [Green Version]
- Chapman, T.A.; Wu, X.Y.; Barchia, I.; Bettelheim, K.A.; Driesen, S.; Trott, D.; Wilson, M.; Chin, J.J. Comparison of virulence gene profiles of Escherichia coli strains isolated from healthy and diarrheic swine. Appl. Environ. Microbiol. 2006, 72, 4782–4795. [Google Scholar] [CrossRef] [Green Version]
- Cundon, C.; Carbonari, C.C.; Zolezzi, G.; Rivas, M.; Bentancor, A. Putative virulence factors and clonal relationship of O174 Shiga toxinproducing Escherichia coli isolated from human, food and animal sources. Vet. Microb. 2018, 215, 29–34. [Google Scholar] [CrossRef]
- Milkman, R. Electrophoretic variation in Escherichia coli from natural sources. Science 1973, 182, 1024–1026. [Google Scholar] [CrossRef]
- Milkman, R. Recombination and population structure in Escherichia coli. Genetics 1997, 146, 745–750. [Google Scholar]
- Peerayeh, S.N.; Navidinia, M.; Fallah, F.; Bakhshi, B.; Alebouyeh, M. Evaluation of clonal relatedness among different sources of E. coli isolates in Iranian children with urinary tract infection (UTI) and age-matched healthy people. Biomed. Res. 2019, 30. [Google Scholar] [CrossRef] [Green Version]
- Klein, G.; Bulte, M. Antibiotic susceptibility pattern of Escherichia coli strains with verocytotoxic E. coli-associated virulence factors from food and animal species. Food Microbiol. 2003, 20, 27–33. [Google Scholar] [CrossRef]
- Technical Committee ISO/TC 212: Clinical Laboratory Testing and In Vitro Diagnostic Test Systems. ISO 20776-1:2019-Susceptibility Testing of Infectious Agents and Evaluation of Performance of Antimicrobial Susceptibility Test Devices—Part 1: Broth Micro-Dilution Reference Method for Testing the In Vitro Activity of Antimicrobial Agents Against Rapidly Growing Aerobic Bacteria Involved in Infectious Diseases. Available online: https://www.iso.org/standard/70464.html (accessed on 30 December 2020).
- Centers for Disease Control and Prevention, CDC: PulseNet. PNL04 Standard Operating Procedure for PulseNet PFGE—CDC, July 2017, Atlanta, USA. Available online: https://www.cdc.gov/pulsenet/pdf/listeria-pfge-protocol-508c.pdf (accessed on 18 September 2020).
Antimicrobial Agents | No. Tested | Resistant | Intermedium | Susceptible | |||
---|---|---|---|---|---|---|---|
no. | % | no. | % | no. | % | ||
Aminosidine | 104 | 30 | 29 | 1 | 1 | 73 | 70 |
Colistin 1 | 104 | 8 | 8 | 0 | 0 | 96 | 92 |
Enrofloxacin | 104 | 48 | 46 | 10 | 10 | 46 | 44 |
Lincomycin and Spectomicin | 104 | 34 | 33 | 22 | 21 | 48 | 46 |
Oxytetracycline | 104 | 71 | 68 | 20 | 19 | 13 | 13 |
Thiamphenicol | 104 | 52 | 50 | 42 | 40 | 10 | 10 |
Tylmicosin | 104 | 52 | 50 | 1 | 1 | 51 | 49 |
Tylosin | 104 | 101 | 97 | 1 | 1 | 2 | 2 |
Trimethoprim | 104 | 58 | 56 | 2 | 2 | 44 | 42 |
Sulphamethoxazole | 104 | 98 | 94 | 6 | 6 | 0 | 0 |
Ampicillin | 104 | 78 | 75 | 8 | 8 | 18 | 17 |
Doxycycline | 104 | 68 | 65 | 18 | 17 | 18 | 17 |
Flumequine | 104 | 56 | 54 | 8 | 8 | 40 | 38 |
Erythromycin | 104 | 96 | 92 | 7 | 7 | 1 | 1 |
Amoxicillin | 104 | 104 | 100 | 0 | 0 | 0 | 0 |
Apramycin | 104 | 33 | 32 | 1 | 1 | 70 | 67 |
Antimicrobial Agents | Colistin-Resistant Strains | EPEC+ Strains | ||||||||
---|---|---|---|---|---|---|---|---|---|---|
EC11 | EC23 | EC33 | EC36 | EC59 | EC62 | EC83 | EC85 | EC15 | EC31 | |
Aminosidine | R | S | R | R | R | R | R | R | S | R |
Colistin | R | R | R | R | R | R | R | R | S | S |
Enrofloxacin | R | R | S | R | S | S | R | S | S | R |
Lincomycin and Spectomicin | S | S | S | R | I | I | R | R | S | S |
Oxytetracycline | R | R | S | R | R | R | R | I | S | R |
Thiamphenicol | R | R | I | I | R | R | I | I | S | R |
Tylmicosin | R | S | R | I | R | R | R | R | S | R |
Tylosin | R | R | R | R | R | R | R | R | R | R |
Trimethoprim | R | R | S | R | R | S | R | S | S | R |
Sulphamethoxazole | R | R | R | R | R | R | R | R | R | R |
Ampicillin | R | R | I | R | R | R | R | R | S | R |
Doxycycline | R | R | I | R | R | R | I | I | I | R |
Flumequine | R | R | I | R | R | S | R | S | S | R |
Erythromycin | R | I | R | R | R | R | R | R | I | R |
Amoxicillin | R | R | R | R | R | R | R | R | R | R |
Apramycin | R | S | R | R | R | R | R | R | S | R |
Target Genes | Primer Sequences (5′-3′) | Amplicons’ Size (bp) |
---|---|---|
stx1 | ATAAATCGCCATTCGTTGACTAC AGAACGCCCACTGAGATCATC | 188 |
stx2 | GGCACTGTCTGAAACTGCTCC TCGCCAGTTATCTGACATTCTG | 255 |
eae | GACCCGGCACAAGCATAAGC CCACCTGCAGCAACAAGAGG | 384 |
aatA | CTGGCGAAAGACTGTATCAT CAATGTATAGAAATCCGCTGTT | 630 |
ipaH | CTCGGCACGTTTTAATAGTCTGG GTGGAGAGCTGAAGTTTCTCTGC | 917 |
ltA | GGCGACAGATTATACCGTGC CGGTCTCTATATTCCCTGTT | 450 |
stA | ATTTTTMTTTCTGTATTRTCTT CACCCGGTACARGCAGGATT | 190 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Russo, N.; Stamilla, A.; Cascone, G.; Randazzo, C.L.; Messina, A.; Lanza, M.; Pino, A.; Caggia, C.; Antoci, F. The Wide Range of Antibiotic Resistance and Variability of Genotypic Profiles in Escherichia coli from Domestic Animals in Eastern Sicily. Antibiotics 2021, 10, 28. https://0-doi-org.brum.beds.ac.uk/10.3390/antibiotics10010028
Russo N, Stamilla A, Cascone G, Randazzo CL, Messina A, Lanza M, Pino A, Caggia C, Antoci F. The Wide Range of Antibiotic Resistance and Variability of Genotypic Profiles in Escherichia coli from Domestic Animals in Eastern Sicily. Antibiotics. 2021; 10(1):28. https://0-doi-org.brum.beds.ac.uk/10.3390/antibiotics10010028
Chicago/Turabian StyleRusso, Nunziatina, Alessandro Stamilla, Giuseppe Cascone, Cinzia Lucia Randazzo, Antonino Messina, Massimiliano Lanza, Alessandra Pino, Cinzia Caggia, and Francesco Antoci. 2021. "The Wide Range of Antibiotic Resistance and Variability of Genotypic Profiles in Escherichia coli from Domestic Animals in Eastern Sicily" Antibiotics 10, no. 1: 28. https://0-doi-org.brum.beds.ac.uk/10.3390/antibiotics10010028