Antimicrobial Resistance and Incidence of Integrons in Aeromonas Species Isolated from Diseased Freshwater Animals and Water Samples in Iran
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Isolation
2.2. Antibiotic Susceptibility Test
2.3. PCR Detection of Integrons
2.4. Amplification and Sequencing of Gene Cassette Regions
2.5. Statistical Analysis
3. Results
3.1. Identification of Aeromonas spp. from Different Aquatic Animals
3.2. The Antimicrobial Susceptibility of Aeromonas spp.
3.3. Detection and Characterization of Integron and Gene Cassettes
4. Discussion
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Janda, J.M.; Abbott, S.L. The genus Aeromonas: Taxonomy, pathogenicity, and infection. Clin. Microbiol. Rev. 2010, 23, 35–73. [Google Scholar] [CrossRef] [PubMed]
- Boerlin, P.; Reid-Smith, R.J. Antimicrobial resistance: Its emergence and transmission. Anim. Health Res. Rev. 2008, 9, 115–126. [Google Scholar] [CrossRef]
- Mazel, D. Integrons: Agents of bacterial evolution. Nat. Rev. Microbiol. 2006, 4, 608–620. [Google Scholar] [CrossRef] [PubMed]
- Hall, R.M. Integrons and gene cassettes: Hotspots of diversity in bacterial genomes. Ann. N. Y. Acad. Sci. 2012, 1267, 71–78. [Google Scholar] [CrossRef] [PubMed]
- Piotrowska, M.; Popowska, M. Insight into the mobilome of Aeromonas strains. Front. Microbiol. 2015, 6, 494. [Google Scholar] [CrossRef] [PubMed]
- Deng, Y.; Wu, Y.; Jiang, L.; Tan, A.; Zhang, R.; Luo, L. Multi-drug resistance mediated by class 1 integrons in Aeromonas isolated from farmed freshwater animals. Front. Microbiol. 2016, 7, 935. [Google Scholar] [CrossRef] [PubMed]
- Lin, M.; Wu, X.; Yan, Q.; Ma, Y.; Huang, L.; Qin, Y.; Xu, X. Incidence of antimicrobial-resistance genes and integrons in antibiotic-resistant bacteria isolated from eels and aquaculture ponds. Dis. Aquat. Org. 2016, 120, 115–123. [Google Scholar] [CrossRef]
- Lukkana, M.; Wongtavatchai, J.; Chuanchuen, R. Class 1 integrons in Aeromonas hydrophila isolates from farmed Nile tilapia (Oreochromis nilotica). J. Vet. Med. Sci. 2012, 74, 435–440. [Google Scholar] [CrossRef]
- Nawaz, M.; Khan, S.A.; Khan, A.A.; Sung, K.; Tran, Q.; Kerdahi, K.; Steele, R. Detection and characterization of virulence genes and integrons in Aeromonas veronii isolated from catfish. Food. Microbiol. 2010, 27, 327–331. [Google Scholar] [CrossRef]
- Ndi, O.L.; Barton, M.D. Incidence of class 1 integron and other antibiotic resistance determinants in Aeromonas spp. from rainbow trout farms in Australia. J. Fish Dis. 2011, 34, 589–599. [Google Scholar] [CrossRef]
- Sarria-Guzmán, Y.; López-Ramírez, M.P.; Chávez-Romero, Y.; Ruiz-Romero, E.; Dendooven, L.; Bello-López, J.M. Identification of antibiotic resistance cassettes in class 1 integrons in Aeromonas spp. strains isolated from fresh fish (Cyprinus carpio L.). Curr. Microbiol. 2014, 68, 581–586. [Google Scholar] [CrossRef] [PubMed]
- Jacobs, L.; Chenia, H.Y. Characterization of integrons and tetracycline resistance determinants in Aeromonas spp. isolated from South African aquaculture systems. Int. J. Food Microbiol. 2007, 114, 295–306. [Google Scholar] [CrossRef] [PubMed]
- Chenia, H.Y.; Jacobs, A. Antimicrobial resistance, heavy metal resistance and integron content in bacteria isolated from a South African tilapia aquaculture system. Dis. Aquat. Org. 2017, 126, 199–209. [Google Scholar] [CrossRef] [PubMed]
- Igbinosa, I.H.; Chigor, V.N.; Igbinosa, E.O.; Obi, L.C.; Okoh, A.I. Antibiogram, adhesive characteristics, and incidence of class 1 integron in Aeromonas species isolated from two South African rivers. Biomed. Res. Int. 2013, 2013, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Ranjbar, R.; Aleo, A.; Giammanco, G.M.; Dionisi, A.M.; Sadeghifard, N.; Mammina, C. Genetic relatedness among isolates of Shigella sonnei carrying class 2 integrons in Tehran, Iran, 2002–2003. BMC Infect. Dis. 2007, 7, 62. [Google Scholar] [CrossRef]
- Ranjbar, R.; Farshad, S.; Rahbar, M.; Safiri, Z.; Mammina, C.; Arjomanzadegan, M. Occurrence of class 2 integrons among multi-drug resistant Shigella sonnei isolated from Tehran, Iran in 2005. Arch. Clin. Infect. Dis. 2010, 5, 156–160. [Google Scholar]
- Ranjbar, R.; Giammanco, G.M.; Farshad, S.; Owlia, P.; Aleo, A.; Mammina, C. Serotypes, antibiotic resistance, and class 1 integrons in Salmonella isolates from pediatric cases of enteritis in Tehran, Iran. Foodborne Pathog. Dis. 2011, 8, 547–553. [Google Scholar] [CrossRef]
- Tajbakhsh, E.; Khamesipour, F.; Ranjbar, R.; Ugwu, I.C. Prevalence of class 1 and 2 integrons in multi-drug resistant Escherichia coli isolated from aquaculture water in Chaharmahal Va Bakhtiari province, Iran. Ann. Clin. Microbiol. Antimicrob. 2015, 14, 37. [Google Scholar] [CrossRef] [PubMed]
- Ranjbar, R.; Zeynali, M.; Sohrabi, N.; Kamboh, A.A.; Moshaveri, A. Antibiotic resistance and prevalence of class 1 and 2 integrons in Escherichia coli isolated from hospital wastewater. Univ. Med. 2018, 37, 209–215. [Google Scholar] [CrossRef]
- Ranjbar, R.; Taghipour, F.; Afshar, D.; Farshad, F. Distribution of Class 1 and 2 Integrons Among Salmonella Enterica Serovars Isolated from Iranian Patients. Open Microbiol. J. 2019, 13, 63–66. [Google Scholar] [CrossRef]
- Modarres Mousavi Behbahani, S.M.; Akhlaghi, M.; Sharifiyazdi, H. Phenotypic and genetic diversity of motile aeromonads isolated from diseased fish and fish farms. Iran. J. Vet. Res. 2014, 15, 238–243. [Google Scholar]
- Dorsch, M.; Ashbolt, N.J.; Cox, P.T.; Goodman, A.E. Rapid identification of Aeromonas species using 16S rDNA targeted oligonucleotide primers: A molecular approach based on screening of environmental isolates. J. Appl. Bacteriol. 1994, 77, 722–726. [Google Scholar] [CrossRef]
- Orozova, P.; Barker, M.; Austin, D.A.; Austin, B. Identification and pathogenicity to rainbow trout, Oncorhynchus mykiss (Walbaum), of some aeromonads. J. Fish Dis. 2009, 32, 865–871. [Google Scholar] [CrossRef] [PubMed]
- Sen, K. Development of a rapid identification method for Aeromonas species by multiplex-PCR. Can. J. Microbiol. 2005, 51, 957–966. [Google Scholar] [CrossRef] [PubMed]
- Xia, C.; Ma, Z.H.; Rahman, M.H.; Wu, Z.G. PCR cloning and identification of the β-haemolysin gene of Aeromonas hydrophila from freshwater fishes in China. Aquaculture 2004, 229, 45–53. [Google Scholar] [CrossRef]
- Su, J.; Shi, L.; Yang, L.; Xiao, Z.; Li, X.; Yamasaki, S. Analysis of integrons in clinical isolates of Escherichia coli in China during the last six years. FEMS. Microbiol. Lett. 2006, 254, 75–80. [Google Scholar] [CrossRef]
- Zhang, H.; Shi, L.; Li, L.; Guo, S.; Zhang, X.; Yamasaki, S.; Miyoshi, S.I.; Shinoda, S. Identification and characterization of class 1 integron resistance gene cassettes among Salmonella strains isolated from healthy humans in China. Micribiol. Immunol. 2004, 48, 639–645. [Google Scholar] [CrossRef]
- Wayne, P.A. Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria that Grow Aerobically: Approved Standard; Clinical and Laboratory Standard Institute: Wayne, PA, USA, 2006. [Google Scholar]
- Holmes, D.S.; Quigley, M. A rapid boiling method for the preparation of bacterial plasmids. Anal. Biochem. 1981, 114, 193–197. [Google Scholar] [CrossRef]
- Kadlec, K.; von Czapiewski, E.; Kaspar, H.; Wallmann, J.; Michael, G.B.; Steinacker, U.; Schwarz, S. Molecular basis of sulfonamide and trimethoprim resistance in fish-pathogenic Aeromonas isolates. Appl. Environ. Microbiol. 2011, 77, 7147–7150. [Google Scholar] [CrossRef]
- Moura, A.; Pereira, C.; Henriques, I.; Correia, A. Novel gene cassettes and integrons in antibiotic-resistant bacteria isolated from urban wastewaters. Res. Microbiol. 2012, 163, 92–100. [Google Scholar] [CrossRef]
- Lee, M.F.; Peng, C.F.; Lin, Y.H.; Lin, S.R.; Chen, Y.H. Molecular diversity of class 1 integrons in human isolates of Aeromonas spp. from southern Taiwan. Jpn. J. Infect. Dis. 2008, 61, 343–349. [Google Scholar] [PubMed]
Target Gene | Primer Sequence 5’→3’ | Size | Reference |
---|---|---|---|
16S rDNA | AGAGTTTGATCCTGGCTCAG ACGGCTACCTTGTTACGACTT | 1500 | [22] |
16S rDNA | GAAAGGTTGATGCCTAATACGTA CGTGCTGGCAACAAAGGACAG | 685 | [23] |
Elastase | ACACGGTCAAGGAGATCAAC CGCTGGTGTTGGCCAGCAGG | 540 | [24] |
Lipase | ATCTTCTCCGACTGGTTCGG CCGTGCCAGGACTGGGTCTT | 383 | [24] |
Aerolysin | CAAGGAGGTCTGTGGCGACA TTTCACCGGTAGCAGGATTG | 209 | [25] |
intI1 | ACGAGCGCAAGGTTTCGGT GAAAGGTCTGGTCATACATG | 565 | [26] |
intI2 | GTGCAACGCATTTTGCAGG CAACGGAGTCATGCAGATG | 403 | [26] |
Gene cassette(s) of class 1 integron | GGCATACAAGCAGCAAGC AAGCAGACTTGACCTGAT | Variable | [27] |
Aeromonas spp. | Sources | |||||
---|---|---|---|---|---|---|
Carp | Rainbow Trout | Sturgeon | Aquarium Fish | Crayfish | Water Samples | |
A. hydrophila (n = 49) | 28 | 1 | 16 | 2 | 2 | - |
A. veronii bv. sobria (n = 14) | 4 | 2 | - | 2 | - | 6 |
A. bestiarum/piscicola (n = 5) | 4 | - | - | 1 | - | - |
A. media (n = 4) | 1 | 2 | - | - | - | 1 |
A. jandaei (n = 1) | - | - | - | 1 | - | - |
A. aquariorum (n = 1) | - | - | - | - | - | 1 |
Aeromonas spp. (Numbers) | Fish Species/Water Sample | Cassette Size (kbp) | Gene Cassettes | Resistance Phenotype |
---|---|---|---|---|
A. hydrophila (2) | Sturgeon | 1.0 | dfrA12-aadA2 | SXT, V, AMP, RD, NOR, OFL, TE, CIP |
A. hydrophila (2) | Sturgeon | 1.8 | dfrA12-orfF-aadA2 | SXT, V, AMP, RD, NOR, TE, CIP, DO, C |
A. hydrophila (1) | Sturgeon | 2.3 | aac(6’)-Ib-cr-arr3-dfrA27 | SXT, V AMP, RD |
A. hydrophila (1) | Crayfish | 2.0 | dfrB4-catB3-aadA1 | SXT, AMP, RD, TE, S, G, C |
A. veronii bv. sobria (1) | Rainbow trout | 2.3 | aac(6’)-Ib-cr-arr3-dfrA27 | STX, V, RD, TE, CIP S, G |
A. veronii bv. sobria (1) | Water sample | 0.7 | dfrA15 | STX, V, AMP, TE, |
A. media (2) | Rainbow trout | 1.7 | dfrA1-aadA1 | STX, V, RD, TE, DO, C |
A. aquariorum (1) | Water sample | 1.5 | dfrA1-orfC | STX, V, AMP, RD, TE, DO, C |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ranjbar, R.; Salighehzadeh, R.; Sharifiyazdi, H. Antimicrobial Resistance and Incidence of Integrons in Aeromonas Species Isolated from Diseased Freshwater Animals and Water Samples in Iran. Antibiotics 2019, 8, 198. https://0-doi-org.brum.beds.ac.uk/10.3390/antibiotics8040198
Ranjbar R, Salighehzadeh R, Sharifiyazdi H. Antimicrobial Resistance and Incidence of Integrons in Aeromonas Species Isolated from Diseased Freshwater Animals and Water Samples in Iran. Antibiotics. 2019; 8(4):198. https://0-doi-org.brum.beds.ac.uk/10.3390/antibiotics8040198
Chicago/Turabian StyleRanjbar, Reza, Reza Salighehzadeh, and Hassan Sharifiyazdi. 2019. "Antimicrobial Resistance and Incidence of Integrons in Aeromonas Species Isolated from Diseased Freshwater Animals and Water Samples in Iran" Antibiotics 8, no. 4: 198. https://0-doi-org.brum.beds.ac.uk/10.3390/antibiotics8040198