Analysis of Vancomycin-Resistant Enterococci in Hemato-Oncological Patients
Abstract
:1. Introduction
2. Results
3. Discussion
4. Materials and Methods
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Kolář, M. Vancomycin-resistant enterococci. Klin. Mikrobiol. Infekc. Lek. 2018, 24, 50–56. [Google Scholar]
- Sievert, D.M.; Ricks, P.; Edwards, J.R.; Schneider, A.; Patel, J.; Srinivasan, A.; Kallen, A.; Limbago, B.; Fridkin, S.; National Healthcare Safety Network (NHSN) Team and Participating NHSN Facilities. Antimicrobial-resistant pathogens associated with healthcare-associated infections: Summary of data reported to the National Healthcare Safety Network at the Centers for Disease Control and Prevention, 2009–2010. Infect. Control Hosp. Epidemiol. 2013, 34, 1–14. [Google Scholar] [CrossRef]
- Michael, K.E.; No, D.; Roberts, M.C. VanA-positive multi-drug-resistant Enterococcus spp. isolated from surfaces of a US hospital laundry facility. J. Hosp. Infect. 2017, 95, 218–223. [Google Scholar] [CrossRef]
- Kolář, M.; Heinigeová, B.; Bartoníková, N.; Čermák, P.; Burgetová, D.; Dorníková, G.; Dovalová, M.; Frýbortová, V.; Horová, E.; Chmelařová, E.; et al. Gram-positive pathogens in bloodstream infections—A multicenter study. Klin. Mikrobiol. Inf. Lek. 2003, 9, 244–252. [Google Scholar]
- Herkel, T.; Uvizl, R.; Doubravska, L.; Adamus, M.; Gabrhelik, T.; Htoutou Sedlakova, M.; Kolar, M.; Hanulik, V.; Pudova, V.; Langova, K.; et al. Epidemiology of hospital-acquired pneumonia: Results of a Central European multicenter, prospective, observational study compared with data from the European region. Biomed. Pap. Med. Fac. Univ. Palacky Olomouc Czech Repub. 2016, 160, 448–455. [Google Scholar] [CrossRef]
- Pudová, V.; Htoutou Sedláková, M.; Kolář, M.; Working Group. Clonality of bacterial pathogens causing hospital-acquired pneumonia. Curr. Microbiol. 2016, 73, 312–316. [Google Scholar] [CrossRef]
- Arias, C.A.; Murray, B.E. The rise of the Enterococcus: Beyond vancomycin resistance. Nat. Rev. Microbiol 2012, 10, 266–278. [Google Scholar] [CrossRef] [Green Version]
- Arthur, M.; Reynolds, P.E.; Depardieu, F.; Evers, S.; Dutka-Malen, S.; Quintiliani, R., Jr.; Courvalin, P. Mechanisms of glycopeptide resistance in enterococci. J. Infect. 1996, 32, 11–16. [Google Scholar] [CrossRef]
- Murray, B.E. Vancomycin-resistant enterococci. Am. J. Med. 1997, 102, 284–293. [Google Scholar] [CrossRef]
- Reynolds, P.E.; Courvalin, P. Vancomycin resistance in enterococci due to synthesis of precursors terminating in D-alanyl-D-serine. Antimicrob. Agents Chemother. 2005, 49, 21–25. [Google Scholar] [CrossRef] [Green Version]
- Courvalin, P. Vancomycin resistance in gram-positive cocci. Clin. Infect. Dis. 2006, 42 (Suppl. S1), S25–S34. [Google Scholar] [CrossRef]
- Uttley, A.H.; Collins, C.H.; Naidoo, J.; George, R.C. Vancomycin-resistant enterococci. Lancet 1988, 1, 57–58. [Google Scholar] [CrossRef]
- Kolář, M.; Vágnerová, I.; Kohnová, I. Detection of vancomycin-resistant enterococci in Teaching Hospital, Olomouc. Klin. Mikrobiol. Inf. Lek. 1997, 3, 189–191. [Google Scholar]
- Kolar, M.; Htoutou Sedlakova, M.; Pudova, V.; Roderova, M.; Novosad, J.; Senkyrikova, M.; Szotkowska, R.; Indrak, K. Incidence of fecal Enterobacteriaceae producing broad-spectrum beta-lactamases in patients with hematological malignancies. Biomed. Pap. Med. Fac. Univ. Palacky Olomouc Czech Repub. 2015, 159, 100–103. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Heath, C.H.; Blackmore, T.K.; Gordon, D.L. Emerging resistance in Enterococcus spp. Med. J. Aust. 1996, 164, 116–120. [Google Scholar] [CrossRef]
- Weber, D.J.; Rutala, W.A. Role of environmental contamination in the transmission of vancomycin-resistant enterococci. Infect. Control Hosp. Epidemiol. 1997, 18, 306–309. [Google Scholar] [CrossRef] [PubMed]
- Jordens, J.Z.; Bates, J.; Griffiths, D.T. Faecal carriage and nosocomial spread of vancomycin-resistant Enterococcus faecium. J. Antimicrob. Chemother. 1994, 34, 515–528. [Google Scholar] [CrossRef]
- Heisel, R.W.; Sutton, R.R.; Mascara, G.P.; Winger, D.G.; Weber, D.R.; Lim, S.H.; Oleksiuk, L.M. Vancomycin-resistant enterococci in acute myeloid leukemia and myelodysplastic syndrome patients undergoing induction chemotherapy with idarubicin and cytarabine. Leuk. Lymphoma 2017, 58, 2565–2572. [Google Scholar] [CrossRef]
- Kolar, M.; Pantucek, R.; Vagnerova, I.; Kesselova, M.; Sauer, P.; Matouskova, I.; Doskar, J.; Koukalova, D.; Hejnar, P. Genotypic characterisation of vancomycin-resistant Enterococcus faecium isolates from haemato-oncological patients at Olomouc University Hospital, Czech Republic. Clin. Microbiol. Infect. 2006, 12, 353–360. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Paterson, D.L.; Muto, C.A.; Ndirangu, M.; Linden, P.K.; Potoski, B.A.; Capitano, B.; Bonomo, R.A.; Aron, D.C.; Donskey, C.J. Acquisition of rectal colonization by vancomycin-resistant Enterococcus among intensive care unit patients treated with piperacillin-tazobactam versus those receiving cefepime-containing antibiotic regimens. Antimicrob. Agents Chemother. 2008, 52, 465–469. [Google Scholar] [CrossRef] [Green Version]
- European Antimicrobial Resistance Surveillance Network (EARS-Net). Available online: https://ecdc.europa.eu/en/about-us/partnerships-and-networks/disease-and-laboratory-networks/ears-net (accessed on 6 August 2019).
- European Centre for Disease Prevention and Control (ECDC) Antimicrobial Resistance Surveillance in Europe 2015. Available online: https://ecdc.europa.eu/en/publications-data/antimicrobial-resistance-surveillance-europe-2015 (accessed on 6 August 2019).
- European Centre for Disease Prevention and Control. Antimicrobial Resistance Surveillance in Europe 2016. Available online: https://ecdc.europa.eu/en/publications-data/antimicrobial-resistance-surveillance-europe-2016 (accessed on 6 August 2019).
- European Centre for Disease Prevention and Control. Antimicrobial Resistance Surveillance in Europe 2017. Available online: https://ecdc.europa.eu/sites/portal/files/documents/EARS-Net-report-2017-update-jan-2019.pdf (accessed on 6 August 2019).
- Kolar, M.; Pantucek, R.; Vagnerova, I.; Sauer, P.; Kesselova, M.; Cekanova, L.; Koukalova, D.; Doskar, J.; Ruzickova, V. Prevalence of vancomycin-resistant enterococci in hospitalized patients and those living in the community in the Czech Republic. New Microbiol. 2006, 29, 121–125. [Google Scholar]
- AbdelKhalek, A.; Abutaleb, N.S.; Mohammad, H.; Seleem, M.N. Repurposing ebselen for decolonization of vancomycin-resistant enterococci (VRE). PLoS ONE 2018, 13, e0199710. [Google Scholar] [CrossRef] [Green Version]
- Yang, J.X.; Li, T.; Ning, Y.Z.; Shao, D.H.; Liu, J.; Wang, S.Q.; Liang, G.W. Molecular characterization of resistance, virulence and clonality in vancomycin-resistant Enterococcus faecium and Enterococcus faecalis: A hospital-based study in Beijing, China. Infect. Genet. Evol. 2015, 33, 253–260. [Google Scholar] [CrossRef] [PubMed]
- Alevizakos, M.; Gaitanidis, A.; Nasioudis, D.; Tori, K.; Flokas, M.E.; Mylonakis, E. Colonization with vancomycin-resistant enterococci and risk for bloodstream infection among patients with malignancy: A systematic review and meta-analysis. Open Forum Infect. Dis. 2016, 4, ofw246. [Google Scholar] [CrossRef] [Green Version]
- Ballo, O.; Tarazzit, I.; Stratmann, J.; Reinheimer, C.; Hogardt, M.; Wichelhaus, T.A.; Kempf, V.; Serve, H.; Finkelmeier, F.; Brandts, C. Colonization with multidrug resistant organisms determines the clinical course of patients with acute myeloid leukemia undergoing intensive induction chemotherapy. PLoS ONE 2019, 14, e0210991. [Google Scholar] [CrossRef]
- Weber, S.; Hogardt, M.; Reinheimer, C.; Wichelhaus, T.A.; Kempf, V.; Kessel, J.; Wolf, S.; Serve, H.; Steffen, B.; Scheich, S. Bloodstream infections with vancomycin-resistant enterococci are associated with a decreased survival in patients with hematological diseases. Ann. Hematol 2019, 98, 763–773. [Google Scholar] [CrossRef] [PubMed]
- Mantey, J.; Min, L.; Cassone, M.; Gibson, K.E.; Mody, L. Changing dynamics of colonization in nursing facility patients over time: Reduction in methicillin-resistant Staphylococcus aureus (MRSA) offset by increase in vancomycin-resistant Enterococcus (VRE) prevalence. Infect. Control Hosp. Epidemiol. 2019, 40, 1069–1070. [Google Scholar] [CrossRef] [PubMed]
- Talaga, K.; Odrowąż-Konduracka, D.; Paradowska, B.; Jagiencarz-Starzec, B.; Wolak, Z.; Bulanda, M.; Szcypta, A. Typing of Enterococcus spp. strains in 4 hospitals in the Małopolska region in Poland. Adv. Clin. Exp. Med. 2018, 27, 111–117. [Google Scholar] [CrossRef] [Green Version]
- Jovanović, M.; Tošić, T.; Jovanović, S.; Stošović, R.; Stevanović, G.; Velebit, B.; Zervos, M.J. Presence of the esp gene in Enterococcus faecium derived from oropharyngeal microbiota of haematology patients. Arch. Oral Biol. 2018, 88, 54–59. [Google Scholar] [CrossRef]
- Vu, J.; Carvalho, J. Enterococcus: Review of its physiology, pathogenesis, diseases and the challenges it poses for clinical microbiology. Front. Biol. 2011, 6, 357–366. [Google Scholar] [CrossRef]
- Farahani, A. State of globe: Enterococci: Virulence factors and biofilm formation. J. Glob. Infect. Dis. 2016, 8, 1–2. [Google Scholar] [CrossRef]
- Marchi, A.P.; Perdigão Neto, L.V.; Martins, R.C.R.; Rizek, C.F.; Camargo, C.H.; Moreno, L.Z.; Moreno, A.M.; Batista, M.V.; Basqueira, M.S.; Rossi, F.; et al. Vancomycin-resistant enterococci isolates colonizing and infecting haematology patients: Clonality, and virulence and resistance profile. J. Hosp. Infect. 2018, 99, 346–355. [Google Scholar] [CrossRef] [PubMed]
- Ochoa, S.A.; Escalona, G.; Cruz-Córdova, A.; Dávila, L.B.; Saldaña, Z.; Cázares-Domímguez, V.; Eslava, C.A.; López-Martínez, B.; Hernández-Castro, R.; Aquino-Jarquin, G.; et al. Molecular analysis and distribution of multidrug-resistant Enterococcus faecium isolates belonging to clonal complex 17 in a tertiary care center in Mexico City. BMC Microbiol. 2013, 13, 291. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ryan, L.; O’Mahony, E.; Wrenn, C.; FitzGerald, S.; Fox, U.; Boyle, B.; Schaffer, K.; Werner, G.; Klare, I. Epidemiology and molecular typing of VRE bloodstream isolates in an Irish tertiary care hospital. J. Antimicrob. Chemother. 2015, 70, 2718–2724. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gozalan, A.; Coskun-Ari, F.F.; Ozdem, B.; Unaldi, O.; Celikbilek, N.; Kirca, F.; Aydogan, S.; Muderris, T.; Guven, T.; Acikgoz, Z.C.; et al. Molecular characterization of vancomycin-resistant Enterococcus faecium strains isolated from carriage and clinical samples in a tertiary hospital, Turkey. J. Med. Microbiol. 2015, 64, 759–766. [Google Scholar] [CrossRef]
- Bressan, R.; Knezevich, A.; Monticelli, J.; Campanile, F.; Busetti, M.; Santagati, M.; Dolzani, L.; Milan, A.; Bongiorno, D.; Di Santolo, M.; et al. Spread of vancomycin-resistant Enterococcus faecium isolates despite validated infection control measures in an Italian hospital: Antibiotic resistance and genotypic characterization of the endemic strain. Microb. Drug Resist. 2018, 24, 1148–1155. [Google Scholar] [CrossRef]
- Noble, M.A.; Isaac-Renton, J.L.; Bryce, E.A.; Roscoe, D.L.; Roberts, F.J.; Walker, M.; Scharf, S.; Walsh, A.; Altamirano-Dimas, M.; Gribble, M. The toilet as a transmission vector of vancomycin-resistant enterococci. J. Hosp. Infect. 1998, 40, 237–241. [Google Scholar] [CrossRef]
- The European Committee on Antimicrobial Susceptibility Testing—EUCAST 2018. Available online: http://www.eucast.org/ (accessed on 6 August 2019).
- Dutka-Malen, S.; Evers, S.; Courvalin, P. Detection of glycopeptide resistance genotypes and identification to the species level of clinically relevant enterococci by PCR [published correction appears in J Clin Microbiol. 1995 May;33:1434]. J. Clin. Microbiol. 1995, 33, 24–27. [Google Scholar] [CrossRef] [Green Version]
- Vankerckhoven, V.; Van Autgaerden, T.; Vael, C.; Lammens, C.; Chapelle, S.; Rossi, R.; Jabes, D.; Goossens, H. Development of a multiplex PCR for the detection of asa1, gelE, cylA, esp, and hyl genes in enterococci and survey for virulence determinants among European hospital isolates of Enterococcus faecium. J. Clin. Microbiol. 2004, 42, 4473–4479. [Google Scholar] [CrossRef] [Green Version]
- Pantůček, R.; Götz, F.; Doskar, J.; Rosypal, S. Genomic variability of Staphylococcus aureus and the other coagulase-positive Staphylococcus species estimated by macrorestriction analysis using pulsed-field gel electrophoresis. Int. J. Syst. Bacteriol. 1996, 46, 216–222. [Google Scholar] [CrossRef] [Green Version]
- Tenover, F.C.; Arbeit, R.D.; Goering, R.V.; Mickelsen, P.A.; Murray, B.E.; Persing, D.H.; Swaminathan, B. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: Criteria for bacterial strain typing. J. Clin. Microbiol. 1995, 33, 2233–2239. [Google Scholar] [CrossRef] [Green Version]
Year/Antibiotic | AMP | TIG | TET | TEI | FUR | LNZ |
---|---|---|---|---|---|---|
2016 | 0 | 100 | 71 | 0 | 100 | 100 |
2017 | 0 | 88 | 43 | 0 | 84 | 100 |
2018 | 0 | 100 | 35 | 0 | 48 | 100 |
2016–2018 | 0 | 96 | 48 | 0 | 76 | 100 |
Gene | Sequence (5′→3′) | Size (bp) | Reference |
---|---|---|---|
van Genes | |||
vanA | GGGAAAACGACAATTGC | 732 | [42] |
GTACAATGCGGCCGTTA | |||
vanB | ATGGGAAGCCGATAGTC | 635 | |
GATTTCGTTCCTCGACC | |||
vanC-1 | GGTATCAAGGAAACCTC | 822 | |
CTTCCGCCATCATAGCT | |||
vanC2-C3 | CTCCTACGATTCTCTTG | 439 | |
CGAGCAAGACCTTTAAG | |||
Virulence Factor Genes | |||
asa1 | GCACGCTATTACGAACTATGA | 375 | [43] |
TAAGAAAGAACATCACCACGA | |||
gelE | TATGACAATGCTTTTTGGGAT | 213 | |
AGATGCACCCGAAATAATATA | |||
cylA | ACTCGGGGATTGATAGGC | 688 | |
GCTGCTAAAGCTGCGCTT | |||
esp | AGATTTCATCTTTGATTCTTGG | 510 | |
AATTGATTCTTTAGCATCTGG | |||
hyl | ACAGAAGAGCTGCAGGAAATG | 276 | |
GACTGACGTCCAAGTTTCCAA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hricová, K.; Štosová, T.; Kučová, P.; Fišerová, K.; Bardoň, J.; Kolář, M. Analysis of Vancomycin-Resistant Enterococci in Hemato-Oncological Patients. Antibiotics 2020, 9, 785. https://0-doi-org.brum.beds.ac.uk/10.3390/antibiotics9110785
Hricová K, Štosová T, Kučová P, Fišerová K, Bardoň J, Kolář M. Analysis of Vancomycin-Resistant Enterococci in Hemato-Oncological Patients. Antibiotics. 2020; 9(11):785. https://0-doi-org.brum.beds.ac.uk/10.3390/antibiotics9110785
Chicago/Turabian StyleHricová, Kristýna, Taťána Štosová, Pavla Kučová, Kateřina Fišerová, Jan Bardoň, and Milan Kolář. 2020. "Analysis of Vancomycin-Resistant Enterococci in Hemato-Oncological Patients" Antibiotics 9, no. 11: 785. https://0-doi-org.brum.beds.ac.uk/10.3390/antibiotics9110785