Next Article in Journal
In Vitro Activity of Pentamidine Alone and in Combination with Antibiotics against Multidrug-Resistant Clinical Pseudomonas aeruginosa Strains
Next Article in Special Issue
Detection of Various Streptococcus spp. and Their Antimicrobial Resistance Patterns in Clinical Specimens from Austrian Swine Stocks
Previous Article in Journal
Last Call for Replacement of Antimicrobials in Animal Production: Modern Challenges, Opportunities, and Potential Solutions
Previous Article in Special Issue
In Vitro Activity of Dalbavancin against Refractory Multidrug-Resistant (MDR) Staphylococcus aureus Isolates
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antibiotics
Volume 9
Issue 12
10.3390/antibiotics9120884
antibiotics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Monitoring of Non-β-Lactam Antibiotic Resistance-Associated Genes in ESBL Producing Enterobacterales Isolates

by
Pottathil Shinu
1,*,
Rajesh Bareja
2,
Anroop B. Nair
3,
Vashishth Mishra
2,
Snawar Hussain
1,
Katharigatta N. Venugopala
3,4,
Nagaraja Sreeharsha
3,5,
Mahesh Attimarad
3 and
Sahibzada Tasleem Rasool
1
1
Department of Biomedical Sciences, College of Clinical Pharmacy, King Faisal University, Al-Ahsa 31982, Saudi Arabia
2
Department of Microbiology, Faculty of Medicine, Government Medical College and Hospital, Badaun 243601, India
3
Department of Pharmaceutical Sciences, College of Clinical Pharmacy, King Faisal University, Al-Ahsa 31982, Saudi Arabia
4
Department of Biotechnology and Food Technology, Durban University of Technology, Durban 4001, South Africa
5
Department of Pharmaceutics, Vidya Siri College of Pharmacy, Off Sarjapura Road, Bangaluru 560035, India
*
Author to whom correspondence should be addressed.
Antibiotics 2020, 9(12), 884; https://0-doi-org.brum.beds.ac.uk/10.3390/antibiotics9120884
Submission received: 28 October 2020 / Revised: 7 December 2020 / Accepted: 8 December 2020 / Published: 9 December 2020
(This article belongs to the Special Issue Antimicrobial Resistance: The Final Frontier)
Versions Notes

Abstract

:
Genetic context of extended spectrum β-Lactamase (ESBL) producing Enterobacterales and its association with plasmid mediated quinolone resistance (PMQR), aminoglycoside modifying enzymes (AME) and Trimethoprim/Sulfamethoxazole (TMP-SMX) resistance is little known from North India. Therefore, the current study was aimed to investigate the frequency of Non-β-Lactam antibiotic resistance associated genes in extended spectrum β-Lactamase producing Enterobacterales. For this study, Non-Duplicate phenotypically confirmed ESBL producing Enterobacterales isolates (N = 186) were analyzed for ESBLs, PMQRs, AMEs and TMP-SMX resistance genes using polymerase chain reaction (PCR). PCR detected presence of PMQR genes in 81.29% (N = 139) of ESBL isolates (N = 171), AME genes in 60.82% and TMP-SMX resistance genes in 63.74% of the isolates. Molecular characterization of ESBL producing Enterobacterales showed 84.79% blaTEM followed by 73.68% blaCTX-M, 43.86% blaSHV, 19.88% blaPER and 9.94% blaVEB, respectively. Analysis of PMQR genes revealed 77.7% aac(6′)-lb-cr the most commonly detected gene followed by 67.63% oqxB, 62.59% oqxA, 43.17% qnrB, 19.42% qnrD, 18.7% qnrS, 9.35% qnrA, 3.6% qepA and 2.88% qnrC, respectively. Analysis of AMEs gene profile demonstrated 81.73% aac(6′)-Ib, the most frequently encountered gene followed by 46.15% aph(3′)-Ia, 44.23% ant(3”)-Ia, respectively. A 100% prevalence of sul1, followed by dfrA (54.63%) and sul2 (15.74%) was observed. In summary, prevalence of ESBL-Producing genes (particularly blaTEM and blaCTX-M) along with PMQR, AMEs, and TMP-SMX resistant genes may potentially aid in the transfer of antimicrobial resistance among these strains.

1. Introduction

β-Lactam antibiotics are used for treating most of the human infections that are caused by Gram-negative bacteria belonging to the family Enterobacterales [1]. However, the use of β-Lactam antibiotics is challenging due to the emergence of various antimicrobial resistance (AMR) mechanisms particularly the presence of extended-spectrum β-lactamases (ESBLs) [2]. ESBLs are considered the most extensively encountered AMR mechanisms prevalent in Enterobacterales and other clinically significant Gram-negative bacteria [1,2]. Genes coding for ESBLs production are often located on plasmids that also carry genes coding for resistance to fluoroquinolones, aminoglycosides, trimethoprim- sulfamethoxazole (TMP-SMX) [1]. Further, a high level of fluoroquinolone resistance was reported among ESBLs producing Enterobacterales [2,3]. Chromosomal mutations and plasmid-mediated quinolone resistance (PMQR) are considered the most relevant mechanisms of fluoroquinolone resistance among Enterobacterales [4,5]. Generally, PMQR determinants produce low-level of quinolone resistance, however, reports reveal that the presence of PMQR determinants may enhance the degree of chromosomal mediated quinolone resistance if present in the same strain [3,6,7,8]. PMQRs are mainly categorized into three groups; (i) quinolone resistance (qnr) gene mediated (ii) quinolones modifying aminoglycoside acetyltransferase encoding genes (aac(6′)-Ib-c), (iii) plasmid-mediated quinolone efflux pumps qepA, oqxA, and oqxB [6].
Literature indicates that synthesis of aminoglycoside modifying enzymes (AMEs) is an important AMR mechanism that produce high level of aminoglycoside resistance among Gram- negative bacteria [9,10]. These AMEs are grouped into three categories: (i) aminoglycoside N-acetyltransferases (AACs), (ii) aminoglycoside O-phosphotransferases (APHs), and (iii) aminoglycoside O-nucleotidyltransferases (ANTs) [10]. Further, the structural genes coding for AMEs are often located on plasmids that carry multiple resistance elements for ESBLs [11,12]. This type of association between ESBL and AMEs coding genes are of foremost apprehension in the treatment of bacterial infections. Besides resistance to β-lactams, fluoroquinolones, and aminoglycosides, members of Enterobacterales demonstrate resistance to TMP-SMX as well. However, little has been reported on the genetic context of various species of ESBL producing Enterobacterales and its association with, PMQR, AMEs TMP-SMX resistance exclusively from North India. Therefore, the current study was designed to analyze the distribution of non-β-lactam antibiotic resistance associated genes prevailing in ESBL producing Enterobacterales. To our knowledge, this is the first study that investigated the distribution of AME, PMQR and TMP-SMX resistance genes among ESBL producing Enterobacterales that are isolated from North India. Furthermore, this study included clinical isolates of different members of Enterobacterales (Escherichia coli, Klebsiella pneumonia, Citrobacter freundii, Klebsiella oxytoca, Morganella morganii Proteus mirabilis, Proteus vulgaris, and Enterobacter cloacae), while the earlier studies limited their molecular characterization in two species (E. coli and K. pneumoniae) [8,10,13]. In addition, this study explores prevalence of TMP-SMX resistance genes among ESBL producing clinical Enterobacterales, an observation that has been made only a few times earlier.

2. Results

Among the total phenotypically confirmed ESBL isolates (N = 186) obtained, K. pneumoniae 16.13% (30/186), E. coli 9.67% (18/186), K. oxytoca 2.15% (4/186), P. mirabilis 1.61% (3/186) and P. vulgaris 0.53% (1/186) were resistant to all the antibiotics tested. Table 1 shows distribution of antibiotic susceptibility pattern of various antibiotics tested against different strains of Enterobacterales. The highest antibiotic resistance rate was noted for ampicillin 95.89% (70/73) followed by TMP-SMX 90.86% (169/186). The resistance rate of β-lactams were: cefazolin 94.08% (175/186), amoxicillin-clavulanic acid 77% (124/161), cefotaxime 82.8% (154/186), cefepime 66.67% (124/186), ceftazidime 89.78% (164/186), ceftriaxone 88.17% (164/186), cefoxitin 76.83% (126/164), cefpodoxime 86.11% (155/180), cefuroxime 86.02% (160/186), and ceftizoxime 83.3% (155/186), respectively. The resistance rate of fluoroquinolones were 75.27% (140/186), 69.89% (130/186), 76.88% (143/186), 75.27% (140/186), and 71.51% (133/186) for ciprofloxacin, levofloxacin, nalidixic acid, gatifloxacin, and moxifloxacin, respectively. Similarly, the resistance rate of aminoglycosides were 64% (119/186), 61% (114/186), 49% (91/186), and 59% (109/186) for gentamycin, tobramycin, amikacin, and kanamycin, respectively. The lowest resistance rates were associated with imipenem 43.01% (80/186) and meropenem 46.77% (87/186), respectively (Table 2 and Supplementary Materials Table S1).
Table 3 demonstrates distribution of PMQR, AME, and TMP-SMX resistance genes in Enterobacterales. Among the total phenotypically confirmed ESBL isolates (N = 186), PCR confirmed presence of ESBL genes (blaCTX-M, blaTEM, blaSHV, blaPER and blaVEB) in 91.94% (171/186) of Enterobacterales isolates. However, genes coding for ESBL production were not detected from K. pneumoniae 2.69% (5/186), E. coli 2.69% (5/186), K. oxytoca 1.07% (2/186), P. mirabilis 1.07% (2/186), C. freundii 0.54% (1/186) and therefore, these isolates were not included for further analysis. ESBL genes were detected from pus (N = 97), respiratory tract specimens (N = 44), blood and body fluids (N = 30), respectively (Supplementary Materials Table S2). The detected ESBL genes (91.94%) were distributed in different members of Enterobacterales as follows; K. pneumoniae 40.35% (69/171), E. coli 30.99% (53/171), P. mirabilis 7.6% (13/171), C. freundii 7.02% (12/171), K. oxytoca 5.2% (9/171), E. cloacae 5.2% (9/171), P. vulgaris 1.75% (3/171), and M. morganii 1.75% (3/171), respectively. Of the 91.94% (N = 171) genotypically confirmed isolates, blaTEM 84.79% (145/171) was the most common ESBL gene followed by blaCTX-M 73.68% (126/171), blaSHV 43.86% (75/171), blaPER 19.88% (34/171) and blaVEB 9.94% (17/171), respectively.
Among the total phenotypically confirmed ESBL isolates (N = 186), 81.72% (152/186), 70.43% (131/186), and 90.32% (168/186), were resistant to fluoroquinolones, aminoglycosides and TMP-SMX, respectively. Out of the 91.94% (171/186) of the genotypically confirmed ESBL strains, PCR could detect 81.29% (PMQR), 60.82% (AME), 63.74% (TMP-SMX) of genes in these strains. Of the total PMQR genes (81.29%) detected, the distribution of genes in different members of Enterobacterales (N = 139) as follows; K. pneumoniae 44.6% (62/139), E. coli 31.65% (44/139), P. mirabilis 8.63% (12/139), C. freundii 5.03% (7/139), K. oxytoca 5.03% (7/139), E. cloacae 2.16% (3/139), P. vulgaris 2.16% (3/139), and M. morganii 0.72% (1/139), respectively (Table 3). PMQR genes were detected from wound (84/139), respiratory tract specimens (27/139), blood and body fluids (28/139), respectively (Supplementary Materials Table S3). Of the total genotypically confirmed PMQR and ESBL cases (N = 139), the most frequently detected PMQR gene was aac(6′)-lb-cr 77.7% (108/139) followed by oqxB 67.63% (94/139), oqxA 62.59% (87/139), qnrB 43.17% (60/139), qnrD 19.42% (27/139), qnrS 18.71% (26/139), qnrA 9.35% (13/139), qepA 3.6% (5/139), and qnrC 2.88% (4/139), respectively (Supplementary Materials Table S3). Among the genotypically confirmed ESBL and PMQR positive Enterobacterales isolates that carrying qnrA gene (N = 13), majority of the isolates to had co-existence with blaTEM (13/13) and blaCTX-M (8/13) gene (Table 4). Similarly, most of the strains carrying qnrB gene (N = 60) demonstrated coexistence with blaTEM (46/60), blaCTX-M (43/60), and blaSHV (27/60). In contrast, strains carrying Aac-ib-cr gene (N = 108), most of the isolates showed coexistence with blaTEM (98/108), blaCTX-M (84/108), blaSHV (47/108), blaPER (28/108), and blaVEB (13/108) (Supplementary Materials Table S3). This coexistence of genes was observed among those isolates that carried oqxA and oqxB as well. Among the isolates that carrying oqxA (N = 87) gene, majority of the isolates were possessing blaTEM (72/87), blaCTX-M (66/87) and blaSHV (39/87), blaPER (17/87) and blaVEB (12/87), respectively (Table 4 and Supplementary Materials Table S3). Similarly, isolates that possess oqxB genes was carrying blaTEM (80/94), blaCTX-M (71/94) and blaSHV (46/94), blaPER (15/94) and blaVEB (11/94), respectively. It was also noted that Enterobacterales isolates that having higher minimum inhibitory concentration (MIC) values for ciprofloxacin (≥16 μg/mL), nalidixic acid (≥64 μg/mL), levofloxacin (≥32 μg/mL),gatifoxacin (≥32 μg/mL) and moxifloxacin (≥32 μg/mL) mainly harboured Aac-ib-cr, qnrB, oqxA and oqxB genes. Further, the frequency of PMQR genes were high in isolates with higher quinolone MIC than their low MIC counterparts (Supplementary Materials Table S6).
Out of the 60.82% (104/171) of AME genes detected, the distribution of these genes in the Enterobacterales (N = 104) is as follows; K. pneumoniae 44.23% (46/104), E. coli 38.46% (40/104), P. mirabilis 2.89% (3/104), C. freundii 5.77% (6/104), K. oxytoca 3.84% (4/104), E. cloacae 2.89% (3/104), P. vulgaris 0.96% (1/104), and M. morganii 0.96% (1/104), respectively (Table 3). The distribution of different AME genes in various specimens include wound (N = 69), respiratory tract specimens (N = 7), blood and body fluids (N = 28), respectively. Of the total genotypically confirmed ESBL and AME cases (N = 104), the most frequently encountered AME gene was aac(6′)-Ib 81.73% (85/104), followed by aph(3′)-Ia 46.15% (48/104), ant(3”)-Ia 44.23% (46/104), aac(3)-IIa 45.19% (47/104), aph(3”)-Ib 35.58%, (37/104), armA 14.42% (15/104), ant(4”)-IIa 12.5% (13/104), aac(3)-Ib 10.58%(11/104), ant(2”)-Ia 8.65% (9/104), aac(3)-Ia 6.73% (7/104), respectively (Table 3). However, aac(2′)-Ia, aac(6′)-Ia, aac(6′)-Ic and aph(3”)-Ia were not detected in any of the strains analyzed (Supplementary Materials Table S4).
Of the total AME positive Enterobacterale isolates (N = 104) that carried aac(3)-IIa genes (N = 47), majority of the isolate had co-existence with blaTEM (43/47) and blaCTX-M (38/47) genes. Similarly, strains carrying aac(6′)-Ib gene (N = 85) demonstrated coexistence with blaTEM (75/85), blaCTX-M (72/85), and blaSHV (43/85). However, strains carrying ant (3”)-Ia gene (N = 46), majority of isolates showed co-existence with blaTEM (41/46), blaCTX-M (35/46) and blaSHV (23/46). This coexistence of genes were also observed among the isolates that carrying aph(3”)-Ia and aph(3”)-Ib wherein majority of the strains were equally harbouring both blaTEM and blaCTX-M genes (Table 4 and Supplementary Materials Table S4). Further, isolates that showed high MIC values for gentamicin (≥16 μg/mL), tobramycin (≥16 μg/mL), amikacin (≥64 μg/mL) and kanamycin (≥64 μg/mL) mainly harboured aac(6′)-Ib, aph(3”)-Ia, aac(3)-IIa, ant(3”)-Ia genes, respectively (Supplementary Materials Table S7). The rate of incidence of aminoglycoside resistance genes was high in isolates that having higher aminoglycoside MICs as compared to strains with low degree of aminoglycoside MICs (Supplementary Materials Table S7).
Of the 63.74% (108/171) of TMP-SMX resistant ESBL producing Enterobacterales isolates, the distribution of TMP-SMX resistance genes are as follows; K. pneumoniae 42.59% (46/108), E. coli 34.26% (37/108), P. mirabilis 5.56% (6/108), C. freundii 6.5% (7/108), K. oxytoca 5.56% (6/108), E. cloacae 4.63% (5/108), P. vulgaris 1.86% (2/108), and M. morganii 0.92% (1/108), respectively (Table 3). These TMP-SMX resistance genes were distributed among wound (N = 78), respiratory tract specimens (N = 4), blood and body fluids (N = 28), respectively. Of the total genotypically confirmed ESBL and TMP-SMX resistant isolates (N = 108), the most common TMP-SMX resistance gene was sul1 100% (108/108), followed by dfrA 54.63% (59/108) and sul2 15.74% (17/108), respectively (Supplementary Materials Table S5).
Of the total ESBL isolates that carrying sul1 gene (N = 108), majority of the isolates were having co-existence with blaTEM (95/108), blaCTX-M (81/108) and blaSHV (51/108) genes, respectively. Similarly, strains carrying dfrA1 gene (N = 59) demonstrated coexistence with blaTEM (53/59) and blaCTX-M (48/59) (Supplementary Materials Table S5). Further, Enterobacterales isolates that showed elevated MICs (4/76 ≥ 16/304 μg/mL) for TMP-SMX mainly harbored sul1 and dfrA1 genes. It was also observed that the frequency of TMP-SMX genes was higher in strains with high TMP-SMX MIC values (Supplementary Materials Table S8).
Table 5 summarizes the comparison of origin of strain and type of resistance genes detected. The data analysis shows no direct correlation exists between origin of strain (wound, respiratory tract specimens, blood and body fluids) and the type of resistance genes (ESBL, PMQR, AME, and TMP-SMX resistance genes) detected. The number of types of resistance genes detected in wound specimens were significantly (p < 0.05) different from that found in the respiratory tract specimens (Table 5).

3. Discussion

The current study investigated the frequency of non-β-lactam antibiotic resistance associated genes among ESBL producing Enterobacterales. It was observed that the prevalence of ESBL genes detected in the current study (particularly among E. coli and K. pneumoniae) were comparable with earlier studies [2,22]. The most commonly encountered ESBL gene in this study was blaTEM (84.79%) followed by blaCTX-M (73.68%), blaSHV (43.86%), blaPER (18.71%) and blaSHV (9.94%), respectively. These findings were in accordance with an earlier study wherein most prevalent ESBL gene found was blaTEM (73%) followed by blaCTX-M (25–100%) and blaSHV (23%) [2]. The low prevalence of blaPER and blaVEB in the present study were comparable with the data reported by Khurana et al. [2]. Further, it was observed that most of the ESBL producing organisms were resistant to fluoroquinolones, aminoglycosides and TMP-SMX, respectively. This may be possibly due to the co-existence of PMQR, AME and TMP-SMX resistance genes in the same plasmids that also code for ESBL proteins [22].
In the present study, PCRs detected presence of PMQR genes in 81.29% (N = 139) of genotypically confirmed ESBL isolates (N = 171), indicating the presence of high frequency of PMQR genes among ESBL strains. Interestingly, K. pneumoniae (44.6%) was having higher number of PMQR genes detected followed by E. coli (31.65%). This observation is in accordance with an earlier study wherein, PMQR genes were more frequently encountered among E. coli, Klebsiella species, and Enterobacter species [3]. However, the frequency of occurrence of PMQR genes were low among Enterobacter cloacae in this study. This is probably due to the difference in the geographical location as the earlier study was conducted in the southern part of India (where the usage of antibiotics is different). Further, the widespread antibiotic resistance prevalent in India may be attributed to readily availability of antibiotics across the pharmacy counters. This could play a major role in increased distribution of antibiotic-resistance genes throughout the population. This study included isolates that obtained from wound, respiratory tract, body fluid and blood specimens while other studies were performed mostly using isolates that are collected from urine [4,9,20]. Of the total genotypically confirmed ESBL cases (N = 171), the most frequent PMQR gene detected was aac(6′)-lb-cr (77.7%) which is in agreement with an earlier report wherein the prevalence rate was found to be 64.5% [3]. In this study, relatively higher prevalence of qnrB (43.17%) was observed, which was in accordance with Yang et.al observation (prevalence rate ~50%) [13]. Previous studies also reported the low prevalence of qnrD, qnrS, qnrA, and qnrC [4,5,22,23]. It was observed that the distribution of efflux pumps genes among ESBL producing Enterobacterales isolates were found to be oqxB (67.63%), oqxA (62.59%) and qepA (3.6%), respectively. However, this efflux pump mediated drug resistance mechanism of bacteria can be subdued using various efflux inhibitory molecules [24], for instance, the susceptibility of antibiotics against multidrug-resistant bacteria (that developed exclusively due to efflux pump mechanisms) can be enhanced in presence of efflux pump inhibitor such as omeprazole [25]. Further, the genome sequencing analysis of multidrug-resistant strains that might reveal the potential genes that are associated with multidrug efflux pumps and once the genes and gene products are identified, the molecular docking studies that may further help in developing appropriate efflux pump inhibitors. These efflux pump inhibitors can be incorporated with antibiotic molecules in order to overcome the efflux pump mediated drug resistance [26]. Further, to our knowledge, this is the first study that investigated the prevalence of PMQR among Enterobacterales in North India. However, the oqxA and oqxB prevalence rates were comparable with earlier reports wherein the prevalence rates were found to be 88% and 30% for oqxA and oqxB genes, respectively [27]. Further, the differences in the prevalence of oqxA and oqxB genes may be attributed to the geographical distribution and type of isolates studied, as most of the studies were conducted on E. coli and K. pneumonia isolates [5,19]. The low prevalence of qepA observed (3.6%) was similar with previous data (2%) in the literature [13,28]. This low prevalence of qepA in the current study may also indicate low incidence of qepA gene among different strains of Enterobacterales across the world [5]. In this study, the presence of PMQR genes were associated with ESBL genes, possibly due to the common carriage on the same plasmids [23]. The isolates that carrying a minimum of two β-lactamases coding genes (particularly, blaTEM and blaCTX-M) were more likely to carry aac(6′)-Ib-cr and qnrB genes. The genes that code for both ESBL and PMQR proteins are usually located on same plasmids and consequently that may have higher chances of transfer among the members of Enterobacterales. Therefore, it is very pertinent to comprehend the drug resistance mechanisms prevalent among the members of medically important bacteria as it may be a major concern for patient safety and in determination of therapeutic strategies.
Genes encoding AMEs are prevalent in various groups of bacteria [10,29,30,31,32]. In this study, prevalence of AME genes were found to be 60.82% among ESBL producing strains of Enterobacterales. This relatively higher prevalence rate of AMEs in ESBL producing strains may be due to co-existence of genes encoding ESBLs and AMEs in Gram-negative bacteria [9]. In this study, AMEs coding genes were most frequently isolated from K. pneumoniae (44.23%) and E. coli (38.46%). This was in accordance with an earlier study conducted by Haidar et al., wherein a higher prevalence of AME genes were reported among K. pneumoniae [9]. In the present study, the most frequently encountered AME gene was aac(6′)-Ib (81.73%) which is in agreement with the earlier studies (prevalence was 73%) [9]. The predominance and coexistence of aac(6′)-Ib with other AME genes observed may be attributed to the fact that the gene coding for aac(6′)-Ib enzyme is frequently located within class I integrons. Further, it is known that the gene cassettes that carry other genes coding for AMEs can be easily incorporated into class I integrons resulting in the development of resistance to currently used aminoglycosides [10]. The other prevalent genes were aph(3′)-Ia (46.15%), followed by ant(3”)-Ia (44.23%), aac(3)-IIa (45.19%), and aph(3”)-Ib (35.58%). The higher prevalence of aph(3′)-Ia and aph(3”)-Ib is alarming as this type of resistance may usually produce high level of aminoglycoside resistance. The prevalence of other AME genes were found to be relatively low, which is comparable with earlier studies [9,23].
The TMP-SMX resistance genes such as sul1, sul2, or dfrA genes are likely to be present either on chromosome or on plasmids [33,34]. In the present study, TMP-SMX resistance genes were obtained from 63.74% of ESBL producing isolates. This comparatively low detection rate of these resistance genes may be attributed to the presence of alternative resistance mechanisms prevailing in TMP-SMX resistant isolates [33]. However, additional investigations are required to explore the genetic basis of TMP-SMX resistance mechanisms that prevailing in various strains of Enterobacterales. Further, among the genotypically confirmed TMP-SMX resistant strains (N = 108), 42.59% of K. pneumonia isolates were carrying TMP-SMX resistance genes, followed by E. coli (34.26%). However, due to the paucity of literatures, the comparison with earlier studies could not performed. To our knowledge, this new study report, the prevalence of TMP-SMX resistance genes among various clinical strains of ESBL producing Enterobacterales. A higher prevalence of sul1 (100%) followed by dfrA (54.63%) and sul2 (15.74%), genes were noted in this study. This higher prevalence of sul1 gene may be attributed to the fact that the sul1 genes are usually located within class I integrons and this particular characteristic (which is a horizontally transferable genetic element) might have further helped in its wide distribution [35]. The comparatively higher prevalence of dfrA1 (33.91%) gene in the present study was in agreement with an earlier study wherein in the prevalence rate was also found to be high [22]. Enterobacterales isolates that showed elevated MICs for TMP-SMX mainly harbored sul1 and dfrA1 genes indicating the likelihood of these genes in imparting resistance to TMP-SMX. However, no genes were detected from number of isolates that were having higher MIC values, suggesting the existence of alternative pathways of resistance in TMP-SMX resistant isolates.

4. Materials and Methods

4.1. Study Setting and Clinical Specimens

Between July 2018 and June 2019, a total of 2134 clinical samples (wound, respiratory tract specimens, blood and body fluids) received in the Microbiology laboratory, Government Medical College and Hospital, Badaun, India were analyzed for ESBL producing strains of Enterobacterales. This hospital laboratory receives samples from two civil hospitals and three primary health care centers that are attached to it. Among the total samples analyzed (N = 2134), a total of 186 non-repetitive phenotypically confirmed ESBL producing Enterobacterales isolates (one organism per patient was included to avoid duplication) were obtained. All the isolates were identified by manual API® system (BioMérieux, Durham, NC, USA) and the results interpreted as recommended by the manufacturer. The strains included were K. pneumoniae (N = 74), E. coli (N = 58), P. mirabilis (N = 15), C. freundii (N = 13), K. oxytoca (N = 11), E. cloacae (N = 9), P. vulgaris (N = 3) and M. morganii (N = 3). All the clinical isolates were identified by standard laboratory procedure [11]. All the bacterial isolates were stored at −80 °C in glycerol for future use.

4.2. Antimicrobial Susceptibility Testing and MIC Determination

The antibiotic susceptibility testing was conducted by modified Kirby Bauer disc diffusion method as recommended by the Clinical Laboratory Standards Institute (CLSI) [10]. The antibiotic discs (HiMedia, Mumbai, India) tested include; ampicillin (10 μg), cefazolin (30 μg), amoxicillin -clavulanic acid (20 μg + 10 μg), cefotaxime (30 μg), cefepime (30 μg), ceftazidime (30 μg), ceftriaxone (30 μg), cefoxitin (10 μg), cefpodoxime (30 μg), cefuroxime (30 μg), ceftizoxime (30 μg), imipenem (10 μg), meropenem (10 μg), aztreonam (30 μg), gentamicin (10 μg), tobramycin (10 μg), amikacin (30 μg), kanamycin (30 μg), ciprofloxacin (5 μg), levofloxacin (5 μg), gatifloxacin (5 μg), nalidixic acid (30 μg), moxifloxacin (5 μg), and TMP-SMX (1.25/23.75 μg). However, some of the antibiotics were not tested against the following organisms since these organism’s possess intrinsic resistance, more specifically, (a) K. pneumoniae, C. freundii, K. oxytoca, E. cloacae, P. vulgaris, and M. morganii against Ampicillin (b) C. freundii, E. cloacae, and M. morganii against amoxicillin- clavulanic acid (c) C. freundii, and E. cloacae against cefoxitin (d) P. vulgaris, and M. morganii against cefpodoxime, respectively [36]. Quality control strains used for antimicrobial susceptibility testing include E. coli (ATCC 25922) and Pseudomonas aeruginosa (ATCC 27853).
The MIC of fluoroquinolones (MIC determined for selected antibiotics that include; ciprofloxacin, levofloxacin, nalidixic acid, gatifloxacin, and moxifloxacin), aminoglycosides (MIC calculated for; gentamycin, tobramycin, amikacin and kanamycin) and TMP-SMX were determined by broth micro dilution method and the results were interpreted in accordance with the CLSI guidelines [36]. The MICs were calculated to determine the association between presence of antibiotic resistance genes and concentration of antibiotic tested.

4.3. Phenotypic Detection of ESBL

ESBL activity was initially screened using disk diffusion method as recommended by CLSI [36]. Isolates that showed decreased zone of inhibition to one or more of the following antibiotic: ≤25 mm with ceftriaxone (30 μg), ≤27 mm with cefotaxime (30 μg), ≤22 mm with ceftazidime (30 μg), ≤17 mm with cefpodoxime (10 μg), and ≤27 mm with aztreonam (30 μg) were considered as ESBL producers (for E. coli, K. pneumoniae, and K oxytoca). However, zone size with ≤22 mm cefpodoxime (10 μg), ≤22 mm with ceftazidime (30 μg), ≤27 mm with cefotaxime, indicated ESBL production for P. mirabilis [36].
The double-disk synergy diffusion test (phenotypic confirmatory test for ESBL) was carried out as per CLSI recommendations. Briefly, ceftazidime (30 μg) and cefotaxime (30 μg) alone and in combination with clavulanic acid (10 μg; Himedia, Mumbai, India) were used. The ESBL production is confirmed when there is an increase of zone diameter (≥5 mm) around disk with antibiotic-clavulanic acid combination [36].
The disc approximation test was used to confirm the ESBL production in E. cloacae, C. freundii, P. vulgaris, and M. morganii strains. This test was performed as disc diffusion assay on Mueller-Hinton agar (MHA). Briefly, antibiotic discs containing aztreonam (30 μg), ceftazidime (30 μg), ceftriaxone (30 μg), and cefotaxime (30 μg) were kept 30 mm apart (center to center) around amoxicillin-clavulanic acid (20 μg + 10 μg) disc on MHA plate inoculated with the organism to be tested. The MHA plates were incubated at 37 °C for 24 h. An increased zone of inhibition of any of the test antibiotic towards amoxicillin-clavulanic acid was considered as ESBL production [37]. The control strains used were E. coli ATCC 25922 (non-beta-lactamases producer) and K. pneumoniae ATCC 700603 (ESBL producer), respectively.

4.4. PCR Analysis and Sequencing

4.4.1. Extraction of Bacterial DNA

Bacterial DNA was obtained from the phenotypically confirmed ESBL strains of Enterobacterales using QIAamp DNA Mini Kit (Qiagen, Hilden, Germany). The DNA samples obtained by this procedure were segregated into two aliquots; first aliquot was used as template for the subsequent PCR reactions and the second aliquot was stored at −80 °C (Jindal Ultra Freezer (SMI-165E), Ghaziabad, India) for future use.

4.4.2. Molecular Detection of ESBL, PMQR, AME and TMP-SMX Resistance Genes

All the phenotypically confirmed ESBL producing Enterobacterales isolates were subjected to molecular characterization of the relevant encoding genes such as blaSHV, blaCTX-M, blaTEM, blaPER, and blaVEB by PCR using primers and PCR conditions shown in Table 1 [14,15].
ESBL producing Enterobacterales isolates that resistant to fluoroquinolones were subjected to PCRs for detection of (i) qnr proteins coding genes such as qnrA, qnrB, qnrC, qnrD, and qnrS (ii) quinolones modifying aminoglycoside acetyltransferase coding genes (acc(6′)-Ib-cr) and (iii) plasmid-mediated quinolone efflux pump protein encoding genes (qepA, oqxA and oqxB) using primers and PCR conditions depicted in Table 1 [4,5,16,17,18,19].
ESBL producing aminoglycosides resistant strains of Enterobacterales were screened for AMEs coding genes aac(2′)-Ia, aac(3)-Ia, aac(3)-Ib, aac(3)-IIa, aac(6′)-Ia, aac(6′)-Ib,aac(6′)-Ic,ant(2”)-Ia, ant(3”)-Ia, ant(4”)-IIa, aph(3′)-Ia, aph(3”)-Ia, aph(3”)-Ib, armA using primers described in Table 1 [20,21].
All isolates phenotypically resistant to TMP-SMX were subjected to PCR for detection of sul1, sul2 and dfrA genes using primers and PCR conditions shown in Table 1 [22,38]. Briefly, 2 µL (~500 ng) of purified DNA was subjected to each multiplex PCR in a 100 µL reaction mixture containing 1 × PCR buffer (10 Tris-HCl pH 8.8, (NH4)2SO4, 3 mM MgCl2, 0.2% Tween 20), 200 mM of each dNTPs, 0.5 µM of each primer, and 2.0 units of AURA Taq DNA polymerase. Amplification was carried out as follows: initial denaturation at 95 °C for 5 min; 30 cycles of denaturation at 95 °C for 30 s, annealing at 50–62 °C for 30 s, extension/elongation at 72 °C for 45 s; and a final elongation step at 72 °C for 5 min. PCR-generated products were detected by electrophoresis of 7 μL of each amplification mixture in 2% agarose gels in 1% Tris Borate-EDTA buffer and 0.5 µg/mL ethidium bromide.
To identify the ESBL, PMQR, AME, and TMP-SMX resistance genes detected in the PCR assays, automated DNA sequencing of the amplicons were conducted. More specifically, multiplex PCR-generated products were separated in 2% low melting agarose gel with 1% Tris-acetate-EDTA buffer. The PCR products were excised from the agarose gel and purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) as recommended by the manufacturer. The nucleotide sequencing of amplicons was conducted using an ABI 3730xl DNA Analyzer (Applied Biosystems, Branch burg, NJ, USA). Basic Local Alignment Search Tool (BLAST) program was used to compare each ESBL, PMQR, AME, and TMP-SMX resistance gene sequences against those available in gene bank at the National Center of Biotechnology Information database.

4.5. Statistical Analysis

Chi-squared test was used to compare the association between the origin of strain and type of resistance genes detected. The null hypothesis will be accepted if the presence of genes in all the groups (wound, respiratory tract specimens, and blood body fluids) were similar. Dunn’s multiple comparisons test was performed to compare the differences in the number of resistance genes obtained between two categories of samples. All statistical analyses were performed using Graph pad Prism (version 6, Graph-Pad Software, Inc., La Jolla, CA, USA). The statistical difference values showing p < 0.05 were considered as significant.

5. Conclusions

In summary, this is the first study that investigated the occurrence of genetic determinants prevailing in ESBL producing Enterobacterales and the association of these genetic determinants with PMQR, AME, and TMP-SMX resistance genes in the north India. The current study demonstrated widespread occurrence of PMQR, AME, and TMP-SMX drug resistant genetic determinants in the ESBL producing Enterobacterales strains. Screening of PMQR genetic elements in ESBL producing Enterobacterales strains revealed high prevalence of both aac(6′)-Ib-cr and qnrB. However, molecular analysis of AMEs producing Enterobacterales strains showed high prevalence of aac(6′)-Ib followed by aph (3′)-Ia. On examination of TMP-SMX resistant strains, sul1 was found to be the most frequently encountered gene followed by dfrA. The association of ESBL-producing genes with the PMQR, AMEs, and TMP-SMX resistance genes may potentially aid in transfer of drug resistance determinants among these strains. Therefore, a complete understanding of PMQRs, AMEs, and other drug resistance mechanisms will help in determining rationale of treatment and infection control measures in hospital settings.

Supplementary Materials

The following are available online at https://0-www-mdpi-com.brum.beds.ac.uk/2079-6382/9/12/884/s1, Table S1: Antibiotic resistance pattern of Enterobacterales isolates tested, Table S2: Distribution of Enterobacterales isolates in various specimens studied, Table S3: Distribution of plasmid mediated quinolone resistance (PMQR) genes in extended spectrum beta-lactamase producing Enterobacterales isolates, Table S4: Distribution of aminoglycoside modifying enzyme (AME) genes in extended spectrum beta-lactamase producing Enterobacterales, Table S5: Distribution of TMP-SMX resistant genes in extended spectrum beta-lactamase producing Enterobacterales, Table S6: Distribution plasmid mediated quinolone resistance genes in extended spectrum beta-lactamase producing Enterobacterales isolates and its comparison with minimum inhibitory concentrations of fluoroquinolones tested, Table S7: Distribution of aminoglycoside modifying genes in extended spectrum beta-lactamase producing Enterobacterales isolates and its comparison with minimum inhibitory concentrations of aminoglycosides tested, Table S8: Distribution of trimethoprim-sulfamethoxazole (TMP-SMX) resistance genes in extended spectrum beta-lactamase producing Enterobacterales isolates and its comparison with minimum inhibitory concentrations of TMP-SMX tested.

Author Contributions

Conceptualization, P.S., R.B., A.B.N., V.M. and S.H.; Data Curation, P.S., R.B., A.B.N., K.N.V., N.S. and M.A.; Formal Analysis, P.S., R.B., A.B.N., N.S., M.A. and S.T.R.; Funding Acquisition, P.S., A.B.N. and S.H.; Investigation, P.S., R.B., A.B.N., V.M., S.H., K.N.V., N.S., M.A. and S.T.R.; Methodology, P.S., R.B., A.B.N., V.M., S.H., K.N.V., N.S., M.A. and S.T.R.; Writing—Original Draft Preparation, S.H., K.N.V., N.S., M.A. and S.T.R.; Writing—Review & Editing, P.S., R.B., A.B.N. and V.M.; All authors have read and agreed to the published version of the manuscript.

Funding

The authors acknowledge the Deanship of Scientific Research at King Faisal University for the financial support under Nasher Track (Grant No.186297).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Alvarez, M.; Tran, J.H.; Chow, N.; Jacoby, G.A. Epidemiology of conjugative plasmid-mediated AmpC beta-lactamases in the United States. Antimicrob. Agents Chemother. 2004, 48, 533–537. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Khurana, S.; Mathur, P.; Kapil, A.; Valsan, C.; Behera, B. Molecular epidemiology of beta-lactamase producing nosocomial Gram-negative pathogens from North and South Indian hospitals. J. Med. Microbiol. 2017, 66, 999–1004. [Google Scholar] [CrossRef] [PubMed]
  3. Yugendran, T.; Harish, B.N. High incidence of plasmid-mediated quinolone resistance genes among ciprofloxacin-resistant clinical isolates of Enterobacteriaceae at a tertiary care hospital in Puducherry, India. PeerJ 2016, 4, e1995. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Chen, X.; Zhang, W.; Pan, W.; Yin, J.; Pan, Z.; Gao, S.; Jiao, X. Prevalence of qnr, aac(6′)-Ib-cr, qepA, and oqxAB in Escherichia coli isolates from humans, animals, and the environment. Antimicrob. Agents Chemother. 2012, 56, 3423–3427. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Cattoir, V.; Poirel, L.; Rotimi, V.; Soussy, C.J.; Nordmann, P. Multiplex PCR for detection of plasmid-mediated quinolone resistance qnr genes in ESBL-producing enterobacterial isolates. J. Antimicrob. Chemother. 2007, 60, 394–397. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  6. Jacoby, G.A.; Strahilevitz, J.; Hooper, D.C. Plasmid-mediated quinolone resistance. Microbiol. Spectr. 2014, 2. [Google Scholar] [CrossRef] [Green Version]
  7. Zhang, H.; Chang, M.; Zhang, X.; Cai, P.; Dai, Y.; Song, T.; Wu, Z.; Xu, H.; Qiao, M. Functional Identification and Evolutionary Analysis of Two Novel Plasmids Mediating Quinolone Resistance in Proteus vulgaris. Microorganisms 2020, 8. [Google Scholar] [CrossRef]
  8. Teramae, M.; Osawa, K.; Shigemura, K.; Kitagawa, K.; Shirakawa, T.; Fujisawa, M.; Miyara, T. Prevalence of Quinolone Resistance of Extended-Spectrum β-Lactamase-Producing Escherichia coli with ST131-fimH30 in a City Hospital in Hyogo, Japan. Int. J. Mol. Sci. 2019, 20. [Google Scholar] [CrossRef] [Green Version]
  9. Haidar, G.; Alkroud, A.; Cheng, S.; Churilla, T.M.; Churilla, B.M.; Shields, R.K.; Doi, Y.; Clancy, C.J.; Nguyen, M.H. Association between the Presence of Aminoglycoside-Modifying Enzymes and In Vitro Activity of Gentamicin, Tobramycin, Amikacin, and Plazomicin against Klebsiella pneumoniae Carbapenemase- and Extended-Spectrum-β-Lactamase-Producing Enterobacter Species. Antimicrob. Agents Chemother. 2016, 60, 5208–5214. [Google Scholar] [CrossRef] [Green Version]
  10. Fernández-Martínez, M.; Ruiz Del Castillo, B.; Lecea-Cuello, M.J.; Rodríguez-Baño, J.; Pascual, Á.; Martínez-Martínez, L. Prevalence of Aminoglycoside-Modifying Enzymes in Escherichia coli and Klebsiella pneumoniae Producing Extended Spectrum β-Lactamases Collected in Two Multicenter Studies in Spain. Microb. Drug Resist. 2018, 24, 367–376. [Google Scholar] [CrossRef]
  11. Winn, W.; Allen, S.; Janda, W.; Koneman, E.; Procop, G. Introduction to microbiology part II: Guidelines for the Collection, Transport, Processing, Analysis and Reporting of Cultures from Specific Specimen Sources. In Koneman’s Color Atlas and Textbook of Diagnostic Microbiology, 6th ed.; Lippincott William & Wilkins: Philadelpia, PA, USA, 2006; pp. 67–105. [Google Scholar]
  12. Plattner, M.; Gysin, M.; Haldimann, K.; Becker, K.; Hobbie, S.N. Epidemiologic, Phenotypic, and Structural Characterization of Aminoglycoside-Resistance Gene aac(3)-IV. Int. J. Mol. Sci. 2020, 21. [Google Scholar] [CrossRef] [PubMed]
  13. Yang, H.Y.; Nam, Y.S.; Lee, H.J. Prevalence of plasmid-mediated quinolone resistance genes among ciprofloxacin-nonsusceptible Escherichia coli and Klebsiella pneumoniae isolated from blood cultures in Korea. Can. J. Infect. Dis. Med. Microbiol. 2014, 25, 163–169. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Moland, E.S.; Hanson, N.D.; Black, J.A.; Hossain, A.; Song, W.; Thomson, K.S. Prevalence of newer beta-lactamases in gram-negative clinical isolates collected in the United States from 2001 to 2002. J. Clin. Microbiol. 2006, 44, 3318–3324. [Google Scholar] [CrossRef] [Green Version]
  15. Dallenne, C.; Da Costa, A.; Decré, D.; Favier, C.; Arlet, G. Development of a set of multiplex PCR assays for the detection of genes encoding important beta-lactamases in Enterobacteriaceae. J. Antimicrob. Chemother. 2010, 65, 490–495. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Wang, M.; Guo, Q.; Xu, X.; Wang, X.; Ye, X.; Wu, S.; Hooper, D.C.; Wang, M. New plasmid-mediated quinolone resistance gene, qnrC, found in a clinical isolate of Proteus mirabilis. Antimicrob. Agents Chemother. 2009, 53, 1892–1897. [Google Scholar] [CrossRef] [Green Version]
  17. Majlesi, A.; Kakhki, R.K.; Mozaffari Nejad, A.S.; Mashouf, R.Y.; Roointan, A.; Abazari, M.; Alikhani, M.Y. Detection of plasmid-mediated quinolone resistance in clinical isolates of Enterobacteriaceae strains in Hamadan, West of Iran. Saudi J. Biol. Sci. 2018, 25, 426–430. [Google Scholar] [CrossRef] [PubMed]
  18. Wareham, D.W.; Umoren, I.; Khanna, P.; Gordon, N.C. Allele-specific polymerase chain reaction (PCR) for rapid detection of the aac(6′)-Ib-cr quinolone resistance gene. Int. J. Antimicrob. Agents 2010, 36, 476–477. [Google Scholar] [CrossRef]
  19. Yamane, K.; Wachino, J.; Suzuki, S.; Arakawa, Y. Plasmid-mediated qepA gene among Escherichia coli clinical isolates from Japan. Antimicrob. Agents Chemother. 2008, 52, 1564–1566. [Google Scholar] [CrossRef] [Green Version]
  20. Miró, E.; Grünbaum, F.; Gómez, L.; Rivera, A.; Mirelis, B.; Coll, P.; Navarro, F. Characterization of aminoglycoside-modifying enzymes in enterobacteriaceae clinical strains and characterization of the plasmids implicated in their diffusion. Microb. Drug Resist. 2013, 19, 94–99. [Google Scholar] [CrossRef]
  21. Berçot, B.; Poirel, L.; Nordmann, P. Updated multiplex polymerase chain reaction for detection of 16S rRNA methylases: High prevalence among NDM-1 producers. Diagn. Microbiol. Infect. Dis. 2011, 71, 442–445. [Google Scholar] [CrossRef]
  22. Arabi, H.; Pakzad, I.; Nasrollahi, A.; Hosainzadegan, H.; Azizi Jalilian, F.; Taherikalani, M.; Samadi, N.; Monadi Sefidan, A. Sulfonamide Resistance Genes (sul) M in Extended Spectrum Beta Lactamase (ESBL) and Non-ESBL Producing Escherichia coli Isolated From Iranian Hospitals. Jundishapur J. Microbiol. 2015, 8, e19961. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Azargun, R.; Sadeghi, M.R.; Soroush Barhaghi, M.H.; Samadi Kafil, H.; Yeganeh, F.; Ahangar Oskouee, M.; Ghotaslou, R. The prevalence of plasmid-mediated quinolone resistance and ESBL-production in Enterobacteriaceae isolated from urinary tract infections. Infect. Drug Resist. 2018, 11, 1007–1014. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Usai, D.; Donadu, M.; Bua, A.; Molicotti, P.; Zanetti, S.; Piras, S.; Corona, P.; Ibba, R.; Carta, A. Enhancement of antimicrobial activity of pump inhibitors associating drugs. J. Infect. Dev. Ctries. 2019, 13, 162–164. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Chowdhury, N.; Suhani, S.; Purkaystha, A.; Begum, M.K.; Raihan, T.; Alam, M.J.; Islam, K.; Azad, A.K. Identification of AcrAB-TolC Efflux Pump Genes and Detection of Mutation in Efflux Repressor AcrR from Omeprazole Responsive Multidrug-Resistant Escherichia coli Isolates Causing Urinary Tract Infections. Microbiol. Insights 2019, 12, 1178636119889629. [Google Scholar] [CrossRef] [Green Version]
  26. Yewale, P.P.; Lokhande, K.B.; Sridhar, A.; Vaishnav, M.; Khan, F.A.; Mandal, A.; Swamy, K.V.; Jass, J.; Nawani, N. Molecular profiling of multidrug-resistant river water isolates: Insights into resistance mechanism and potential inhibitors. Environ. Sci. Pollut. Res. Int. 2020, 27, 27279–27292. [Google Scholar] [CrossRef]
  27. El-Badawy, M.F.; Tawakol, W.M.; El-Far, S.W.; Maghrabi, I.A.; Al-Ghamdi, S.A.; Mansy, M.S.; Ashour, M.S.; Shohayeb, M.M. Molecular Identification of Aminoglycoside-Modifying Enzymes and Plasmid-Mediated Quinolone Resistance Genes among Klebsiella pneumoniae Clinical Isolates Recovered from Egyptian Patients. Int. J. Microbiol. 2017, 2017, 8050432. [Google Scholar] [CrossRef] [Green Version]
  28. Doma, A.O.; Popescu, R.; Mitulețu, M.; Muntean, D.; Dégi, J.; Boldea, M.V.; Radulov, I.; Dumitrescu, E.; Muselin, F.; Puvača, N.; et al. Comparative Evaluation of qnrA, qnrB, and qnrS Genes in Enterobacteriaceae Ciprofloxacin-Resistant Cases, in Swine Units and a Hospital from Western Romania. Antibiotics (Basel) 2020, 9. [Google Scholar] [CrossRef]
  29. Hammadi, A.; Aga, Q.; Nimer, N.; Shinu, P.; Nair, A. Antimicrobial resistance and presence of Class 1 integrons in Pseudomonas aeruginosa isolates from burn and wound infections. J. Pharm. Negat. Results 2020, 11, 36. [Google Scholar]
  30. Kumar, N.; Singh, V.A.; Pottathil, S. Metallo-β-lactamase- and serine carbapenemase-producing Klebsiella spp.: A global challenge. J. Glob. Antimicrob. Resist. 2018, 12, 185–186. [Google Scholar] [CrossRef]
  31. Shinu, P.; Singh, V.; Nair, A. Isoniazid and rifampin drug susceptibility testing: Application of 2,3,5-triphenyl tetrazolium chloride assay and microscopic-observation drug-susceptibility assay directly on Ziehl-Neelsen smear positive sputum specimens. Braz. J. Infect. Dis. 2016, 20, 33–40. [Google Scholar] [CrossRef] [Green Version]
  32. Venugopala, K.N.; Tratrat, C.; Chandrashekharappa, S.; Attimarad, M.; Sreeharsha, N.; Nair, A.B.; Pottathil, S.; Venugopala, R.; Al-Attraqchi, O.H.A.; Morsy, M.A. Anti-tubercular potency and computationally-assessed drug-likeness and toxicology of diversely substituted indolizines. Indian J. Pharma. Educ. Res. 2019, 53, 545–552. [Google Scholar] [CrossRef] [Green Version]
  33. Hu, L.F.; Chang, X.; Ye, Y.; Wang, Z.X.; Shao, Y.B.; Shi, W.; Li, X.; Li, J.B. Stenotrophomonas maltophilia resistance to trimethoprim/sulfamethoxazole mediated by acquisition of sul and dfrA genes in a plasmid-mediated class 1 integron. Int. J. Antimicrob. Agents 2011, 37, 230–234. [Google Scholar] [CrossRef] [PubMed]
  34. Kanda, N.; Hashimoto, H.; Sonoo, T.; Naraba, H.; Takahashi, Y.; Nakamura, K.; Hatakeyama, S. Gram-negative Organisms from Patients with Community-Acquired Urinary Tract Infections and Associated Risk Factors for Antimicrobial Resistance: A Single-Center Retrospective Observational Study in Japan. Antibiotics (Basel) 2020, 9. [Google Scholar] [CrossRef]
  35. Blahna, M.T.; Zalewski, C.A.; Reuer, J.; Kahlmeter, G.; Foxman, B.; Marrs, C.F. The role of horizontal gene transfer in the spread of trimethoprim-sulfamethoxazole resistance among uropathogenic Escherichia coli in Europe and Canada. J. Antimicrob. Chemother. 2006, 57, 666–672. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Wayne, P. Performance standards for antimicrobial susceptibility testing: 20th informational supplement. In CLSI Document M100-S20; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2010. [Google Scholar]
  37. Thomson, K.S.; Sanders, C.C. Detection of extended-spectrum beta-lactamases in members of the family Enterobacteriaceae: Comparison of the double-disk and three-dimensional tests. Antimicrob. Agents Chemother. 1992, 36, 1877–1882. [Google Scholar] [CrossRef] [Green Version]
  38. Montiel-Riquelme, F.; Calatrava-Hernández, E.; Gutiérrez-Soto, M.; Expósito-Ruiz, M.; Navarro-Marí, J.M.; Gutiérrez-Fernández, J. Clinical Relevance of Antibiotic Susceptibility Profiles for Screening Gram-negative Microorganisms Resistant to Beta-Lactam Antibiotics. Microorganisms 2020, 8. [Google Scholar] [CrossRef]
Table
Table 1. Primers used for PCR and sequencing of drug resistance-associated genes from Enterobacterales.
Table 1. Primers used for PCR and sequencing of drug resistance-associated genes from Enterobacterales.
Target GenePrimer NamePrimer Sequence (5′–3′)Annealing Temperature (°C)Amplicon/Product Size (bp)References
ESBL genesTEMF AGATCAGTTGGGTGCACGAG52 °C750[14]
R TGCTTAATCAGTGAGGCACC
SHVF GGGAAACGGAACTGAATGAG55 °C380[14]
R TTAGCGTTGCCAGTGCTCG
CTX-M1F TTAGGAARTGTGCCGCTGYA60 °C688[15]
R CGATATCGTTGGTGGTRCCAT
PERF GCTCCGATAATGAAAGCGT60 °C520[15]
R TTCGGCTTGACTCGGCTGA
VEBF CATTTCCCGATGCAAAGCGT60 °C648[15]
R CGAAGTTTCTTTGGACTCTG
PMQR geneqnrAF AGAGGATTTCTCACGCCAGG57 °C630[4]
R GCAGCACTATKACTCCCAAGG
qnrBF GGMATHGAAATTCGCCACTG57 °C264[5]
R TTTGCYGYYCGCCAGTCGAA
qnrCF GGGTTGTACATTTATTGAATC57 °C447[16]
R TCCACTTTACGAGGTTCT
qnrDF CGAGATCAATTTACGGGGAATA57 °C582[17]
R AACAAGCTGAAGCGCCTG
qnrSF GCAAGTTCATTGAACAGGGT57 °C428[15]
R TCTAAACCGTCGAGTTCGGCG
aac(6′)-Ib-crF TTGGAAGCGGGGACGGAM52 °C260[18]
R ACACGGCTGGACCATA
oqxAF GACAGCGTCGCACAGAATG62 °C339[4]
R GGAGACGAGGTTGGTATGGA
oqxBF CGAAGAAAGACCTCCCTACCC62 °C240[4]
R CGCCGCCAATGAGATACA
qepAF GCAGGTCCAGCAGCGGGTAG62 °C218[19]
R CTTCCTGCCCGAGTATCGTG
AME genesaac(2′)-Ia,F AGAAGCGCTTTACGATTTATTA55 °C406[20]
R GACTCCGCCTTCTTCTTCAA55 °C
aac(3)-IaF GCAGTCGCCCTAAAACAAA55 °C441[20]
R CACTTCTTCCCGTATGCCCAACTT
aac(3)-IbF GCAGTCGCCCTAAAACAAA55 °C417[20]
R GGATCGTCACCGTAGTCTGC
aac(3)-IIaF GGCAATAACGGAGGCGCTTCAAAA55 °C563[20]
R TTCCAGGCATCGGCATCTCATACG
aac(6′)-IaF ATGAATTATCAAATTGTG55 °C558[20]
R TTACTCTTTGATTAAACT
aac(6′)-IbF CAAAGTTAGGCATCACA55 °C540[20]
R ACCTGTACAGGATGGAC
aac(6′)-IcF CTACGATTACGTCAACGGCTGC55 °C130[20]
R TTGCTTCGCCCACTCCTGCACC
ant(2″)-IaF ACGCCGTGGGTCGATGTTTGATGT55 °C572[20]
R CTTTTCCGCCCCGAGTGAGGTG
ant(3″)-IaF TCGACTCAACTATCAGAGG55 °C245[20]
R ACAATCGTGACTTCTACAGCG
ant(4″)-IIaF CCGGGGCGAGGCGAGTGC55 °C423[20]
R TACGTGGGCGGATTGATGGGAACC
aph(3′)-IaF CGAGCATCAAATGAAACTGC55 °C625[20]
R GCGTTGCCAATGATGTTACAG
aph(3″)-IaF CGGCGTGGGCGGCGACTG55 °C557[20]
R CCGGATGGAGGACGATGTTGG
aph(3″)-IbF GTGGCTTGCCCCGAGGTCATCA55 °C612[20]
R CCAAGTCAGAGGGTCCAATC
armAF ATTTTAGATTTTGGTTGTGGC54.5 °C101[21]
R ATCTCAGCTCTATCAATATCG
R TACGTGGGCGGATTGATGGGAACC
TMP-SMX resistance genessul1F CGGCGTGGGCTACCTGAACG55 °C432[22]
R GCCGATCGCGTGAAGTTCCG
sul2F GCGCTCAAGGCAGATGGCATT53 °C293[22]
R GCGTTTGATACCGGCACCCGT
dfrA1F TGGAGTTATCGGGAATGGC34 °C334[22]
R AACATCACCTTCCGGCTCG
Table
Table 2. Antibiotic susceptibility pattern of the Enterobacterales isolates obtained from wound, respiratory tract and blood and body fluid specimens.
Table 2. Antibiotic susceptibility pattern of the Enterobacterales isolates obtained from wound, respiratory tract and blood and body fluid specimens.
Antibiotics Organisms
Escherichia coli, N = 58 (%)Klebsiella Pneumoniae, N = 74 (%)Proteus mirabilis, N = 15 (%)Citrobacter freundii, N = 13 (%)Klebsiella oxytoca, N = 11 (%)Enterobacter cloacae, N = 9 (%)Proteus vulgaris, N = 3 (%)Morganella morganii, N = 3 (%)
Ampicillin55 (94.83)-15 (100)-----
Cefazolin49 (84.48)69 (93.24)13 (86.67)12 (92.31)10 (90.91)7 (77.78)3 (100)3 (100)
Amoxicillin-clavulanic acid38 (65.52)64 (86.49)12 (80)-8 (72.73)---
Cefotaxime48 (82.76)63 (85.14)9 (60)13 (100)8 (72.73)9 (100)2 (66.67)2 (66.67)
Cefepime46 (79.31)41 (55.41)10 (66.67)11 (84.62)9 (81.82)5 (55.56)1 (33.33)2 (66.67)
Ceftazidime52 (89.66)66 (89.19)13 (86.67)11 (84.62)11 (100)9 (100)2 (66.67)3 (100)
Ceftriaxone50 (86.21)71 (95.95)8 (53.33)13 (100)11 (100)7 (77.78)1 (33.33)2 (66.67)
Cefoxitin41 (70.69)64 (86.49)11 (73.33)-7 (63.64)-2 (66.67)1 (33.33)
Cefpodoxime52 (89.66)66 (89.19)7 (46.67)10 (76.92)11 (100)9 (100)--
Cefuroxime50 (86.21)69 (93.24)9 (60)11 (84.62)10 (90.91)7 (77.78)2 (66.67)2 (66.67)
Ceftizoxime47 (81.03)67 (90.54)10 (66.67)10 (76.92)8 (72.73)9 (100)2 (66.67)2 (66.67)
Imipenem22 (37.93)30 (40.54)12 (80)7 (53.85)6 (54.55)3 (33.33)00
Meropenem27 (46.55)32 (43.24)11 (73.33)7 (53.85)6 (54.55)3 (33.33)1 (33.33)0
Aztreonam54 (93.1)68 (91.89)12 (80)10 (76.92)11 (100)9 (100)1 (33.33)2 (66.67)
Gentamicin40 (68.97)46 (62.16)7 (46.67)5 (38.46)4 (36.36)8 (88.89)2 (66.67)2 (66.67)
Tobramycin45 (77.59)50 (67.57)5 (33.33)7 (53.85)6 (54.55)7 (77.78)-1 (33.33)
Amikacin32 (55.17)39 (52.7)3 (20)3 (23.08)5 (45.45)6 (66.67)1 (33.33)-
Kanamycin40 (68.97)36 (48.65)8 (53.33)6 (46.15)6 (54.55)9 (100)2 (66.67)1 (33.33)
Ciprofloxacin45 (77.59)65 (87.84)11 (73.33)8 (61.54)6 (54.55)4 (44.44)1 (33.33)2 (66.67)
Levofloxacin32 (55.17)56 (75.68)11 (73.33)7 (53.85)8 (72.73)6 (66.67)2 (66.67)2 (66.67)
Nalidixic acid40 (68.97)64 (86.49)12 (80)5 (38.46)8 (72.73)5 (55.56)1 (33.33)2(66.67)
Gatifloxacin46 (79.31)62 (83.78)10 (66.67)6 (46.15)7 (63.64)4 (44.44)2 (66.67)2 (66.67)
Moxifloxacin42 (72.41)59 (79.73)12 (80)7 (53.85)7 (63.64)3 (33.33)1 (33.33)2 (66.67)
Trimethoprim- sulfamethoxazole57 (98.2865 (87.84)15 (100)11 (84.62)9 (81.82)9 (100)2 (66.67)3 (100)
Table
Table 3. Distribution of Extended-spectrum beta-lactamases (ESBL) and non-beta-lactamase encoding genes in genotypically confirmed strains of ESBL producing Enterobacterales.
Table 3. Distribution of Extended-spectrum beta-lactamases (ESBL) and non-beta-lactamase encoding genes in genotypically confirmed strains of ESBL producing Enterobacterales.
Type of ResistanceOrganisms
Escherichia coli, N = 53 (%)Klebsiella pneumoniae, N = 69 (%)Proteus mirabilis, N = 13 (%)Citrobacter freundii, N = 12 (%)Klebsiella oxytoca, N = 9 (%)Enterobacter cloacae, N = 9 (%)Proteus vulgaris, N = 3 (%)Morganella morganii, N = 3 (%)
ESBL
TEM46 (86.8)58 (84.06)12 92.31)9 (75)7 (77.78)7 (77.78)3 (100)3 (100)
CTX-M39 (73.6)61 (88.41)8 (61.54)8 (66.67)6 (66.67)4 (44.44)NDND
SHV29 (54.7)30 (43.48)2 (15.39)4 (33.33)7 (77.78)3 (33.33)NDND
PER8 (15.1)13 (18.84)3 (23.08)3 (25)2 (22.22)3 (33.33)1 (33.33)ND
VEB1 (1.89)5 (7.25)8 (61.54)ND1 (11.11)2 (22.22)NDND
PMQR
qnr A3 (5.66)ND8 (61.54)NDNDND2 (66.67)ND
qnrB12 (22.6)36 (52.17)ND6 (50)5 (55.56)NDND1 (33.33)
qnrC4 (7.55)NDNDNDNDNDNDND
qnrD7 (13.2)17 (24.64)NDND3 (33.33)NDNDND
qnrS11 (20.8)3 (4.35)9 (69.23)NDND3 (33.33)NDND
Aac-ib-cr32 (60.4)51 (73.91)7 (53.85)7 (58.33)6 (66.67)2 (22.22)3 (100)ND
oqxA14 (26.4)58 (84.06)9 (69.23)ND4 (44.44)2 (22.22)NDND
oqxB21 (39.6)62 (89.86)8 (61.54)ND3 (33.33)NDNDND
qepA5 (9.43)NDNDNDNDNDNDND
AME
aac(3)-Ib2 (3.77)4 (5.8)ND3 (25)1 (11.11)1 (11.11)NDND
aac(3)-Ia6 (11.3)NDND1 (8.33)NDNDNDND
aac(3)-IIa18 (34)19 (27.54)1(7.69)3 (25)2 (22.22)3 (33.33)ND1 (33.33)
aac(6′)-Ib28 (52.8)46 (66.67)3 (23.08)2 (16.67)4 (44.44)1 (11.11)ND1 (33.33)
ant(2”)-Ia06 (8.7)NDND1 (11.11)2 (22.22)NDND
ant(3”)-Ia22 (41.5)17 (24.64)2 (15.39)3 (25)ND1 (11.11)1 (33.33)ND
ant(4”)-IIa8 (15.1)4(5.797)1 (7.69)NDNDNDNDND
aph(3′)-Ia16 (30.2)30 (43.48)1 (7.69)ND1 (11.11)NDNDND
aph(3”)-Ib20 (37.7)15 (21.74)1 (7.69)ND2 (22.22)2 (22.22)NDND
armA5 (9.43)10 (14.49)NDNDNDNDNDND
TMP-SMX
sul135 (66)46 (66.67)6 (46.15)7 (58.33)6 (66.67)5 (55.56)2 (66.67)1 (33.33)
sul29 (17)6 (8.7)NDND1 (11.11)1 (11.11)NDND
dfrA120 (37.7)28 (40.58)2 (15.39)4 (33.33)1 (11.11)2 (22.22)1 (33.33)1 (33.33)
ND: Not detected.
Table
Table 4. Coexistence of ESBL with PMQR, AME and TMP-SMX genes in Enterobacterales.
Table 4. Coexistence of ESBL with PMQR, AME and TMP-SMX genes in Enterobacterales.
Name of the GeneName of the OrganismTotal Number of IsolatesESBL Genes
PMQRTEMCTX-MSHVPERVEB
qnr AEscherichia coli94341ND
Proteus mirabilis874124
Proteus vulgaris22NDND1ND
qnrBEscherichia coli12758NDND
Klebsiella pneumonia3630331553
Citrobacter freundii65311ND
Klebsiella oxytoca542311
Morganella morganii11NDNDNDND
qnrCEscherichia coli442NDNDND
qnrDEscherichia coli77742ND
Klebsiella pneumonia1715131272
Klebsiella oxytoca33ND1ND1
qnrSEscherichia coli11911131
Klebsiella pneumonia33ND211
Proteus mirabilis994226
Enterobacter cloacae331ND11
Aac-ib-crEscherichia coli323029981
Klebsiella pneumonia51464330135
Proteus mirabilis763125
Citrobacter freundii754210
Klebsiella oxytoca654521
Enterobacter cloacae221ND11
Proteus vulgaris33NDND1ND
oqxAEscherichia coli141096NDND
Klebsiella pneumonia58495030135
Proteus mirabilis985125
Klebsiella oxytoca431211
Enterobacter cloacae221ND11
oqxBEscherichia coli21161313NDND
Klebsiella pneumonia62535430135
Proteus mirabilis884225
Klebsiella oxytoca33ND1ND1
qepAEscherichia coli5314NDND
AME
aac(3)-IbEscherichia coli222NDNDND
Klebsiella pneumonia441221
Citrobacter freundii3132NDND
Klebsiella oxytoca11NDNDNDND
Enterobacter cloacae11NDND1ND
aac(3)-IaEscherichia coli66643ND
Citrobacter freundii1ND11NDND
aac(3)-IIaEscherichia coli181618441
Klebsiella pneumonia191718135ND
Proteus mirabilis1111ND1
Citrobacter freundii331ND1ND
Klebsiella oxytoca22NDNDND1
Enterobacter cloacae331ND11
Morganella morganii11NDNDNDND
aac(6′)-IbEscherichia coli282628881
Klebsiella pneumonia46413830135
Proteus mirabilis332112
Citrobacter freundii2ND22NDND
aac(6′)-IbKlebsiella oxytoca431211
Enterobacter cloacae11NDNDND1
Morganella morganii11NDNDNDND
ant(2”)-IaKlebsiella pneumonia64662ND
Klebsiella oxytoca11NDNDNDND
Enterobacter cloacae221ND11
ant(3”)-IaEscherichia coli22191793ND
Klebsiella pneumonia171515138ND
Proteus mirabilis221112
Citrobacter freundii331ND1ND
Enterobacter cloacae111ND1ND
Proteus vulgaris11NDND1ND
ant(4”)-IIaEscherichia coli88831ND
Klebsiella pneumonia4442NDND
Proteus mirabilis11NDND11
aph(3′)-IaEscherichia coli16161685ND
Klebsiella pneumonia30272522111
Proteus mirabilis11NDND11
Klebsiella oxytoca11NDNDNDND
aph(3”)-IbEscherichia coli20171593ND
Klebsiella pneumonia151514105ND
Proteus mirabilis11NDND11
Klebsiella oxytoca22NDNDND2
Enterobacter cloacae221ND11
armAEscherichia coli5225NDND
Klebsiella pneumonia1010953
TMP-SMX resistance genes
sul1Escherichia coli3531291081
Klebsiella pneumonia46413830135
Proteus mirabilis663124
Citrobacter freundii75421ND
Klebsiella oxytoca653421
Enterobacter cloacae543222
Proteus vulgaris22NDND1ND
Morganella morganii11NDNDNDND
sul2Escherichia coli9744NDND
Klebsiella pneumonia663222
Klebsiella oxytoca11NDNDNDND
Enterobacter cloacae111NDND1
dfrA1Escherichia coli201820551
Klebsiella pneumonia28262318102
Proteus mirabilis221112
Citrobacter freundii4232NDND
Klebsiella oxytoca11NDNDNDND
Enterobacter cloacae221ND11
Proteus vulgaris11NDND1ND
Morganella morganii11NDNDNDND
ND: Not detected.
Table
Table 5. Comparison of origin of strain and type of resistance genes.
Table 5. Comparison of origin of strain and type of resistance genes.
Origin of Strain
Type of Resistance GeneWound SpecimensRespiratory Tract SpecimensBlood and Body Fluids
N = 97 (%)N = 44 (%)N = 30 (%)
ESBL
TEM85 (87.62)35 (79.54)25 (83.33)
CTX-M70 (72.16)34 (77.27)22 (73.33)
SHV40 (41.23)19 (43.18)16 (53.33)
PER29 (29.89)ND4 (13.3)
VEB14 (14.43)1 (2.27)2 (6.6)
PMQR
qnrA13 (13.4)NDND
qnrB19 (19.58)17 (38.63)24 (80)
qnrCNDND4 (13.3)
qnrD27 (27.83)NDND
qnrS26 (26.8)NDND
aac(6′)-lb-cr76 (78.35)8 (18.18)24 (80)
oqxA43 (44.33)16 (36.36)28 (93.33)
oqxB39 (40.2)27 (61.36)28 (93.33)
qepANDND5 (16.66)
AMEs
aac(3)-Ib11 (11.34)NDND
aac(3)-Ia6 (6.19)ND1 (3.33)
aac(3)-IIa44 (45.36)ND3 (10)
aac(6′)-Ib62 (63.91)3 (6.82)20 (66.67)
ant(2”)-Ia9 (9.28)NDND
ant(3”)-Ia33 (34)ND13 (41.94)
ant(4”)-IIa13 (13.4)NDND
aph(3′)-Ia39 (40.21)ND9 (30)
aph(3”)-Ia1 (1.03)NDND
aph(3”)-Ib25 (25.77)ND15 (50)
armA8 (8.24)4 (9.09)3 (10)
TMP-SMX resistance gene
sul 178 (80.41)3 (6.82)27 (90)
sul 28 (8.24)ND9 (30)
dfr A59 (60.82)NDND
ND: Not detected.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Shinu, P.; Bareja, R.; Nair, A.B.; Mishra, V.; Hussain, S.; Venugopala, K.N.; Sreeharsha, N.; Attimarad, M.; Rasool, S.T. Monitoring of Non-β-Lactam Antibiotic Resistance-Associated Genes in ESBL Producing Enterobacterales Isolates. Antibiotics 2020, 9, 884. https://0-doi-org.brum.beds.ac.uk/10.3390/antibiotics9120884

AMA Style

Shinu P, Bareja R, Nair AB, Mishra V, Hussain S, Venugopala KN, Sreeharsha N, Attimarad M, Rasool ST. Monitoring of Non-β-Lactam Antibiotic Resistance-Associated Genes in ESBL Producing Enterobacterales Isolates. Antibiotics. 2020; 9(12):884. https://0-doi-org.brum.beds.ac.uk/10.3390/antibiotics9120884

Chicago/Turabian Style

Shinu, Pottathil, Rajesh Bareja, Anroop B. Nair, Vashishth Mishra, Snawar Hussain, Katharigatta N. Venugopala, Nagaraja Sreeharsha, Mahesh Attimarad, and Sahibzada Tasleem Rasool. 2020. "Monitoring of Non-β-Lactam Antibiotic Resistance-Associated Genes in ESBL Producing Enterobacterales Isolates" Antibiotics 9, no. 12: 884. https://0-doi-org.brum.beds.ac.uk/10.3390/antibiotics9120884

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop