Virulence Structure and Genetic Diversity of Blumeria graminis f. sp. avenae from Different Regions of Europe
Abstract
:1. Introduction
2. Results
2.1. Virulence Analysis
2.2. Genetic Diversity Based on ISSR and SCoT Markers
3. Discussion
4. Materials and Methods
4.1. Virulence Analysis
4.2. Genetic Diversity Based on ISSR and SCoT Molecular Markers
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Dean, R.; Van Kan, J.; Pretorius, Z.; Hammond-Kosack, K.; Di Pietro, A.; Spanu, P.D.; Rudd, J.J.; Dickman, M.; Kahmann, R.; Ellis, J.; et al. The Top 10 fungal pathogens in molecular plant pathology. Mol. Plant Pathol. 2012, 13, 414–430. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Inuma, T.; Khodaparast, S.A.; Takamatsu, S. Multilocus phylogenetic analyses within Blumeria graminis, a powdery mildew fungus of cereals. Mol. Phylogenet. Evol. 2007, 44, 741–751. [Google Scholar] [CrossRef] [PubMed]
- Troch, V.; Audenaert, K.; Vanheule, A.; Bekaert, B.; Hofte, M.; Haesaert, G. Evaluation of Resistance to Powdery Mildew in Triticale Seedlings and Adult Plants. Plant Dis. 2013, 97, 410–417. [Google Scholar] [CrossRef] [Green Version]
- Lawes, D.A.; Hayes, J.D. The effect of mildew (Erysiphe graminis f. sp. avenae) on spring oats. Plant Pathol. 1965, 14, 125–128. [Google Scholar] [CrossRef]
- Aung, T.; Thomas, H.; Jones, I.T. The transfer of the gene for mildew resistance from Avena barbata (4x) into the cultivated oat A. sativa by an induced translocation. Euphytica 1977, 26, 623–632. [Google Scholar] [CrossRef]
- Jones, I.T.; Roderick, H.W.; Clifford, B.C. The integration of host resistance with fungicides in the control of oat powdery mildew. Ann. Appl. Biol. 1987, 110, 591–602. [Google Scholar] [CrossRef]
- Różewicz, M.; Wyzińska, M.; Grabiński, J. The most important fungal diseases of cereals—Problems and possible solutions. Agronomy 2021, 11, 714. [Google Scholar] [CrossRef]
- Cowger, C.; Brown, J.K.M. Blumeria graminis (powdery mildew of grasses and cereals). Invasive Species Compendium. Available online: https://www.cabi.org/isc/datasheet/22075 (accessed on 22 April 2022).
- Menardo, F.; Wicker, T.; Keller, B. Reconstructing the Evolutionary History of Powdery Mildew lineages (Blumeria graminis) at different evolutionary time scales with NGS data. Genome Biol. Evol. 2017, 9, 446–456. [Google Scholar] [CrossRef] [Green Version]
- Liu, N.; Liu, Z.L.; Gong, G.; Zhang, M.; Wang, X.; Zhou, Y.; Qi, X.; Chen, H.; Yang, J.; Luo, P.; et al. Virulence Structure of Blumeria graminisf. sp. triticiand Its Genetic Diversity by ISSR and SRAP Profiling Analyses. PLoS ONE 2015, 10, e0130881. [Google Scholar]
- McDonald, B.A.; Linde, C. Pathogen population genetics, evolutionary potential, and durable resistance. Annu. Rev. Phytopathol. 2002, 40, 349–379. [Google Scholar] [CrossRef] [Green Version]
- Brown, J.K.M. The choice of molecular marker methods for population genetic studies of plant pathogens. New Phytol. 1996, 133, 183–195. [Google Scholar] [CrossRef]
- Sharma, T.R. Molecular Diagnosis and Application of DNA Markers in the Management of Fungal and Bacterial Plant Diseases. Indian J. Biotechnol. 2003, 2, 99–109. [Google Scholar]
- Schnieder, F.; Koch, G.; Jung, C.; Verreet, J.-A. The application of molecular markers for genetic characterization of Septoria tritici populations. J. Plant Dis. Prot. 1998, 105, 452–461. [Google Scholar]
- Komínková, E.; Dreiseitl, A.; Malečková, E.; Doležel, J.; Valárik, M. Genetic Diversity of Blumeria graminis f. sp. hordei in Central Europe and Its Comparison with Australian Population. PLoS ONE 2016, 11, e0167099. [Google Scholar] [CrossRef] [PubMed]
- Xu, Z.; Duan, X.; Zhou, Y.; Guo, Q.; Yao, Q.; Cao, S. Population Genetic Analysis of Blumeria graminis f. sp. tritici in Qinghai Province, China. J. Integr. Agric. 2014, 13, 1952–1961. [Google Scholar] [CrossRef]
- Wu, P.; Xie, J.; Hu, J.; Qiu, D.; Liu, Z.; Li, J.; Li, M.; Zhang, H.; Yang, L.; Liu, H.; et al. Development of Molecular Markers Linked to Powdery Mildew Resistance Gene Pm4b by Combining SNP Discovery from Transcriptome Sequencing Data with Bulked Segregant Analysis (BSR-Seq) in Wheat. Front. Plant Sci. 2018, 9, 95. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Okoń, S.M.; Ociepa, T. Virulence structure of the Blumeria graminis DC.f. sp. avenae populations occurring in Poland across 2010–2013. Eur. J. Plant Pathol. 2017, 149, 711–718. [Google Scholar] [CrossRef]
- Cieplak, M.; Terlecka, K.; Ociepa, T.; Zimowska, B.; Okoń, S. Virulence Structure of Blumeria graminis f. sp. avenae Populations in Poland across 2014–2015. Plant Pathol. J. 2021, 37, 115–123. [Google Scholar] [CrossRef]
- Okoń, S.; Cieplak, M.; Kuzdraliński, A.; Ociepa, T. New pathotype nomenclature for better characterisation the virulence and diversity of Blumeria graminis f. sp. avenae populations. Agronomy 2021, 11, 1852. [Google Scholar] [CrossRef]
- Zhu, J.H.; Wang, J.M.; Jia, Q.J.; Yang, J.M.; Zhou, Y.J.; Lin, F.; Hua, W.; Shang, Y. Pathotypes and Genetic Diversity of Blumeria graminis f. sp. hordei in the Winter Barley Regions in China. Agric. Sci. China 2010, 9, 1787–1798. [Google Scholar] [CrossRef]
- Tucker, M.A.; Jayasena, K.; Ellwood, S.R.; Oliver, R.P. Pathotype variation of barley powdery mildew in Western Australia. Australas. Plant Pathol. 2013, 42, 617–623. [Google Scholar] [CrossRef] [Green Version]
- Bai, J.; Liu, J.; Jiao, W.; Sa, R.; Zhang, N.; Jia, R. Proteomic analysis of salt-responsive proteins in oat roots (Avena sativa L.). J. Sci. Food Agric. 2016, 96, 3867–3875. [Google Scholar] [CrossRef] [PubMed]
- Xue, L.H.; Li, C.J.; Zhao, G.Q. First Report of Powdery Mildew Caused by Blumeria graminis on Avena sativa in China. Plant Dis. 2017, 101, 1954. [Google Scholar] [CrossRef]
- Zhao, Z.-H.; Huang, J.; Lu, M.; Wang, X.-M.; Wu, L.-F.; Wu, X.-F.; Zhao, X.; Li, H.-J. Virulence and Genetic Diversity of Blumeria graminis f. sp tritici Collected from Shandong and Hebei Provinces. Acta Agron. Sin. 2013, 39, 1377. [Google Scholar] [CrossRef]
- Lalošević, M.; Jevtić, R.; Župunski, V.; Maširević, S.; Orbović, B. Virulence Structure of the Wheat Powdery Mildew Population in Serbia. Agronomy 2021, 12, 45. [Google Scholar] [CrossRef]
- Aoun, M.; Kolmer, J.A.; Breiland, M.; Richards, J.; Brueggeman, R.S.; Szabo, L.J.; Acevedo, M. Genotyping-by-sequencing for the study of genetic diversity in puccinia triticina. Plant Dis. 2020, 104, 752–760. [Google Scholar] [CrossRef] [Green Version]
- Walter, S.; Ali, S.; Kemen, E.; Nazari, K.; Bahri, B.A.; Enjalbert, J.; Hansen, J.G.; Brown, J.K.M.; Sicheritz-Pontén, T.; Jones, J.; et al. Molecular markers for tracking the origin and worldwide distribution of invasive strains of Puccinia striiformis. Ecol. Evol. 2016, 6, 2790–2804. [Google Scholar] [CrossRef] [Green Version]
- Gultyaeva, E.; Dmitriev, A.; Kosman, E. Regional diversity of Russian populations of Pucciniaï triticina in 2007. Can. J. Plant Pathol. 2012, 34, 213–223. [Google Scholar] [CrossRef]
- Tucker, M.A.; Moffat, C.S.; Ellwood, S.R.; Tan, K.C.; Jayasena, K.; Oliver, R.P. Development of genetic SSR markers in Blumeria graminis f. sp. hordei and application to isolates from Australia. Plant Pathol. 2015, 64, 337–343. [Google Scholar] [CrossRef]
- Wu, X.X.; Xu, X.F.; Ma, D.X.; Chen, R.Z.; Li, T.Y.; Cao, Y.Y. Virulence structure and its genetic diversity analyses of Blumeria graminis f. sp. Tritici isolates in China. BMC Evol. Biol. 2019, 19, 183. [Google Scholar] [CrossRef]
- Wyand, R.A.; Brown, J.K.M. Genetic and forma specialis diversity in Blumeria graminis of cereals and its implications for host-pathogen co-evolution. Mol. Plant Pathol. 2003, 4, 187–198. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Spanu, P.D.; Abbott, J.C.; Amselem, J.; Burgis, T.A.; Soanes, D.M.; Stüber, K.; Ver Loren van Themaat, E.; Brown, J.K.M.; Butcher, S.A.; Gurr, S.J.; et al. Genome Expansion and Gene Loss in powdery mildew fungi reveal tradeoffs in extreme parasitism. Science 2010, 330, 1543–1546. [Google Scholar] [CrossRef] [PubMed]
- Wicker, T.; Oberhaensli, S.; Parlange, F.; Buchmann, J.P.; Shatalina, M.; Roffler, S.; Ben-david, R.; Doležel, J.; Šimková, H.; Schulze-lefert, P.; et al. The wheat powdery mildew genome shows the unique evolution of an obligate biotroph. Nat. Genet. 2013, 45, 1092–1096. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zietkiewicz, E.; Rafalski, A.; Labuda, D. Genome Fingerprinting by Simple Sequence Repeat (SSR)-Anchored Polymerase Chain Reaction Amplification. Genomics 1994, 20, 176–183. [Google Scholar] [CrossRef] [PubMed]
- Spackman, M.E.; Ogbonnaya, F.C.; Brown, J.S. Hypervariable RAPD, ISSR and SSR markers generate robust taxonomic groups among Puccinia striiformis formae speciales of importance to Australian agriculture. Australas. Plant Pathol. 2010, 39, 226–233. [Google Scholar] [CrossRef]
- Lin, Y.; Fuping, L.; Shanshan, L.; Xiao, W.; Ruixuan, Z.; Ziqin, L.; Hui, Z. ISSR analysis of Fusarium oxysporum Schl. in Hebei province. Procedia Environ. Sci. 2012, 12, 1237–1242. [Google Scholar] [CrossRef] [Green Version]
- Bayraktar, H.; Dolar, F.S.; Maden, S. Use of RAPD and ISSR Markers in Detection of Genetic Variation and Population Structure among Fusarium oxysporum f. sp. ciceris Isolates on Chickpea in Turkey. J. Phytopathol. 2008, 156, 146–154. [Google Scholar] [CrossRef]
- Collard, B.C.Y.; Mackill, D.J. Start Codon Targeted (SCoT) Polymorphism: A Simple, Novel DNA Marker Technique for Generating Gene-Targeted Markers in Plants. Plant Mol. Biol. Rep. 2009, 27, 86–93. [Google Scholar] [CrossRef]
- Gajera, H.P.; Hirpara, D.G.; Katakpara, Z.A.; Patel, S.V.; Golakiya, B.A. Molecular evolution and phylogenetic analysis of biocontrol genes acquired from SCoT polymorphism of mycoparasitic Trichoderma koningii inhibiting phytopathogen Rhizoctonia solani Kuhn. Infect. Genet. Evol. 2016, 45, 383–392. [Google Scholar] [CrossRef]
- Nath, V.S.; Senthil, M.; Hegde, V.M.; Jeeva, M.L.; Misra, R.S.; Veena, S.S.; Raj, M. Evaluation of fungicides on Indian isolates of Phytophthora colocasiae causing leaf blight of taro. Arch. Phytopathol. Plant Prot. 2013, 46, 548–555. [Google Scholar] [CrossRef]
- Longya, A.; Talumphai, S.; Jantasuriyarat, C. Morphological Characterization and Genetic Diversity of Rice Blast Fungus, Pyricularia oryzae, from Thailand Using ISSR and SRAP Markers. J. Fungi 2020, 6, 38. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mutlu, N.; Boyaci, F.H.; Göçmen, M.; Abak, K. Development of SRAP, SRAP-RGA, RAPD and SCAR markers linked with a Fusarium wilt resistance gene in eggplant. Theor. Appl. Genet. 2008, 117, 1303–1312. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Polat, I.; Baysal, Ö.; Mercati, F.; Kitner, M.; Cohen, Y.; Lebeda, A.; Carimi, F. Characterization of Pseudoperonospora cubensis isolates from Europe and Asia using ISSR and SRAP molecular markers. Eur. J. Plant Pathol. 2014, 139, 641–653. [Google Scholar] [CrossRef]
- Hsam, S.L.K.; Peters, N.; Paderina, E.V.; Felsenstein, F.; Oppitz, K.; Zeller, F.J. Genetic studies of powdery mildew resistance in common oat (Avena sativa L.) I. Cultivars and breeding lines grown in Western Europe and North America. Euphytica 1997, 96, 421–427. [Google Scholar] [CrossRef]
- Hsam, S.L.K.; Pederina, E.; Gorde, S.; Zeller, F.J. Genetic studies of powdery mildew resistance in common oat (Avena staiva L.). II. Cultivars and breeding lines grown in Northern and Eastern Europe. Hereditas 1998, 129, 227–230. [Google Scholar] [CrossRef]
- Okoń, S.M.; Ociepa, T. Effectiveness of new sources of resistance against oat powdery mildew identified in A. sterilis. J. Plant Dis. Prot. 2018, 125, 505–510. [Google Scholar] [CrossRef] [Green Version]
- Okoń, S.; Kowalczyk, K. Screening oat landraces for resistance to Blumeria graminis f. sp. avenae. J. Plant Pathol. 2020, 102, 893–898. [Google Scholar] [CrossRef] [Green Version]
- Mains, E.B. Inheritance of resistance to powdery mildew, Erysiphe graminis tritici, in wheat. Phytopathology 1934, 24, 1257–1261. [Google Scholar]
- Dreiseitl, A.; Kosman, E. Virulence phenotypes of Blumeria graminis f. sp. hordei in South Africa. Eur. J. Plant Pathol. 2015, 136, 113–121. [Google Scholar] [CrossRef]
- Kosman, E. Difference and diversity of plant pathogen populations: A new approach for measuring. Phytopathology 1996, 86, 1152–1155. [Google Scholar]
- Kosman, E.; Leonard, K.J. Conceptual analysis of methods applied to assessment of diversity within and distance between populations with asexual or mixed mode of reproduction. New Phytol. 2007, 174, 683–696. [Google Scholar] [CrossRef] [PubMed]
- Schachtel, G.A.; Dinoor, A.; Herrmann, A.; Kosman, E. Comprehensive Evaluation of Virulence and Resistance Data: A New Analysis Tool. Plant Dis. 2012, 96, 1060–1063. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Feehan, J.M.; Scheibel, K.E.; Bourras, S.; Underwood, W.; Keller, B.; Somerville, S.C. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing. J. Vis. Exp. 2017, 121, e55463. [Google Scholar] [CrossRef] [PubMed]
- Collard, B.C.Y.; Mackill, D.J. Marker-assisted selection: An approach for precision plant breeding in the twenty-first century. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2008, 363, 557–572. [Google Scholar] [CrossRef] [Green Version]
- Belaj, A.; Trujillo, I.; De La Rosa, R.; Rallo, L.; Giménez, M.J. Polymorphism and Discrimination Capacity of Randomly Amplified Polymorphic Markers in an Olive Germplasm Bank. J. Am. Soc. Hortic. Sci. 2001, 126, 64–71. [Google Scholar] [CrossRef] [Green Version]
- Prevost, A.; Wilkinson, M.J. A new system of comparing PCR primers applied to ISSR fingerprinting of potato cultivars. Theor. Appl. Genet. 1999, 98, 107–112. [Google Scholar] [CrossRef]
- Anderson, J.A.; Churchill, G.A.; Autrique, J.E.; Tanksley, S.D.; Sorrells, M.E. Optimizing parental selection for genetic linkage maps. Genome 1993, 36, 181–186. [Google Scholar] [CrossRef]
- Bergmann, F.; Gregorius, H.R. Comparison of the genetic diversities of various poplations of Norway spruce (Picea abies). In Proceedings of the Biochemical Genetics of Forest Trees; 1979; pp. 99–107. [Google Scholar]
- Nei, M.; Roychoudhury, A.K. Sampling variances of heterozygosity and genetic distance. Genetics 1975, 80, 223–226. [Google Scholar] [CrossRef]
- Brown, A.H.D.; Weir, B.S. Measuring genetic variability in plant populations. In Developments in Plant Genetics and Breeding; Elsevier: Amsterdam, The Netherlands, 1983; Volume 1, pp. 219–239. [Google Scholar]
- Nei, M. Genetic Distance between Populations. Am. Nat. 1972, 106, 283–292. [Google Scholar] [CrossRef]
- Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research—An update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef] [Green Version]
- Yeh, F.C.; Yang, R.-C. POPGENE VERSION 1.31 Microsoft Window-based Freeware for Population Genetic Analysis Quick User Guide A joint Project Development by New Feature in Current Version. 1999. [Google Scholar]
- Hammer, Ø.; Harper, D.A.T.; Ryan, P.D. Past: Paleontological statistics software package for education and data analysis. Palaeontol. Electron. 2001, 4, 1–9. [Google Scholar]
- Okoń, S.; Ociepa, T.; Paczos-Grzęda, E.; Kowalczyk, K. Analysis of the level of resistance of Polish oat cultivars (Avena sativa L.) to powdery mildew (Blumeria graminis DC. f. sp. avenae Em. Marchal.). Agron. Sci. 2016, 61, 51–60. [Google Scholar] [CrossRef]
Differential | Gene | Frequency (%) | |||||
---|---|---|---|---|---|---|---|
Czech Republic CZ | Finland FI | Ireland IE | Germany DE | Poland PL | Average | ||
Jumbo | Pm1 | 33 | 100 | 100 | 100 | 93 | 85 |
CC3678 | Pm2 | 0 | 0 | 0 | 0 | 0 | 0 |
Mostyn | Pm3 | 56 | 40 | 0 | 100 | 80 | 55 |
Av1860 | Pm4 | 0 | 0 | 0 | 0 | 0 | 0 |
Am27 | Pm5 | 0 | 0 | 0 | 50 | 3 | 11 |
Bruno | Pm6 | 100 | 100 | 50 | 100 | 83 | 87 |
APR122 | Pm7 | 0 | 0 | 0 | 0 | 8 | 2 |
Canyon | Pm7 | 0 | 50 | 0 | 100 | 83 | 47 |
Rollo | Pm3 + Pm8 | 0 | 100 | 40 | 20 | 18 | 36 |
AVE2406 | Pm9 | 0 | 100 | 100 | 20 | 28 | 50 |
AVE2925 | Pm10 | 100 | 100 | 100 | 40 | 50 | 78 |
CN113536 | Pm11 | 0 | 0 | 0 | 0 | 25 | 5 |
CN67383 | UA.ster. | 100 | 100 | 0 | 20 | 30 | 50 |
Pl51586 | UA.stri. | 0 | 0 | 0 | 0 | 10 | 2 |
Fuchs | - | 100 | 100 | 100 | 100 | 100 | 100 |
Population | Number of Isolates | No. of Different Pathotypes | Hs | Si | Sh | KWm |
---|---|---|---|---|---|---|
PL | 40 | 22 | 0.23 | 0.95 | 0.86 | 0.31 |
CZ | 10 | 3 | 0.06 | 0.57 | 0.43 | 0.10 |
FI | 10 | 3 | 0.07 | 0.58 | 0.41 | 0.12 |
IE | 10 | 3 | 0.07 | 0.58 | 0.41 | 0.12 |
DE | 10 | 5 | 0.13 | 0.74 | 0.64 | 0.20 |
Virulence | Molecular Markers | ||||||
---|---|---|---|---|---|---|---|
Populations | N | Nei Gst | Nm | Distance Based on ISSR | Distance Based on ISSR | Nm (ISSR) | Nm (SCoT) |
FI-CZ | 0.22 | 0.19 | 2.12 | 0.233 | 0.261 | 0.110 | 0.830 |
FI-DE | 0.26 | 0.24 | 1.63 | 0.279 | 0.264 | 0.099 | 0.154 |
FI-IE | 0.16 | 0.16 | 2.71 | 0.349 | 0.199 | 0.099 | 0.121 |
FI-PL | 0.20 | 0.19 | 2.17 | 0.185 | 0.178 | 1.277 | 0.998 |
IE-CZ | 0.26 | 0.23 | 1.66 | 0.264 | 0.125 | 0.141 | 0.242 |
IE-DE | 0.31 | 0.26 | 1.42 | 0.338 | 0.181 | 0.237 | 0.289 |
IE-PL | 0.21 | 0.19 | 2.08 | 0.231 | 0.143 | 0.849 | 1.055 |
DE-CZ | 0.25 | 0.23 | 1.68 | 0.221 | 0.137 | 0.330 | 0.352 |
DE-PL | 0.03 | 0.06 | 7.83 | 0.127 | 0.123 | 1.851 | 1.232 |
PL-CZ | 0.17 | 0.17 | 2.37 | 0.168 | 0.144 | 0.999 | 1.002 |
Assay | Primer | Primer Sequence | Amplified Bands | Polymorphic Bands | Percentage of Polymorphic Bands (%) | PIC | RP |
---|---|---|---|---|---|---|---|
ISSR | SR39 | GAGAGAGAGAGAGAGAGG | 12 | 11 | 91.67 | 0.37 | 11.27 |
SR41 | AGAGAGAGAGAGAGAGAGAGC | 14 | 10 | 71.43 | 0.24 | 8.7 | |
SR60 | CACCACCACCACCACCACCACT | 13 | 13 | 100 | 0.33 | 11.2 | |
SR17 | GAGAGAGAGAGAGAGAYC | 21 | 15 | 71.43 | 0.27 | 15.45 | |
SR22 | CACACACACACACACAG | 14 | 10 | 71.43 | 0.27 | 10.32 | |
SR31 | AGAGAGAGAGAGAGAGAGYC | 16 | 12 | 75.00 | 0.27 | 12.52 | |
SR37 | ACACACACACACACACC | 18 | 15 | 83.33 | 0.28 | 12.82 | |
SR40 | ACACACACACACAC ACT | 11 | 6 | 54.55 | 0.24 | 5.02 | |
SR42 | AGAGAGAGAGAGAGAGYA | 13 | 9 | 69.23 | 0.30 | 8.3 | |
SR46 | GAGAGAGAGAGAGAGAGAGAA | 16 | 12 | 75.00 | 0.31 | 11.52 | |
SR61 | ACACACACACACACACACG | 11 | 6 | 54.55 | 0.22 | 4.1 | |
SR86 | CACACACACACACA CAT | 16 | 12 | 75.00 | 0.24 | 14.9 | |
Average | 14.58 | 10.92 | 74.39 | 0.28 | 10.51 | ||
SCoT | SCoT12 | ACGACATGGCGACCAACG | 24 | 14 | 60.87 | 0.18 | 13.45 |
SCoT13 | ACGACATGGCGACCATCG | 17 | 10 | 58.82 | 0.21 | 11.4 | |
SCoT14 | ACGACATGGCGACCACGC | 12 | 6 | 50.00 | 0.15 | 7.87 | |
SCoT18 | ACCATGGCTACCACCGCC | 16 | 8 | 50.00 | 0.21 | 6.67 | |
SCoT19 | ACCATGGCTACCACCGGC | 16 | 8 | 50.00 | 0.19 | 6.75 | |
SCoT21 | ACGACATGGCGACCCACA | 17 | 1 | 41.18 | 0.12 | 6.35 | |
SCoT22 | AACCATGGCTACCACCAC | 12 | 10 | 83.33 | 0.36 | 10.47 | |
SCoT23 | CACCATGGCTACCACCAG | 16 | 8 | 50.00 | 0.17 | 4.67 | |
SCoT26 | ACCATGGCTACCACCGTC | 19 | 12 | 63.16 | 0.25 | 12.87 | |
SCoT32 | CCATGGCTACCACCGCAC | 14 | 7 | 50.00 | 0.18 | 8.02 | |
SCoT33 | CCATGGCTACCACCGCAG | 15 | 10 | 66.67 | 0.26 | 10.3 | |
SCoT34 | ACCATGGCTACCACCGCA | 15 | 7 | 46.67 | 0.18 | 5.92 | |
SCoT83 | CAATGGCTACCACTAACG | 20 | 8 | 40.00 | 0.13 | 6.50 | |
SCoT90 | CCATGGCTACCACCGGCA | 23 | 13 | 56.52 | 0.23 | 12.75 | |
Average | 16.86 | 8.71 | 54.80 | 0.20 | 8.86 |
Population | (P %) | (Na) | (Ne) | (He) | (I) |
---|---|---|---|---|---|
ISSR | |||||
FI | 4.60% | 0.724 | 1.023 | 0.014 | 0.021 |
CZ | 5.75% | 0.638 | 1.049 | 0.026 | 0.037 |
IE | 9.20% | 0.690 | 1.064 | 0.036 | 0.053 |
DE | 25.29% | 1.000 | 1.135 | 0.081 | 0.123 |
PL | 69.54% | 1.684 | 1.458 | 0.262 | 0.386 |
SCoT | |||||
FI | 2.55% | 0.821 | 1.014 | 0.008 | 0.012 |
CZ | 8.94% | 0.851 | 1.054 | 0.031 | 0.046 |
IE | 8.51% | 0.847 | 1.059 | 0.033 | 0.048 |
DE | 15.74% | 0.953 | 1.082 | 0.048 | 0.074 |
PL | 53.62% | 1.536 | 1.306 | 0.181 | 0.272 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cieplak, M.; Nucia, A.; Ociepa, T.; Okoń, S. Virulence Structure and Genetic Diversity of Blumeria graminis f. sp. avenae from Different Regions of Europe. Plants 2022, 11, 1358. https://0-doi-org.brum.beds.ac.uk/10.3390/plants11101358
Cieplak M, Nucia A, Ociepa T, Okoń S. Virulence Structure and Genetic Diversity of Blumeria graminis f. sp. avenae from Different Regions of Europe. Plants. 2022; 11(10):1358. https://0-doi-org.brum.beds.ac.uk/10.3390/plants11101358
Chicago/Turabian StyleCieplak, Magdalena, Aleksandra Nucia, Tomasz Ociepa, and Sylwia Okoń. 2022. "Virulence Structure and Genetic Diversity of Blumeria graminis f. sp. avenae from Different Regions of Europe" Plants 11, no. 10: 1358. https://0-doi-org.brum.beds.ac.uk/10.3390/plants11101358