Assessing Asymptomatic Malaria Carriage of Plasmodium falciparum and Non-falciparum Species in Children Resident in Nkolbisson, Yaoundé, Cameroon
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Site
2.2. Ethical Consideration
2.3. Study Design
2.4. Malaria Screening and Blood Sampling
2.5. DNA Extraction
2.6. Amplification of DNA
3. Results
3.1. The Characteristics of the Study Population
3.2. Malaria Prevalence by LM, RDT and PCR Methods
3.3. Prevalence of Plasmodium spp. Infections in Children
3.4. Diagnostic Test Performance Characteristics
3.5. Density of the Plasmodium Parasite
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Moyeh, M.N.; Ali, I.M.; Njimoh, D.L.; Nji, A.M.; Netongo, P.M.; Evehe, M.S.; Atogho-Tiedeu, B.; Ghogomu, S.M.; Mbacham, W.F. Comparison of the Accuracy of Four Malaria Diagnostic Methods in a High Transmission Setting in Coastal Cameroon. J. Parasitol. Res. 2019, 2019, 1–8. [Google Scholar] [CrossRef] [Green Version]
- Ogunfowokan, O.; Ogunfowokan, B.A.; Nwajei, A.I. Sensitivity and specificity of malaria rapid diagnostic test (mRDT CareStatTM) compared with microscopy amongst under five children attending a primary care clinic in southern Nigeria. Afr. J. Prim. Heal. Care Fam. Med. 2020, 12, 1–8. [Google Scholar] [CrossRef]
- World Health Organization. World Malaria Report 2020: 20 Years of Global Progress and Challenges; World Health Organization: Geneva, Switzerland, 2020; Licence: CC BY-NC-SA 3.0 IGO. [Google Scholar]
- Laishram, D.D.; Sutton, P.L.; Nanda, N.; Sharma, V.L.; Sobti, R.C.; Carlton, J.M.; Joshi, H. The complexities of malaria disease manifestations with a focus on asymptomatic malaria. Malar. J. 2012, 11, 29. [Google Scholar] [CrossRef] [Green Version]
- Mbohou, C.N.; Foko, L.P.K.; Nyabeyeu, H.N.; Tonga, C.; Nono, L.K.; Kangam, L.; Bunda, G.W.; Mbou, I.M.; Hondt, E.O.N.; Mbe, A.J.K.; et al. Malaria screening at the workplace in Cameroon. PLoS ONE 2019, 14, e0225219. [Google Scholar] [CrossRef]
- Halliday, K.E.; Witek-McManus, S.S.; Opondo, C.; Mtali, A.; Allen, E.; Bauleni, A.; Ndau, S.; Phondiwa, E.; Ali, D.; Kachigunda, V.; et al. Impact of school-based malaria case management on school attendance, health and education outcomes: A cluster randomised trial in southern Malawi. BMJ Glob. Health 2020, 5, e001666. [Google Scholar] [CrossRef] [Green Version]
- Snow, R.W.; Sartorius, B.; Kyalo, D.; Maina, J.; Amratia, P.; Mundia, C.W.; Bejon, M.; Noor, A.M. The prevalence of Plasmodium falciparum in sub Saharan Africa since 1900 Europe PMC Funders Group. Nature 2017, 550, 515–518. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Das, N.G.; Dhiman, S.; Talukdar, P.K.; Goswami, D.; Rabha, B.; Baruah, I.; Veer, V. Role of asymptomatic carriers and weather variables in persistent transmission of malaria in an endemic district of Assam, India. Infect. Ecol. Epidemiol. 2015, 5, 25442. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sumari, D.; Mwingira, F.; Selemani, M.; Mugasa, J.; Mugittu, K.; Gwakisa, P. Malaria prevalence in asymptomatic and symptomatic children in Kiwangwa, Bagamoyo district, Tanzania. Malar. J. 2017, 16, 222. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wanji, S.; Kimbi, H.K.; Eyong, J.E.; Tendongfor, N.; Ndamukong, J.L. Performance and usefulness of the Hexagon rapid diagnostic test in children with asymptomatic malaria living in the Mount Cameroon region. Malar. J. 2008, 7, 89. [Google Scholar] [CrossRef] [Green Version]
- Nankabirwa, J.; Brooker, S.J.; Clarke, S.E.; Fernando, D.; Gitonga, C.W.; Schellenberg, D.; Greenwood, B. Malaria in school-age children in A frica: An increasingly important challenge. Trop. Med. Int. Health 2014, 19, 1294–1309. [Google Scholar] [CrossRef] [PubMed]
- Heinemann, M.; Phillips, R.O.; Vinnemeier, C.D.; Rolling, C.C.; Tannich, E.; Rolling, T. High prevalence of asymptomatic malaria infections in adults, Ashanti Region, Ghana, 2018. Malar. J. 2020, 19, 1–7. [Google Scholar] [CrossRef]
- Pouokam, B.G.; Lemnyuy, A.W.B. Climate Compatible Development in Africa: Cameroon Case study. Tech. Rep. 2012, 2012, 1–26. [Google Scholar] [CrossRef]
- Bomdzele, E.J.; Molua, E.L.; Sotamenou, J.; Ticha, B.-B.M.; Ndive, E.L.; Shu, G.; Ngaiwi, M.E. Handbook of Climate Change Management. Handb. Clim. Chang. Manag. 2020. [Google Scholar] [CrossRef]
- Molua, E.L. Climatic trends in Cameroon: Implications for agricultural management. Clim. Res. 2006, 30, 255–262. [Google Scholar] [CrossRef] [Green Version]
- Prevention US Agency for International Development (USAID); Centers for Disease Control (CDC). US President’ s Malaria Initiative Thailand: Malaria Operational Plan FY; Prevention US Agency for International Development (USAID): Washington, DC, USA; Centers for Disease Control (CDC): Atlanta, GA, USA, 2020; pp. 1–94.
- WHO. Malaria Rapid Diagnostic Test Performance: Results of WHO Product Testing of Malaria RDTs: Round 8 (2016–2018); World Health Organization: Geneva, Switzerland, 2018; Volume 3. [Google Scholar]
- Putaporntip, C.; Hongsrimuang, T.; Seethamchai, S.; Kobasa, T.; Limkittikul, K.; Cui, L.; Jongwutiwes, S. Differential Prevalence of Plasmodium Infections and Cryptic Plasmodium knowlesi Malaria in Humans in Thailand. J. Infect. Dis. 2009, 199, 1143–1150. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Snounou, G.; Viriyakosol, S.; Zhu, X.P.; Jarra, W.; Pinheiro, L.; Rosario, V.E.D.; Thaithong, S.; Brown, K. High sensitivity of detection of human malaria parasites by the use of nested polymerase chain reaction. Mol. Biochem. Parasitol. 1993, 61, 315–320. [Google Scholar] [CrossRef]
- Centers for Disease Control (CDC); Prevention US Agency for International Development (USAID); US Department of State (US DOS). President’s Malaria Initiative Nigeria and m. O. P. F. 2019, President’ s Malaria Initiative Guinea Malaria Operational Plan FY; Centers for Disease Control (CDC): Atlanta, GA, USA; Prevention US Agency for International Development (USAID); US Department of State (US DOS): Washington, DC, USA, 2011; pp. 1–79.
- Niang, M.; Thiam, L.G.; Sane, R.; Diagne, N.; Talla, C.; Doucoure, S.; Faye, J.; Diop, F.; Badiane, A.; Diouf, B.; et al. Substantial asymptomatic submicroscopic Plasmodium carriage during dry season in low transmission areas in Senegal: Implications for malaria control and elimination. PLoS ONE 2017, 12, e0182189. [Google Scholar] [CrossRef] [PubMed]
- Bell, D.J.; Molyneux, M.E. Treatment of childhoodPlasmodium falciparummalaria: Current challenges. Expert Rev. Anti-infective Ther. 2007, 5, 141–152. [Google Scholar] [CrossRef]
- Noubouossie, D.; Tagny, C.T.; Same-Ekobo, A.; Mbanya, D. Asymptomatic carriage of malaria parasites in blood donors in Yaoundé. Transfus. Med. 2012, 22, 63–67. [Google Scholar] [CrossRef] [PubMed]
- Owusu-Ofori, A.; Gadzo, D.; Bates, I. Transfusion-transmitted malaria: Donor prevalence of parasitaemia and a survey of healthcare workers knowledge and practices in a district hospital in Ghana. Malar. J. 2016, 15, 234. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kwenti, T.E.; Njunda, L.A.; Tsamul, B.; Nsagha, S.D.; Assob, N.J.-C.; Tufon, K.A.; Meriki, D.H.; Orock, E.G. Comparative evaluation of a rapid diagnostic test, an antibody ELISA, and a pLDH ELISA in detecting asymptomatic malaria parasitaemia in blood donors in Buea, Cameroon. Infect. Dis. Poverty 2017, 6, 1–9. [Google Scholar] [CrossRef]
- Okyere, B.; Owusu-Ofori, A.; Ansong, D.; Buxton, R.; Benson, S.; Osei-Akoto, A.; Owiredu, E.-W.; Adjei, C.; Amuzu, E.X.; Boaheng, J.M.; et al. Point prevalence of asymptomatic Plasmodium infection and the comparison of microscopy, rapid diagnostic test and nested PCR for the diagnosis of asymptomatic malaria among children under 5 years in Ghana. PLoS ONE 2020, 15, e0232874. [Google Scholar] [CrossRef] [PubMed]
- Owusu, E.; Buabeng, V.; Dadzie, S.; Brown, C.A.; Grobusch, M.P.; Mens, P. Characteristics of asymptomatic Plasmodium spp. parasitaemia in Kwahu-Mpraeso, a malaria endemic mountainous district in Ghana, West Africa. Malar. J. 2016, 15, 1–10. [Google Scholar] [CrossRef] [Green Version]
- Kumari, P.; Sinha, S.; Gahtori, R.; Yadav, C.P.; Pradhan, M.M.; Rahi, M.; Pande, V.; Anvikar, A.R. Prevalence of Asymptomatic Malaria Parasitemia in Odisha, India: A Challenge to Malaria Elimination. Am. J. Trop. Med. Hyg. 2020, 103, 1510–1516. [Google Scholar] [CrossRef] [PubMed]
- Diallo, A.; Ndam, N.T.; Moussiliou, A.; Dos Santos, S.; Ndonky, A.; Borderon, M.; Oliveau, S.; Lalou, R.; Le Hesran, J.-Y. Asymptomatic Carriage of Plasmodium in Urban Dakar: The Risk of Malaria Should Not Be Underestimated. PLoS ONE 2012, 7, e31100. [Google Scholar] [CrossRef] [Green Version]
- Nzobo, B.J.; Ngasala, B.E.; Kihamia, C.M. Prevalence of asymptomatic malaria infection and use of different malaria control measures among primary school children in Morogoro Municipality, Tanzania. Malar. J. 2015, 14, 1–7. [Google Scholar] [CrossRef] [Green Version]
- Awan, Z.U.R.; Khan, A.K.; Shah, A.H.; Suleman, M.; Khan, M.A. Assessment of malaria prevalence among school children in rural areas of Bannu District Khyber Pakhtunkhwa, Pakistan. Pak. J. Zool. 2012, 44, 321–326. [Google Scholar]
- Dinko, B.; Oguike, M.C.; Larbi, J.A.; Bousema, T.; Sutherland, C.J. Persistent detection of Plasmodium falciparum, P. malariae, P. ovale curtisi and P. ovale wallikeri after ACT treatment of asymptomatic Ghanaian school-children. Int. J. Parasitol. Drugs Drug Resist. 2013, 3, 45–50. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ganguly, S.; Saha, P.; Guha, S.K.; Biswas, A.; Das, S.; Kundu, P.K.; Maji, A.K. High Prevalence of Asymptomatic Malaria in a Tribal Population in Eastern India. J. Clin. Microbiol. 2013, 51, 1439–1444. [Google Scholar] [CrossRef] [Green Version]
- Worku, L.; Damtie, D.; Endris, M.; Getie, S.; Aemero, M. Asymptomatic Malaria and Associated Risk Factors among School Children in Sanja Town, Northwest Ethiopia. Int. Sch. Res. Not. 2014, 2014, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Golassa, L.; Baliraine, F.N.; Enweji, N.; Erko, B.; Swedberg, G.; Aseffa, A. Microscopic and molecular evidence of the presence of asymptomatic Plasmodium falciparum and Plasmodium vivax infections in an area with low, seasonal and unstable malaria transmission in Ethiopia. BMC Infect. Dis. 2015, 15, 310. [Google Scholar] [CrossRef]
- Singh, R.; Godson, I.I.; Singh, S.; Singh, R.B.; Isyaku, N.T.; Ebere, U.V. High prevalence of asymptomatic malaria in apparently healthy schoolchildren in Aliero, Kebbi state, Nigeria. J. Vector Borne Dis. 2014, 51, 128–132. [Google Scholar] [PubMed]
- Manjurano, A.; Omolo, J.J.; Lyimo, E.; Miyaye, D.; Kishamawe, C.; Matemba, L.E.; Massaga, J.J.; Changalucha, J.; Kazyoba, P.E. Performance evaluation of the highly sensitive histidine-rich protein 2 rapid test for Plasmodium falciparum malaria in North-West Tanzania. Malar. J. 2021, 20, 1–9. [Google Scholar] [CrossRef]
No | Species | Primer Name | Primer Sequences (5′–3′) | Amplicon Size |
---|---|---|---|---|
1 | Plasmodium spp. | rPLU5 | CCTGTTGTTGCCTTAAACTTC | 1200 |
rPLU6 | TTAAAATTGTTGCAGTTAAAACG | |||
2 | P. falciparum | rFAL1 | TTAAACTGGTTTGGGAAAACCAAATATATT | 205 |
rFAL2 | ACACAATGAACTCAATCATGACTACCCGTC | |||
3 | P. ovale | rOVA1 | ATCTCTTTTGCTATTTTTTAGTATTGGAGA | 880 |
rOVA2 | GGAAAAGGACACATTAATTGTATCCTAGTG | |||
4 | P. malariae | rMAL1 | ATAACATAGTTGTACGTTAAGAATAACCGC | 144 |
rMAL2 | AAAATTCCCATGCATAAAAAATTATACAAA |
Characteristics | n | Chi-Squared (X2) | p-Value | |
---|---|---|---|---|
Gender | M | 68 (54%) | 4.308 | 0.038 |
F | 59 (46%) | |||
Age (years) | <5 | 58 (45.7%) | 0.2 | 0.655 |
5–10 | 69 (54.3%) | |||
Temperature (°C) | 37.16 °C ± 0.63 °C (36–39.9 °C) | |||
Mean age (years) | 5.42 ± 2.64 | |||
Mean parasitemia/µL | 8260.19 ± 20,427.84 |
PCR Results | RDT Results | Microscopy Results | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Parameter | n | Prevalence of malaria % (n) | (X2) | p | n | Prevalence of malaria % (n) | (X2) | p | n | Prevalence of malaria % (n) | X2 | p | |||
Positive | Negative | Positive | Negative | Positive | Negative | ||||||||||
Gender | |||||||||||||||
Male | 68 | 75.0% (51) | 25.0% (17) | 4.308 | 0.038 | 68 | 79.4% (54) | 20.6% (14) | 1.649 | 0.199 | 68 | 79.4% (54) | 20.6% (14) | 1.158 | 0.282 |
Female | 59 | 57.6% (34) | 42.4% (25) | 59 | 69.5% (41) | 30.5% (18) | 59 | 28.8% (17) | 71.2% (42) | ||||||
Total | 127 | 66.9% (85) | 33.1% (42) | 127 | 74.8% (95) | 25.2% (32) | 127 | 55.9% (71) | 44.1% (56) | ||||||
Age (yrs) | |||||||||||||||
<5 | 58 | 47.1% (40) | 42.9% (18) | 0.2 | 0.655 | 58 | 72.5% (50) | 22.4% (13) | 0.439 | 0.508 | 58 | 77.6% (45) | 22.4% (13) | 0.631 | 0.682 |
5–10 | 69 | 52.9% (45) | 24 (57.1%) | 69 | 77.6% (45) | 27.5% (19) | 69 | 73.9% (51) | 26.1% (18) |
Parasite Species | Gender | Total | X2 | p | |
---|---|---|---|---|---|
Male (n = 68) | Female (n = 59) | ||||
Plasmodium falciparum | 75.0% (51) | 57.6% (34) | 85 | 4.308 | 0.038 |
Plasmodium ovale | 4.4% (3) | 1.7% (1) | 4 | 0.764 | 0.382 |
Plasmodium malariae | 5.9% (4) | 5.1% (3) | 7 | 0.039 | 0.844 |
RDT | Microscopy | |||||
---|---|---|---|---|---|---|
Statistics | Value | 95% CI | Value | 95% CI | ||
Sensitivity | 90.6% | 0.6654 | 0.8390 | 90.6% | 0.6731 | 0.8458 |
Specificity | 57.1% | 0.1509 | 0.5110 | 54.8% | 0.1410 | 0.5034 |
Positive predictive value | 81.1% | 0.7144 | 0.8809 | 80.2% | 0.7057 | 0.8737 |
Negative predictive value | 75.0% | 0.1212 | 0.4375 | 74.2% | 0.1253 | 0.4492 |
Positive likelihood ratio | 110.1% | 0.8336 | 1.4546 | 109.4% | 0.8377 | 1.4293 |
Negative likelihood ratio | 77.2% | 0.4596 | 1.2976 | 77.63% | 0.4564 | 1.3201 |
Disease prevalence | 79.53% | 0.7126 | 0.8596 | 78.74% | 0.7040 | 0.8529 |
Characteristics | Number of Parasites/µL | Total | X2 | p | ||
---|---|---|---|---|---|---|
<500 | 500–1000 | >1000 | ||||
Sex | ||||||
Male | 23.5% (16) | 2.9% (2) | 73.5% (50) | 68 | 1.262 | 0.532 |
Female | 32.2% (19) | 3.4% (2) | 64.4% (38) | 59 | ||
Total | 27.6% (35) | 3.1% (4) | 69.3% (88) | 127 | ||
Age | ||||||
<5 years | 27.6% (16) | 1.7% (1) | 70.7% (41) | 58 | 0.719 | 0.698 |
5–10 years | 27.5% (19) | 4.3% (3) | 68.1% (47) | 69 | ||
Total | 27.6% (35) | 3.1% (4) | 69.3% (88) | 127 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Akindeh, N.M.; Ngum, L.N.; Niba, P.T.N.; Ali, I.M.; Ayem, O.L.O.; Chedjou, J.P.K.; Fomboh, C.T.; Ekollo, A.H.M.; Mbu’u, C.M.; Mbacham, W.F. Assessing Asymptomatic Malaria Carriage of Plasmodium falciparum and Non-falciparum Species in Children Resident in Nkolbisson, Yaoundé, Cameroon. Children 2021, 8, 960. https://0-doi-org.brum.beds.ac.uk/10.3390/children8110960
Akindeh NM, Ngum LN, Niba PTN, Ali IM, Ayem OLO, Chedjou JPK, Fomboh CT, Ekollo AHM, Mbu’u CM, Mbacham WF. Assessing Asymptomatic Malaria Carriage of Plasmodium falciparum and Non-falciparum Species in Children Resident in Nkolbisson, Yaoundé, Cameroon. Children. 2021; 8(11):960. https://0-doi-org.brum.beds.ac.uk/10.3390/children8110960
Chicago/Turabian StyleAkindeh, Nji Mbuh, Lesley Ngum Ngum, Peter Thelma Ngwa Niba, Innocent Mbulli Ali, Ornella Laetitia Oben Ayem, Jean Paul Kengne Chedjou, Calvino Tah Fomboh, Aristid Herve Mbange Ekollo, Cyrille Mbanwi Mbu’u, and Wilfred Fon Mbacham. 2021. "Assessing Asymptomatic Malaria Carriage of Plasmodium falciparum and Non-falciparum Species in Children Resident in Nkolbisson, Yaoundé, Cameroon" Children 8, no. 11: 960. https://0-doi-org.brum.beds.ac.uk/10.3390/children8110960