Sal B Alleviates Myocardial Ischemic Injury by Inhibiting TLR4 and the Priming Phase of NLRP3 Inflammasome
Abstract
:1. Introduction
2. Results
2.1. Effect of Sal B on Myocardial Infarct Size in Myocardial Ischemia Injury Rats
2.2. Effect of Sal B on the Electrocardiograph Parameters
2.3. Sal B Alleviated the Pathological Changes of Rat Hearts
2.4. Effects of Sal B on LDH/cTn/IL-1β in Serum of Myocardial Ischemia Rats and Cell Supernatant of H9C2 Cells
2.5. Effects of Sal B on TLR4/NF-κB Signaling-Related mRNA Expressions in LPS-Induced H9C2 Cells
2.6. Effects of Sal B on TLR4/NF-κB Signaling-Related Protein Expressions in LPS-Induced H9C2 Cells
2.7. Docking Sal B to MD-2 Revealed the Binding Affinity
2.8. Sal B Is a Specific MD-2 Inhibitor
2.9. Sal B Blocked LPS-Induced MD-2/TLR4 Association
3. Materials and Methods
3.1. Materials
3.2. Animals
3.3. Experimental Protocol and Drug Administration
3.4. Measurement of Myocardial Infract Size
3.5. Histopathologic Observation
3.6. Determinations of LDH, cTn and IL-1β in Serum
3.7. Cell Culture and Treatment
3.8. Detections of LDH, cTn and IL-1β in Cell Supernatant
3.9. Immunofluorescence
3.10. Quantitative Real-Time PCR
3.11. Western Blotting
3.12. In Silico Docking Simulations
3.13. Bis-ANS Displacement Assay
3.14. Immunoprecipitation
3.15. Statistics
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Pavillard, L.E.; Marin-Aguilar, F.; Bullon, P.; Cordero, M.D. Cardiovascular diseases, NLRP3 inflammasome, and western dietary patterns. Pharm. Res. 2018, 131, 44–50. [Google Scholar] [CrossRef] [PubMed]
- Ho, J.H.; Hong, C.Y. Salvianolic acids: Small compounds with multiple mechanisms for cardiovascular protection. J. Biomed. Sci. 2011, 18, 30. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Toldo, S.; Abbate, A. The NLRP3 inflammasome in acute myocardial infarction. Nat. Rev. Cardiol. 2018, 15, 203–214. [Google Scholar] [CrossRef]
- Mastrocola, R.; Penna, C.; Tullio, F.; Femmino, S.; Nigro, D.; Chiazza, F.; Serpe, L.; Collotta, D.; Alloatti, G.; Cocco, M.; et al. Pharmacological Inhibition of NLRP3 Inflammasome Attenuates Myocardial Ischemia/Reperfusion Injury by Activation of RISK and Mitochondrial Pathways. Oxid. Med. Cell. Longev. 2016, 2016, 5271251. [Google Scholar] [CrossRef]
- Gan, J.; Qian, W.; Lin, S. Umbelliferone Alleviates Myocardial Ischemia: The Role of Inflammation and Apoptosis. Inflammation 2018, 41, 464–473. [Google Scholar] [CrossRef]
- Su, Q.; Li, L.; Sun, Y.; Yang, H.; Ye, Z.; Zhao, J. Effects of the TLR4/Myd88/NF-kappaB Signaling Pathway on NLRP3 Inflammasome in Coronary Microembolization-Induced Myocardial Injury. Cell Physiol. Biochem. 2018, 47, 1497–1508. [Google Scholar] [CrossRef]
- Zhang, X.; Du, Q.; Yang, Y.; Wang, J.; Dou, S.; Liu, C.; Duan, J. The protective effect of Luteolin on myocardial ischemia/reperfusion (I/R) injury through TLR4/NF-κB/NLRP3 inflammasome pathway. Biomed. Pharmacother. 2017, 91, 1042–1052. [Google Scholar] [CrossRef]
- Mangan, M.S.J.; Olhava, E.J.; Roush, W.R.; Seidel, H.M.; Glick, G.D.; Latz, E. Targeting the NLRP3 inflammasome in inflammatory diseases. Nat. Rev. Drug Discov. 2018, 17, 588–606. [Google Scholar] [CrossRef]
- Lin, K.M.; Hu, W.; Troutman, T.D.; Jennings, M.; Brewer, T.; Li, X.; Nanda, S.; Cohen, P.; Thomas, J.A.; Pasare, C. IRAK-1 bypasses priming and directly links TLRs to rapid NLRP3 inflammasome activation. Proc. Natl. Acad. Sci. USA 2014, 111, 775–780. [Google Scholar] [CrossRef] [Green Version]
- Toldo, S.; Mezzaroma, E.; McGeough, M.D.; Pena, C.A.; Marchetti, C.; Sonnino, C.; Van Tassell, B.W.; Salloum, F.N.; Voelkel, N.F.; Hoffman, H.M. Independent roles of the priming and the triggering of the NLRP3 inflammasome in the heart. Cardiovasc. Res. 2015, 105, 203–212. [Google Scholar] [CrossRef]
- Liu, X.; Xavier, C.; Jann, J.; Wu, H. Salvianolic Acid B (Sal B) Protects Retinal Pigment Epithelial Cells from Oxidative Stress-Induced Cell Death by Activating Glutaredoxin 1 (Grx1). Int. J. Mol. Sci. 2016, 17, 1835. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xue, L.; Wu, Z.; Ji, X.P.; Gao, X.Q.; Guo, Y.H. Effect and mechanism of salvianolic acid B on the myocardial ischemia-reperfusion injury in rats. Asian Pac. J. Trop. Med. 2014, 7, 280–284. [Google Scholar] [CrossRef] [Green Version]
- Gong, L.; Di, C.; Xia, X.; Wang, J.; Chen, G.; Shi, J.; Chen, P.; Xu, H.; Zhang, W. AKT/mTOR signaling pathway is involved in salvianolic acid B-induced autophagy and apoptosis in hepatocellular carcinoma cells. Int. J. Oncol. 2016, 49, 2538–2548. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lou, Y.; Wang, C.; Zheng, W.; Tang, Q.; Chen, Y.; Zhang, X.; Guo, X.; Wang, J. Salvianolic acid B inhibits IL-1beta-induced inflammatory cytokine production in human osteoarthritis chondrocytes and has a protective effect in a mouse osteoarthritis model. Int. Immunopharmacol. 2017, 46, 31–37. [Google Scholar] [CrossRef]
- Li, D.; Wang, J.; Hou, J.; Fu, J.; Liu, J.; Lin, R. Salvianolic acid B induced upregulation of miR-30a protects cardiac myocytes from ischemia/reperfusion injury. BMC Complementary Altern. Med. 2016, 16, 336. [Google Scholar] [CrossRef] [Green Version]
- Pan, C.; Lou, L.; Huo, Y.; Singh, G.; Chen, M.; Zhang, D.; Wu, A.; Zhao, M.; Wang, S.; Li, J. Salvianolic acid B and tanshinone IIA attenuate myocardial ischemia injury in mice by NO production through multiple pathways. Adv. Cardiovasc. Dis. 2011, 5, 99–111. [Google Scholar] [CrossRef]
- Lin, C.; Liu, Z.; Lu, Y.; Yao, Y.; Zhang, Y.; Ma, Z.; Kuai, M.; Sun, X.; Sun, S.; Jing, Y. Cardioprotective effect of Salvianolic acid B on acute myocardial infarction by promoting autophagy and neovascularization and inhibiting apoptosis. J. Pharm. Pharmacol. 2016, 68, 941–952. [Google Scholar] [CrossRef]
- Trott, O.; Olson, A.J. AutoDock Vina: Improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. J. Comput. Chem. 2010, 31, 455–461. [Google Scholar] [CrossRef] [Green Version]
- Wolf, A.J.; Underhill, D.M. Peptidoglycan recognition by the innate immune system. Nat. Rev. Immunol. 2018, 18, 243–254. [Google Scholar] [CrossRef]
- Yang, Y.; Lv, J.; Jiang, S.; Ma, Z.; Wang, D.; Hu, W.; Deng, C.; Fan, C.; Di, S.; Sun, Y. The emerging role of Toll-like receptor 4 in myocardial inflammation. Cell Death Dis. 2016, 7, e2234. [Google Scholar] [CrossRef]
- Drenth, J.P.; van der Meer, J.W. The inflammasome--a linebacker of innate defense. N. Engl. J. Med. 2006, 355, 730–732. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Martinez-Garcia, J.J.; Martinez-Banaclocha, H.; Angosto-Bazarra, D.; de Torre-Minguela, C.; Baroja-Mazo, A.; Alarcon-Vila, C.; Martinez-Alarcon, L.; Amores-Iniesta, J.; Martin-Sanchez, F.; Ercole, G.A. P2X7 receptor induces mitochondrial failure in monocytes and compromises NLRP3 inflammasome activation during sepsis. Nat. Commun. 2019, 10, 2711. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, C.J.; Jiang, M.; Zhou, H.; Liu, W.; Wang, C.; Kang, Z.; Han, B.; Zhang, Q.; Chen, X.; Xiao, J. TLR-stimulated IRAKM activates caspase-8 inflammasome in microglia and promotes neuroinflammation. J. Clin. Investig. 2018, 128, 5399–5412. [Google Scholar] [CrossRef] [PubMed]
- Luo, X.; Yu, Z.; Deng, C.; Zhang, J.; Ren, G.; Sun, A.; Mani, S.; Wang, Z.; Dou, W. Baicalein ameliorates TNBS-induced colitis by suppressing TLR4/MyD88 signaling cascade and NLRP3 inflammasome activation in mice. Sci. Rep. 2017, 7, 16374. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kruger, C.L.; Zeuner, M.T.; Cottrell, G.S.; Widera, D.; Heilemann, M. Quantitative single-molecule imaging of TLR4 reveals ligand-specific receptor dimerization. Sci. Signal. 2017, 10, 503. [Google Scholar] [CrossRef] [Green Version]
Sample Availability: Samples of the compounds are available from the authors. |
Oligonucleotide | Forward Sequence (5’–3’) | Reverse Sequence (5’–3’) |
---|---|---|
TLR4 | GCTCTCAACCTTGGTACTGACAGG | GTCTCCACAGCCACCAGATTCTC |
Myd88 | CGACGCCTTCATCTGCTACTGC | CCACCACCATGCGACGACAC |
IRAK1 | GCGTGTGGCTGACCTCGTTC | GGAGAGGAAGGTGGAGGCAGAG |
NF-κB | TGTGGTGGAGGACTTGCTGAGG | AGTGCTGCCTTGCTGTTCTTGAG |
NLRP3 | CTCTGCATGCCGTATCTGGT | GTCCTGAGCCATGGAAGCAA |
GAPDH | GGCAAATTCAACGGCACAGT | AGATGGTGATGGGCTTCCC |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hu, Y.; Li, Q.; Pan, Y.; Xu, L. Sal B Alleviates Myocardial Ischemic Injury by Inhibiting TLR4 and the Priming Phase of NLRP3 Inflammasome. Molecules 2019, 24, 4416. https://0-doi-org.brum.beds.ac.uk/10.3390/molecules24234416
Hu Y, Li Q, Pan Y, Xu L. Sal B Alleviates Myocardial Ischemic Injury by Inhibiting TLR4 and the Priming Phase of NLRP3 Inflammasome. Molecules. 2019; 24(23):4416. https://0-doi-org.brum.beds.ac.uk/10.3390/molecules24234416
Chicago/Turabian StyleHu, Yang, Qingju Li, Yunzheng Pan, and Li Xu. 2019. "Sal B Alleviates Myocardial Ischemic Injury by Inhibiting TLR4 and the Priming Phase of NLRP3 Inflammasome" Molecules 24, no. 23: 4416. https://0-doi-org.brum.beds.ac.uk/10.3390/molecules24234416