Binary Effects of Gynostemma Gold Nanoparticles on Obesity and Inflammation via Downregulation of PPARγ/CEPBα and TNF-α Gene Expression
Abstract
:1. Introduction
2. Result and Discussion
2.1. Synthesis and Characterization of GP-AuNPs Using G. pentaphyllum Extract
2.2. Cytotoxicity Evaluation of Nanoparticles on 3T3-L1 and Raw 264.7 Cells
2.3. Effect of GP-AuNPs on Lipid Accumulation in 3T3-L1 Cells
2.4. Assessment of Antioxidant Activity
2.5. Effect of GP-AuNPs on Reactive Oxygen Species in 3T3-L1 Preadipocyte Cells
2.6. Effect of GP-AuNPs on Gene Expression Levels during Adipogenesis and Inflammation
3. Materials and Methods
3.1. Plant and Chemical
3.2. Plant Extract Preparation
3.3. Synthesis of Gold Nanoparticles
3.4. Characterization of GP-AuNPs
3.4.1. UV–VIS Spectra Analysis
3.4.2. Field-Emission Transmission Electron Microscopy (FE-TEM) Analysis
3.4.3. XRD Analysis
3.4.4. Fourier-Transform Infrared (FTIR) Spectroscopy Analysis
3.4.5. Stability of A-AuNPs
3.5. Cell Culture
3.6. Cytotoxicity Assay
3.7. Lipid Accumulation and Triglyceride Measurement Assay
3.8. RNA Isolation and RT-PCR
Genes | Forward Primers | Reverse Primers |
PPARγ | ATGGGTGAAACTCTGGGAGATT | AGCTTCAATCGGATGGTTCTT |
C/EBPα | AGGTGCTGGAGTTGACCAGT | CAGCCTAGAGATCCAGCGAC |
TNF-α | AGGGGAAATGAGA GACGCAA | TTCCCCATCTCTTGCCACAT |
GAPDH β-actin | GTATGACTCCACTCACGGCAAA AGCCATGTACGTAGCCATCC | GGTGTGGCTCCTGGAAGATG TCCCTCTCAGCTGTGGTGGTGAA |
3.9. Free Radical Scavenging Activity of GP-AuNPs
3.10. Measurement of Cellular ROS
3.11. Measurement of Nitrite Levels
3.12. Statistical Analysis
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Blüher, M. Obesity: Global epidemiology and pathogenesis. Nat. Rev. Endocrinol. 2019, 15, 288–298. [Google Scholar] [CrossRef] [PubMed]
- Ellulu, M.S.; Patimah, I.; Khaza’ai, H.; Rahmat, A.; Abed, Y. Obesity and inflammation: The linking mechanism and the complications. Arch. Med. Sci. 2017, 13, 851. [Google Scholar] [CrossRef] [PubMed]
- Sahoo, K.; Sahoo, B.; Choudhury, A.K.; Sofi, N.Y.; Kumar, R.; Bhadoria, A.S. Childhood obesity: Causes and consequences. J. Fam. Med. Prim. Care 2015, 4, 187. [Google Scholar]
- Alhabeeb, H.; AlFaiz, A.; Kutbi, E.; AlShahrani, D.; Alsuhail, A.; AlRajhi, S.; Alotaibi, N.; Alotaibi, K.; AlAmri, S.; Alghamdi, S. Gut hormones in health and obesity: The upcoming role of short chain fatty acids. Nutrients 2021, 13, 481. [Google Scholar] [CrossRef]
- World Health Organization. Global Action Plan on Physical Activity 2018–2030: More Active People for a Healthier World; World Health Organization: Geneva, Switzerland, 2019. [Google Scholar]
- Ataey, A.; Jafarvand, E.; Adham, D.; Moradi-Asl, E. The relationship between obesity, overweight, and the human development index in world health organization eastern mediterranean region countries. J. Prev. Med. Public Health 2020, 53, 98. [Google Scholar] [CrossRef] [PubMed]
- Wu, T.-R.; Lin, C.-S.; Chang, C.-J.; Lin, T.-L.; Martel, J.; Ko, Y.-F.; Ojcius, D.M.; Lu, C.-C.; Young, J.D.; Lai, H.-C. Gut commensal Parabacteroides goldsteinii plays a predominant role in the anti-obesity effects of polysaccharides isolated from Hirsutella sinensis. Gut 2019, 68, 248–262. [Google Scholar] [CrossRef] [PubMed]
- Kahn, S.E.; Hull, R.L.; Utzschneider, K.M. Mechanisms linking obesity to insulin resistance and type 2 diabetes. Nature 2006, 444, 840–846. [Google Scholar] [CrossRef] [PubMed]
- Liu, R.; Nikolajczyk, B.S. Tissue immune cells fuel obesity-associated inflammation in adipose tissue and beyond. Front. Immunol. 2019, 10, 1587. [Google Scholar] [CrossRef] [Green Version]
- Hotamisligil, G.S.; Arner, P.; Caro, J.F.; Atkinson, R.L.; Spiegelman, B.M. Increased adipose tissue expression of tumor necrosis factor-alpha in human obesity and insulin resistance. J. Clin. Investig. 1995, 95, 2409–2415. [Google Scholar] [CrossRef]
- Saltiel, A.R.; Olefsky, J.M. Inflammatory mechanisms linking obesity and metabolic disease. J. Clin. Investig. 2017, 127, 1–4. [Google Scholar] [CrossRef]
- Wu, T.; Yin, J.; Zhang, G.; Long, H.; Zheng, X. Mulberry and cherry anthocyanin consumption prevents oxidative stress and inflammation in diet-induced obese mice. Mol. Nutr. Food Res. 2016, 60, 687–694. [Google Scholar] [CrossRef] [PubMed]
- Carrasco-Pozo, C.; Cires, M.J.; Gotteland, M. Quercetin and epigallocatechin gallate in the prevention and treatment of obesity: From molecular to clinical studies. J. Med. Food 2019, 22, 753–770. [Google Scholar] [CrossRef] [PubMed]
- Ferrante, A., Jr. Obesity-induced inflammation: A metabolic dialogue in the language of inflammation. J. Intern. Med. 2007, 262, 408–414. [Google Scholar] [CrossRef] [PubMed]
- Hotamisligil, G.S.; Shargill, N.S.; Spiegelman, B.M. Adipose expression of tumor necrosis factor-alpha: Direct role in obesity-linked insulin resistance. Science 1993, 259, 87–91. [Google Scholar] [CrossRef] [PubMed]
- Le Sage, F.; Meilhac, O.; Gonthier, M.-P. Anti-inflammatory and antioxidant effects of polyphenols extracted from Antirhea borbonica medicinal plant on adipocytes exposed to Porphyromonas gingivalis and Escherichia coli lipopolysaccharides. Pharmacol. Res. 2017, 119, 303–312. [Google Scholar] [CrossRef] [PubMed]
- Yumuk, V.; Tsigos, C.; Fried, M.; Schindler, K.; Busetto, L.; Micic, D.; Toplak, H. European guidelines for obesity management in adults. Obesity Facts 2015, 8, 402–424. [Google Scholar] [CrossRef] [PubMed]
- Tak, Y.J.; Lee, S.Y. Anti-obesity drugs: Long-term efficacy and safety: An updated review. World J. Men’s Health 2021, 39, 208. [Google Scholar] [CrossRef] [Green Version]
- Kong, F.-Y.; Zhang, J.-W.; Li, R.-F.; Wang, Z.-X.; Wang, W.-J.; Wang, W. Unique roles of gold nanoparticles in drug delivery, targeting and imaging applications. Molecules 2017, 22, 1445. [Google Scholar] [CrossRef] [Green Version]
- Rho, J.G.; Han, H.S.; Han, J.H.; Lee, H.; Lee, W.H.; Kwon, S.; Heo, S.; Yoon, J.; Shin, H.H.; Lee, E.-Y. Self-assembled hyaluronic acid nanoparticles: Implications as a nanomedicine for treatment of type 2 diabetes. J. Control. Release 2018, 279, 89–98. [Google Scholar] [CrossRef]
- Hiradate, R.; Khalil, I.A.; Matsuda, A.; Sasaki, M.; Hida, K.; Harashima, H. A novel dual-targeted rosiglitazone-loaded nanoparticle for the prevention of diet-induced obesity via the browning of white adipose tissue. J. Control. Release 2021, 329, 665–675. [Google Scholar] [CrossRef]
- Wang, H.; Liu, Y.; He, R.; Xu, D.; Zang, J.; Weeranoppanant, N.; Dong, H.; Li, Y. Cell membrane biomimetic nanoparticles for inflammation and cancer targeting in drug delivery. Biomater. Sci. 2020, 8, 552–568. [Google Scholar] [CrossRef] [PubMed]
- Elia, P.; Zach, R.; Hazan, S.; Kolusheva, S.; Porat, Z.e.; Zeiri, Y. Green synthesis of gold nanoparticles using plant extracts as reducing agents. Int. J. Nanomed. 2014, 9, 4007. [Google Scholar]
- Elahi, N.; Kamali, M.; Baghersad, M.H. Recent biomedical applications of gold nanoparticles: A review. Talanta 2018, 184, 537–556. [Google Scholar] [CrossRef] [PubMed]
- Kumar, P.V.; Kala, S.M.J.; Prakash, K. Green synthesis of gold nanoparticles using Croton Caudatus Geisel leaf extract and their biological studies. Mater. Lett. 2019, 236, 19–22. [Google Scholar] [CrossRef]
- Parveen, K.; Banse, V.; Ledwani, L. Green synthesis of nanoparticles: Their advantages and disadvantages. AIP Conf. Proc. 2016, 1724, 020048. [Google Scholar]
- Basnet, P.; Chanu, T.I.; Samanta, D.; Chatterjee, S. A review on bio-synthesized zinc oxide nanoparticles using plant extracts as reductants and stabilizing agents. J. Photochem. Photobiol. B Biol. 2018, 183, 201–221. [Google Scholar] [CrossRef]
- Ji, X.; Shen, Y.; Guo, X. Isolation, structures, and bioactivities of the polysaccharides from Gynostemma pentaphyllum (Thunb.) Makino: A review. BioMed Res. Int. 2018, 2018, 6285134. [Google Scholar] [CrossRef] [Green Version]
- Xing, S.-F.; Lin, M.; Wang, Y.-R.; Chang, T.; Cui, W.-Y.; Piao, X.-L. Novel dammarane-type saponins from Gynostemma pentaphyllum and their neuroprotective effect. Nat. Prod. Res. 2020, 34, 651–658. [Google Scholar] [CrossRef]
- Zheng, M.-M.; Xu, F.-X.; Li, Y.-J.; Xi, X.-Z.; Cui, X.-W.; Han, C.-C.; Zhang, X.-L. Study on transformation of ginsenosides in different methods. BioMed Res. Int. 2017, 2017, 8601027. [Google Scholar] [CrossRef] [Green Version]
- Wang, B.; Li, M.; Gao, H.; Sun, X.; Gao, B.; Zhang, Y.; Yu, L. Chemical composition of tetraploid Gynostemma pentaphyllum gypenosides and their suppression on inflammatory response by NF-κB/MAPKs/AP-1 signaling pathways. Food Sci. Nutr. 2020, 8, 1197–1207. [Google Scholar] [CrossRef]
- Liu, J.; Zhang, L.; Ren, Y.; Gao, Y.; Kang, L.; Qiao, Q. Anticancer and immunoregulatory activity of Gynostemma pentaphyllum polysaccharides in H22 tumor-bearing mice. Int. J. Biol. Macromol. 2014, 69, 1–4. [Google Scholar] [CrossRef] [PubMed]
- Circosta, C.; De Pasquale, R.; Occhiuto, F. Cardiovascular effects of the aqueous extract of Gynostemma pentaphyllum Makino. Phytomedicine 2005, 12, 638–643. [Google Scholar] [CrossRef] [PubMed]
- Su, C.; Li, N.; Ren, R.; Wang, Y.; Su, X.; Lu, F.; Zong, R.; Yang, L.; Ma, X. Progress in the Medicinal Value, Bioactive Compounds, and Pharmacological Activities of Gynostemma pentaphyllum. Molecules 2021, 26, 6249. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, N.-H.; Ha, T.K.Q.; Yang, J.-L.; Pham, H.T.T.; Oh, W.K. Triterpenoids from the genus Gynostemma: Chemistry and pharmacological activities. J. Ethnopharmacol. 2021, 268, 113574. [Google Scholar] [CrossRef] [PubMed]
- Chandra, H.; Kumari, P.; Bontempi, E.; Yadav, S. Medicinal plants: Treasure trove for green synthesis of metallic nanoparticles and their biomedical applications. Biocatal. Agric. Biotechnol. 2020, 24, 101518. [Google Scholar] [CrossRef]
- Jadoun, S.; Arif, R.; Jangid, N.K.; Meena, R.K. Green synthesis of nanoparticles using plant extracts: A review. Environ. Chem. Lett. 2021, 19, 355–374. [Google Scholar] [CrossRef]
- An, D.-S.; Cui, C.-H.; Lee, H.-G.; Wang, L.; Kim, S.C.; Lee, S.-T.; Jin, F.; Yu, H.; Chin, Y.-W.; Lee, H.-K. Identification and characterization of a novel Terrabacter ginsenosidimutans sp. nov. β-glucosidase that transforms ginsenoside Rb1 into the rare gypenosides XVII and LXXV. Appl. Environ. Microbiol. 2010, 76, 5827–5836. [Google Scholar] [CrossRef] [Green Version]
- Park, J.K.; Rupa, E.J.; Arif, M.H.; Li, J.F.; Anandapadmanaban, G.; Kang, J.P.; Kim, M.; Ahn, J.C.; Akter, R.; Yang, D.C. Synthesis of zinc oxide nanoparticles from Gynostemma pentaphyllum extracts and assessment of photocatalytic properties through malachite green dye decolorization under UV illumination—A green approach. Optik 2021, 239, 166249. [Google Scholar] [CrossRef]
- Usman, A.I.; Aziz, A.A.; Noqta, O.A. Application of green synthesis of gold nanoparticles: A review. J. Teknol. 2019, 81. [Google Scholar] [CrossRef] [Green Version]
- Singh, P.; Ahn, S.; Kang, J.-P.; Veronika, S.; Huo, Y.; Singh, H.; Chokkaligam, M.; El-Agamy Farh, M.; Aceituno, V.C.; Kim, Y.J. In vitro anti-inflammatory activity of spherical silver nanoparticles and monodisperse hexagonal gold nanoparticles by fruit extract of Prunus serrulata: A green synthetic approach. Artif. Cells Nanomed. Biotechnol. 2018, 46, 2022–2032. [Google Scholar]
- Lingegowda, D.C.; Kumar, J.K.; Prasad, A.D.; Zarei, M.; Gopal, S. FTIR spectroscopic studies on Cleome gynandra—Comparative analysis of functional group before and after extraction. Rom. J. Biophys. 2012, 22, 137–143. [Google Scholar]
- Hudecova, J.; Profant, V.; Novotna, P.; Baumruk, V.; Urbanova, M.; Bour, P. CH Stretching Region: Computational Modeling of Vibrational Optical Activity. J. Chem. Theory Comput. 2013, 9, 3096–3108. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.; Mathiyalagan, R.; Kim, Y.J.; Castro-Aceituno, V.; Singh, P.; Ahn, S.; Wang, D.; Yang, D.C. Rapid green synthesis of silver and gold nanoparticles using Dendropanax morbifera leaf extract and their anticancer activities. Int. J. Nanomed. 2016, 11, 3691. [Google Scholar]
- Bardaweel, S.K.; Gul, M.; Alzweiri, M.; Ishaqat, A.; ALSalamat, H.A.; Bashatwah, R.M. Reactive oxygen species: The dual role in physiological and pathological conditions of the human body. Eurasian J. Med. 2018, 50, 193. [Google Scholar] [CrossRef]
- Xie, Z.; Liu, W.; Huang, H.; Slavin, M.; Zhao, Y.; Whent, M.; Blackford, J.; Lutterodt, H.; Zhou, H.; Chen, P. Chemical composition of five commercial Gynostemma pentaphyllum samples and their radical scavenging, antiproliferative, and anti-inflammatory properties. J. Agric. Food Chem. 2010, 58, 11243–11249. [Google Scholar] [CrossRef]
- Akanji, M.A.; Adeyanju, A.A.; Rotimi, D.; Adeyemi, O.S. Nitric oxide balance in health and diseases: Implications for new treatment strategies. Open Biochem. J. 2020, 14, 25–32. [Google Scholar] [CrossRef]
- Li, L.; Wang, L.; Wu, Z.; Yao, L.; Wu, Y.; Huang, L.; Liu, K.; Zhou, X.; Gou, D. Anthocyanin-rich fractions from red raspberries attenuate inflammation in both RAW264. 7 macrophages and a mouse model of colitis. Sci. Rep. 2014, 4, 6234. [Google Scholar] [CrossRef] [Green Version]
- Ahn, S.; Singh, P.; Castro-Aceituno, V.; Yesmin Simu, S.; Kim, Y.-J.; Mathiyalagan, R.; Yang, D.-C. Gold nanoparticles synthesized using Panax ginseng leaves suppress inflammatory-mediators production via blockade of NF-κB activation in macrophages. Artif. Cells Nanomed. Biotechnol. 2017, 45, 270–276. [Google Scholar] [CrossRef] [Green Version]
- Lee, Y.-J.; Kim, D.-B.; Lee, J.S.; Cho, J.-H.; Kim, B.K.; Choi, H.-S.; Lee, B.-Y.; Lee, O.-H. Antioxidant activity and anti-adipogenic effects of wild herbs mainly cultivated in Korea. Molecules 2013, 18, 12937–12950. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.; Lee, Y.J.; Choi, H.; Ko, E.H.; Kim, J.-w. Reactive oxygen species facilitate adipocyte differentiation by accelerating mitotic clonal expansion. J. Biol. Chem. 2009, 284, 10601–10609. [Google Scholar] [CrossRef] [Green Version]
- Dludla, P.V.; Nkambule, B.B.; Jack, B.; Mkandla, Z.; Mutize, T.; Silvestri, S.; Orlando, P.; Tiano, L.; Louw, J.; Mazibuko-Mbeje, S.E. Inflammation and oxidative stress in an obese state and the protective effects of gallic acid. Nutrients 2019, 11, 23. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, J.A.; Cho, Y.R.; Hong, S.S.; Ahn, E.K. Anti-obesity activity of saringosterol isolated from Sargassum muticum (Yendo) Fensholt extract in 3T3-L1 cells. Phytother. Res. 2017, 31, 1694–1701. [Google Scholar] [CrossRef] [PubMed]
- Kubota, H.; Kojima-Yuasa, A.; Morii, R.; Huang, X.; Norikura, T.; Rho, S.-N.; Matsui-Yuasa, I. Anti-obesity effect of Blumea balsamifera extract in 3T3-L1 preadipocytes and adipocytes. Am. J. Chin. Med. 2009, 37, 843–854. [Google Scholar] [CrossRef] [PubMed]
- Ralf, K.; Gabriel, B.; Ermilo, A.-A.V.; Martha, M.-G.; Mirbella, C.-F.; Rocio, B.-A. Anti-inflammatory and immunomodulatory effects of Critonia aromatisans leaves: Downregulation of pro-inflammatory cytokines. J. Ethnopharmacol. 2016, 190, 174–182. [Google Scholar]
- Kern, P.A.; Saghizadeh, M.; Ong, J.M.; Bosch, R.J.; Deem, R.; Simsolo, R.B. The expression of tumor necrosis factor in human adipose tissue. Regulation by obesity, weight loss, and relationship to lipoprotein lipase. J. Clin. Investig. 1995, 95, 2111–2119. [Google Scholar] [CrossRef] [Green Version]
- Yi, M.H.; Simu, S.Y.; Ahn, S.; Aceituno, V.C.; Wang, C.; Mathiyalagan, R.; Hurh, J.; Batjikh, I.; Ali, H.; Kim, Y.-J. Anti-obesity effect of gold nanoparticles from Dendropanax morbifera Léveille by suppression of triglyceride synthesis and downregulation of PPARγ and CEBPα signaling pathways in 3T3-L1 mature adipocytes and HepG2 cells. Curr. Nanosci. 2020, 16, 196–203. [Google Scholar] [CrossRef]
- Singh, P.; Kim, Y.J.; Singh, H.; Mathiyalagan, R.; Wang, C.; Yang, D.C. Biosynthesis of anisotropic silver nanoparticles by Bhargavaea indica and their synergistic effect with antibiotics against pathogenic microorganisms. J. Nanomater. 2015, 2015, 4. [Google Scholar] [CrossRef] [Green Version]
- Ahn, S.; Singh, P.; Jang, M.; Kim, Y.-J.; Castro-Aceituno, V.; Simu, S.Y.; Kim, Y.J.; Yang, D.-C. Gold nanoflowers synthesized using Acanthopanacis cortex extract inhibit inflammatory mediators in LPS-induced RAW264. 7 macrophages via NF-κB and AP-1 pathways. Colloids Surf. B Biointerfaces 2018, 162, 398–404. [Google Scholar] [CrossRef]
- Singh, P.; Singh, H.; Kim, Y.J.; Mathiyalagan, R.; Wang, C.; Yang, D.C. Extracellular synthesis of silver and gold nanoparticles by Sporosarcina koreensis DC4 and their biological applications. Enzym. Microb. Technol. 2016, 86, 75–83. [Google Scholar] [CrossRef]
- Singh, P.; Kim, Y.J.; Wang, C.; Mathiyalagan, R.; Yang, D.C. The development of a green approach for the biosynthesis of silver and gold nanoparticles by using Panax ginseng root extract, and their biological applications. Artif. Cells Nanomed. Biotechnol. 2016, 44, 1150–1157. [Google Scholar] [CrossRef] [Green Version]
- Singh, P.; Kim, Y.-J.; Zhang, D.; Yang, D.-C. Biological synthesis of nanoparticles from plants and microorganisms. Trends Biotechnol. 2016, 34, 588–599. [Google Scholar] [CrossRef] [PubMed]
- Simu, S.Y.; Ahn, S.; Castro-Aceituno, V.; Singh, P.; Mathiyalangan, R.; Jiménez-Pérez, Z.E.; Yang, D. Gold nanoparticles synthesized with fresh panax ginseng leaf extract suppress adipogenesis by downregulating PPAR/CEBP signaling in 3T3-L1 mature adipocytes. J. Nanosci. Nanotechnol. 2018, 18, 1–8. [Google Scholar]
- Abbai, R.; Ramya Mathiyalagan, J.M.; Kim, Y.-J.; Wang, C.; Singh, P.; Ahn, S.; Farh, M.E.-A.; Yang, D.C. Green synthesis of multifunctional silver and gold nanoparticles from the oriental herbal adaptogen: Siberian ginseng. Int. J. Nanomed. 2016, 11, 3131. [Google Scholar]
- Simu, S.Y.; Siddiqi, M.H.; Ahn, S.; Castro-Aceituno, V.; Kumar, N.S.; Perez, Z.E.J.; Yang, D.-C. Ginsenoside F1 attenuates lipid accumulation and triglycerides content in 3T3-L1 adipocytes with the modulation of reactive oxygen species (ROS) production through PPAR-γ/JAK2 signaling responses. Med. Chem. Res. 2017, 26, 1042–1051. [Google Scholar] [CrossRef]
- Ahn, S.; Siddiqi, M.H.; Aceituno, V.C.; Simu, S.Y.; Zhang, J.; Perez, Z.E.J.; Kim, Y.-J.; Yang, D.-C. Ginsenoside Rg5: Rk1 attenuates TNF-α/IFN-γ-induced production of thymus-and activation-regulated chemokine (TARC/CCL17) and LPS-induced NO production via downregulation of NF-κB/p38 MAPK/STAT1 signaling in human keratinocytes and macrophages. In Vitro Cell. Dev. Biol.-Anim. 2016, 52, 287–295. [Google Scholar] [CrossRef] [PubMed]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Akter, R.; Ling, L.; Rupa, E.J.; KyuPark, J.; Mathiyalagan, R.; Nahar, J.; Won, L.J.; Hyun, K.D.; Murugesan, M.; Yang, D.C.; et al. Binary Effects of Gynostemma Gold Nanoparticles on Obesity and Inflammation via Downregulation of PPARγ/CEPBα and TNF-α Gene Expression. Molecules 2022, 27, 2795. https://0-doi-org.brum.beds.ac.uk/10.3390/molecules27092795
Akter R, Ling L, Rupa EJ, KyuPark J, Mathiyalagan R, Nahar J, Won LJ, Hyun KD, Murugesan M, Yang DC, et al. Binary Effects of Gynostemma Gold Nanoparticles on Obesity and Inflammation via Downregulation of PPARγ/CEPBα and TNF-α Gene Expression. Molecules. 2022; 27(9):2795. https://0-doi-org.brum.beds.ac.uk/10.3390/molecules27092795
Chicago/Turabian StyleAkter, Reshmi, Li Ling, Esrat Jahan Rupa, Jin KyuPark, Ramya Mathiyalagan, Jinnatun Nahar, Lee Jong Won, Kim Do Hyun, Mohanapriya Murugesan, Deok Chun Yang, and et al. 2022. "Binary Effects of Gynostemma Gold Nanoparticles on Obesity and Inflammation via Downregulation of PPARγ/CEPBα and TNF-α Gene Expression" Molecules 27, no. 9: 2795. https://0-doi-org.brum.beds.ac.uk/10.3390/molecules27092795