Simple and Robust Detection of CYP2D6 Gene Deletions and Duplications Using CYP2D8P as Reference
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sequence Analysis
2.2. Design of Primers and Probes for the 5′Nuclease Singleplex PCR
2.3. Design of Primers for Use in the High Resolution Melting PCR Assay
2.4. Reference Samples and DNA Extraction
2.5. Assay Validation
2.6. Detection of CYP2D6 Deletions and Duplications by the 5′Nuclease Singleplex PCR Assay
2.7. Detection of CYP2D6 Deletions and Duplications by High-Resolution Melting
2.8. CYP2D6 and CYP2D8P Sequencing
3. Results
3.1. Design and Validation of the 5′Nuclease Singleplex PCR Assay
3.2. Design and Validation of the High Resolution Melting Assay
4. Discussion
- The equal affinity and efficiency of the universal primers when amplifying the two targets located in the CYP2D6 and 2D8P gene.
- The competition of the two targets for the same pool of universal primers, in the later phase of the PCR amplification.
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Yang, Y.; Botton, M.R.; Scott, E.R.; Scott, S.A. Sequencing the CYP2D6 Gene: From Variant Allele Discovery to Clinical Pharmacogenetic Testing. Pharmacogenomics 2017, 18, 673–685. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Thomas, J.H. Rapid Birth-Death Evolution Specific to Xenobiotic Cytochrome P450 Genes in Vertebrates. PLoS Genet. 2007, 3, 720–728. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Denham, M.J. Adverse Drug Reactions. Br. Med. Bull. 1990, 46, 53–62. [Google Scholar] [CrossRef] [PubMed]
- Esteves, F.; Rueff, J.; Kranendonk, M. The Central Role of Cytochrome P450 in Xenobiotic Metabolism—A Brief Review on a Fascinating Enzyme Family. J. Xenobiotics 2021, 11, 7. [Google Scholar] [CrossRef] [PubMed]
- Fuselli, S.; De Filippo, C.; Mona, S.; Sistonen, J.; Fariselli, P.; Destro-Bisol, G.; Barbujani, G.; Bertorelle, G.; Sajantila, A. Evolution of Detoxifying Systems: The Role of Environment and Population History in Shaping Genetic Diversity at Human CYP2D6 Locus. Pharm. Genom. 2010, 20, 485–499. [Google Scholar] [CrossRef] [PubMed]
- Heim, M.H.; Meyer, U.A. Evolution of a Highly Polymorphic Human Cytochrome P450 Gene Cluster: CYP2D6. Genomics 1992, 14, 49–58. [Google Scholar] [CrossRef]
- Yasukochi, Y.; Satta, Y. Molecular Evolution of the CYP2D Subfamily in Primates: Purifying Selection on Substrate Recognition Sites without the Frequent or Long-Tract Gene Conversion. Genome Biol. Evol. 2015, 7, 1053–1067. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sezutsu, H.; le Goff, G.; Feyereisen, R. Origins of P450 Diversity. Philos. Trans. R. Soc. B Biol. Sci. 2013, 368, 1–11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yasukochi, Y.; Satta, Y. Evolution of the CYP2D Gene Cluster in Humansand Four Non-Human Primates. Genes Genet. Syst. 2011, 86, 109–116. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Taylor, C.; Crosby, I.; Yip, V.; Maguire, P.; Pirmohamed, M.; Turner, R.M. A Review of the Important Role of Cyp2d6 in Pharmacogenomics. Genes 2020, 11, 1295. [Google Scholar] [CrossRef]
- Guengerich, F.P. A History of the Roles of Cytochrome P450 Enzymes in the Toxicity of Drugs. Toxicol. Res. 2021, 37, 1–23. [Google Scholar] [CrossRef] [PubMed]
- Jaquenoud Sirot, E.; van der Velden, J.W.; Rentsch, K.; Eap, C.B.; Baumann, P. Therapeutic Drug Monitoring and Pharmacogenetic Tests as Tools in Pharmacovigilance. Drug Saf. 2006, 29, 735–768. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Ingelman-Sundberg, M.; Lauschke, V.M. Worldwide Distribution of Cytochrome P450 Alleles: A Meta-Analysis of Population-Scale Sequencing Projects. Clin. Pharmacol. Ther. 2017, 102, 688–700. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Valdes, R.; Payne, D.A.; Linder, M.W. Laboratory Medicine Practice Guideline: Laboratory Analysis and Application of Pharmacogenetics to Clinical Practice. Natl. Acad. Clin. Biochem. 2010, 37, 180–193. [Google Scholar]
- Leandro-García, L.J.; Leskelä, S.; Montero-Conde, C.; Landa, I.; López-Jimenez, E.; Letón, R.; Seeringer, A.; Kirchheiner, J.; Cascón, A.; Robledo, M.; et al. Determination of CYP2D6 Gene Copy Number by Multiplex Polymerase Chain Reaction Analysis. Anal. Biochem. 2009, 389, 74–76. [Google Scholar] [CrossRef]
- Ramamoorthy, A.; Flockhart, D.A.; Hosono, N.; Kubo, M.; Nakamura, Y.; Skaar, T.C. Differential Quantification of CYP2D6 Gene Copy Number by Four Different Quantitative Real-Time PCR Assays. Pharm. Genom. 2010, 20, 451–454. [Google Scholar] [CrossRef] [Green Version]
- Schaeffeler, E.; Schwab, M.; Eichelbaum, M.; Zanger, U.M. CYP2D6 Genotyping Strategy Based on Gene Copy Number Determination by TaqMan Real-Rime PCR. Hum. Mutat. 2003, 22, 476–485. [Google Scholar] [CrossRef]
- Langaee, T.; Hamadeh, I.; Chapman, A.B.; Gums, J.G.; Johnson, J.A. A Novel Simple Method for Determining CYP2D6 Gene Copy Number and Identifying Allele(s) with Duplication/Multiplication. PLoS ONE 2015, 10, 2–12. [Google Scholar] [CrossRef] [Green Version]
- Bodin, L.; Beaune, P.H.; Loriot, M.A. Determination of Cytochrome P450 2D6 (CYP2D6) Gene Copy Number by Real-Time Quantitative PCR. J. Biomed. Biotechnol. 2005, 2005, 248–253. [Google Scholar] [CrossRef] [Green Version]
- Nguyen, D.L.; Staeker, J.; Laika, B.; Steimer, W. TaqMan Real-Time PCR Quantification Strategy of CYP2D6 Gene Copy Number for the LightCycler 2.0. Clin. Chim. Acta Int. J. Clin. Chem. 2009, 403, 207–211. [Google Scholar] [CrossRef]
- Söderbäck, E.; Zackrisson, A.L.; Lindblom, B.; Alderborn, A. Determination of CYP2D6 Gene Copy Number by Pyrosequencing. Clin. Chem. 2005, 51, 522–531. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bjerre, D.; Berg Rasmussen, H.; Indices Consortium, T. Novel Approach for CES1 Genotyping: Integrating Single Nucleotide Variants and Structural Variation. Pharmacogenomics 2018, 19, 349–359. [Google Scholar] [CrossRef] [PubMed]
- Sint, D.; Raso, L.; Traugott, M. Advances in Multiplex PCR: Balancing Primer Efficiencies and Improving Detection Success. Methods Ecol. Evol. 2012, 3, 898–905. [Google Scholar] [CrossRef] [PubMed]
- Markoulatos, P.; Siafakas, N.; Moncany, M. Multiplex Polymerase Chain Reaction: A Practical Approach. J. Clin. Lab. Anal. 2002, 16, 47–51. [Google Scholar] [CrossRef] [PubMed]
- Arneth, B.; Shams, M.; Hiemke, C.; Härtter, S. Rapid and Reliable Genotyping Procedure for Detection of Alleles with Mutations, Deletion, or/and Duplication of the CYP2D6 Gene. Clin. Biochem. 2009, 42, 1282–1290. [Google Scholar] [CrossRef] [PubMed]
- Ramírez, B.; Niño-Orrego, M.J.; Cárdenas, D.; Ariza, K.E.; Quintero, K.; Contreras Bravo, N.C.; Tamayo-Agudelo, C.; González, M.A.; Laissue, P.; Fonseca Mendoza, D.J. Copy Number Variation Profiling in Pharmacogenetics CYP-450 and GST Genes in Colombian Population. BMC Med. Genom. 2019, 12, 110. [Google Scholar] [CrossRef] [PubMed]
- He, Y.; Hoskins, J.M.; McLeod, H.L. Copy Number Variants in Pharmacogenetic Genes. Trends Mol. Med. 2011, 17, 244–251. [Google Scholar] [CrossRef] [Green Version]
- Gaedigk, A.; Twist, G.P.; Leeder, J.S. CYP2D6, SULT1A1 and UGT2B17 Copy Number Variation: Quantitative Detection by Multiplex PCR. Pharmacogenomics 2012, 13, 91–111. [Google Scholar] [CrossRef]
- Nakamura, N.; Fukuda, T.; Nonen, S.; Hashimoto, K.; Azuma, J.; Gemma, N. Simple and Accurate Determination of CYP2D6 Gene Copy Number by a Loop-Mediated Isothermal Amplification Method and an Electrochemical DNA Chip. Clin. Chim. Acta Int. J. Clin. Chem. 2010, 411, 568–573. [Google Scholar] [CrossRef]
- Larsen, J.B.; Rasmussen, J.B. Pharmacogenetic Testing Revisited: 5′ Nuclease Real-Time Polymerase Chain Reaction Test Panels for Genotyping CYP2D6 and CYP2C19. Pharm. Pers. Med. 2017, 10, 115–128. [Google Scholar] [CrossRef] [Green Version]
- Lu, H.C.; Chang, Y.S.; Chang, C.C.; Lin, C.H.; Chang, J.G. Developing and Evaluating the HRM Technique for Identifying Cytochrome P450 2D6 Polymorphisms. J. Clin. Lab. Anal. 2015, 29, 220–225. [Google Scholar] [CrossRef] [PubMed]
- Vijzelaar, R.; Botton, M.R.; Stolk, L.; Martis, S.; Desnick, R.J.; Scott, S.A. Multi-Ethnic SULT1A1 Copy Number Profiling with Multiplex Ligation-Dependent Probe Amplification. Pharmacogenomics 2018, 19, 761–770. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Primers and Probes Designed for this Study | ||
(A) Primers and probes for relative quantification | ||
Name | Sequence | Size |
CYP2D6:2D8 exon 9 Fwd | 5′ CAGCTTCTCGGTGCCCAC 3′ | 95 bp |
CYP2D6:2D8 exon 9 Rev | 5′ GCACAGCACAAAGCTCATAGG 3′ | |
CYP2D6 exon 9 probe | 5′ FAM-ACCAGGAAAGCAAAGACACCATGGT-BHQ1 3′ | |
CYP2D8 exon 9 probe | 5′ CF560-TCACCAGAAAGCCGACGACACGAGA-BHQ1 3′ | |
(B) Primers for high-resolution melting | ||
Name | Sequence | Size |
CYP2D6:2D8 exon 9 Fwd | 5′ CAGCTTCTCGGTGCCCAC 3′ | |
CYP2D6 exon 9 Rev | 5′ AGGAAAGCAAAGACACCATGGT 3′ | 60 bp |
CYP2D8 exon 9 Rev | 5′ GCGTCACCAGAAAGCCGA 3′ | 68 bp |
(C) Primers for sequencing | ||
Name | Sequence | Size |
CYP2D6 Seq Fwd | 5′ GTCTAGTGGGGAGACAAACCA 3′ | 676 bp |
CYP2D8 Seq Fwd | 5′ CTAGTGGGGAAGGCAGACCA 3′ | 670 bp |
CYP2D6:2D8 Rev | 5′ GCACAGCACAAAGCTCATAGG 3′ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Larsen, J.B.; Jørgensen, S. Simple and Robust Detection of CYP2D6 Gene Deletions and Duplications Using CYP2D8P as Reference. Pharmaceuticals 2022, 15, 166. https://0-doi-org.brum.beds.ac.uk/10.3390/ph15020166
Larsen JB, Jørgensen S. Simple and Robust Detection of CYP2D6 Gene Deletions and Duplications Using CYP2D8P as Reference. Pharmaceuticals. 2022; 15(2):166. https://0-doi-org.brum.beds.ac.uk/10.3390/ph15020166
Chicago/Turabian StyleLarsen, Jens Borggaard, and Steffen Jørgensen. 2022. "Simple and Robust Detection of CYP2D6 Gene Deletions and Duplications Using CYP2D8P as Reference" Pharmaceuticals 15, no. 2: 166. https://0-doi-org.brum.beds.ac.uk/10.3390/ph15020166