Next Article in Journal
Sampling and Detection Strategies for the Pine Pitch Canker (PPC) Disease Pathogen Fusarium circinatum in Europe
Previous Article in Journal
Soil Disturbance Effects from Tethered Forwarding on Steep Slopes in Brazilian Eucalyptus Plantations
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Forests
Volume 10
Issue 9
10.3390/f10090722
forests-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Preliminary Classification of the ABC Transporter Family in Betula halophila and Expression Patterns in Response to Exogenous Phytohormones and Abiotic Stresses

by
Linjun An
1,
Qing Ma
1,
Jinxia Du
2,
Miao Yu
1,
Fangrui Li
1,
Jiayu Luan
1,
Jing Jiang
1,* and
Huiyu Li
1,*
1
State Key Laboratory of Tree Genetics and Breeding, Northeast Forestry University, Harbin 150040, China
2
Changchun Vocational Institute of Technology, Changchun 130033, China
*
Authors to whom correspondence should be addressed.
Forests 2019, 10(9), 722; https://0-doi-org.brum.beds.ac.uk/10.3390/f10090722
Submission received: 4 July 2019 / Revised: 10 August 2019 / Accepted: 19 August 2019 / Published: 22 August 2019
(This article belongs to the Section Forest Ecophysiology and Biology)
Browse Figures
Review Reports Versions Notes

Abstract

:
ATP-binding cassette (ABC) transporters comprise a transport system superfamily which is ubiquitous in eukaryotic and prokaryotic cells. In plants, ABC transporters play important roles in hormone transport and stress tolerance. In this study, 15 BhABC transporters encoded by genes identified from the transcriptome of Betula halophila were categorized into four subfamilies (ABCB, ABCF, ABCG, and ABCI) using structural domain and phylogenetic analyses. Upon B. halophila exposure to exogenous phytohormones and abiotic stressors, gene expression patterns and transcriptional responses for each subfamily of genes were obtained using semi-quantitative RT-PCR analysis. The results demonstrated that expression of most genes belonging to ABCB and ABCG subfamilies changed in response to exogenous phytohormone exposures and abiotic stress. These results suggest that BhABC genes may participate in hormone transport and that their expression may be influenced by ABA-dependent signaling pathways involved in abiotic stress responses to various stressors.

1. Introduction

ATP-binding cassette (ABC) transporters are complex proteins that are responsible for the translocation of substrates across membranes. They constitute one of the largest protein families yet discovered, with widespread distribution among eukaryotes and prokaryotes [1,2]. ABC transporters contain a common core structure of nucleotide-binding domains (NBDs) and transmembrane domains (TMDs) [3]. In plants, ABC transporters can be classified into full transporter, half transporter, and soluble ABC protein subgroups based on arrangements of these domains [4]. Generally, full transporters contain two NBDs and two TMDs, half transporters contain one NBD and one TMD, and soluble ABC proteins only contain one NBD [4]. According to phylogenetic analyses, ABC transporters can also be classified into eight subfamilies based on evolutionary relatedness (A–G and ABCI; ABCH is not found in plants) [5,6].
In 1992, the first plant ABC transporter gene (AtPGP1) was cloned from Arabidopsis [7]. Since then, the volume of research focusing on the functions of plant ABC transporters has gradually increased and has revealed diverse roles of these proteins. Indeed, the current body of accumulated evidence indicates that these proteins transport plant hormones, metal ions, lipids, secondary metabolites, and exogenous substances, in addition to their roles in regulating plant ion channels and plant–pathogen interactions. Members of the soluble ABC protein subgroup, such as ABCE (Ribonuclease L inhibitor), participate in ribosome recycling and translation termination functions that influence leaf development [8,9]. To date, research on plant hormone and abiotic stress responses has been predominantly focused on the investigation of these processes in herbs, such as Arabidopsis thaliana.
Using a salt stress model, ABCA subfamily transporters have been shown to be downregulated after NaCl treatment in Arabidopsis [10], whereas ABCB transporters are mainly involved in the transport of plant hormones, although they can also enhance tolerance of plants to heavy metals [11,12,13,14,15]. ABCC transporters participate in cellular detoxification mainly by pumping toxins and heavy metals out of cells or vacuoles. [16,17,18,19]. The ABCG subfamily PDR subgroup of full transporter proteins is primarily responsible for managing abiotic stress and is also involved in hormone regulation [20,21,22], whereas the ABCG subfamily half transporter (WBC) subgroup of proteins is mainly involved in the transport of plant hormones [23,24,25].
Betula halophila, a member of the Betulaceae family, is found in the Altay region of northern Xinjiang, China, where it grows in salt marshes to an altitude of 1500 m. Due to its strong salt and drought resistance, B. halophila is a useful model species for studying plant resistance to abiotic stress. In a previous study, after B. halophila had been exposed to 200 mM NaCl for 0 h or 24 h to simulate salt stress, cDNA libraries were prepared from its leaves. Subsequently, high-throughput sequencing was conducted to identify differentially expressed genes (SRA: SRP146369) [26]. Gene expression profile analysis detected 15 differentially expressed BhABC genes in response to salt stress. Based on this result, we studied the expression profiles of these 15 genes in leaves, xylem, roots, and apical buds to better understand BhABC gene transcriptional responses to exogenous plant hormones and abiotic stressors under various conditions.

2. Materials and Methods

2.1. Plant Materials and Treatment Methods

B. halophila seeds were collected in Altay, Xinjiang, China and all seeds were half-siblings. After the seeds germinated, they were transplanted into soil within 10 × 10 cm culture pots and then cultivated at the Birch Breeding Base of the Northeast Forestry University of Harbin, China. Seedlings were grown for one year and only those with the same growth rate over this period were used in this study.
Seedlings were treated with exogenous hormones and abiotic stress reagents. For hormone treatments, seedlings were sprayed with 25 mg/L gibberellin (GA3), 1 μmol/L methyl jasmonate (MeJA), 350 μmol/L salicylic acid (SA), 0.2 mg/L brassinolide (BR), 50 mg/L cytokinin (6-BA), 100 μmol/L abscisic acid (ABA), or 50 mg/L auxin (IAA), respectively. For samples undergoing abiotic stress, 20% Polyethylene Glycol (PEG), 0.4 mol/L sodium chloride (NaCl), 150 μmol/L cadmium chloride (CdCl2), and 0.3 mol/L sodium bicarbonate (NaHCO3) were used for watering, with no additional watering performed over the study period.
Every day at 8:00 a.m., the spraying of hormones and the irrigation of abiotic stress reagents were carried out. Plants were sampled at various time points during abiotic stress and ABA treatments, namely 0 h, 6 h, 12 h, 24 h, 48 h, and 72 h. For all other hormone treatments, plants were sampled at 0 h, 2 h, 4 h, 6 h, 12 h, 24 h, 48 h, and 72 h. At each time point, xylem, roots, leaves, and apical buds of at least five seedlings were collected and pooled, immediately frozen in liquid nitrogen, then stored at −80 °C for RNA analysis.

2.2. Experimental Methods

2.2.1. Bioinformatics Analysis

We used the online National Center of Biotechnology Information (NCBI) Conversed Domains tool (http://0-www-ncbi-nlm-nih-gov.brum.beds.ac.uk/Structure/cdd/wrpsb.cgi) to predict protein open reading frame (ORF) length and conserved structural domains. The ExPASy tool (https://web.expasy.org/protparam/) was used to reveal amino acid sequences of proteins encoded by these genes and to calculate the theoretical isoelectric point of each protein. Subcellular localization was performed using ProtComp v9.0 (http://linux1.softberry.com/berry.phtml?group=programs&subgroup=proloc&topic=protcompan). Signal peptides were predicted using SignalP (http://www.cbs.dtu.dk/services/SignalP/). To carry out transmembrane structural region prediction for BhABC transporter proteins, we used the transmembrane structure analysis program TMHMM v2.0 (http://www.cbs.dtu.dk/services/TMHMM/). The phylogenetic tree was drawn using MEGA 5.0 (developer: Pennsylvania State University, State College, PA, USA) based on the following parameters: neighbor-joining tree method, complete deletion, and 500 bootstrap replicates.

2.2.2. Semi-Quantitative RT-PCR

For RNA extraction, we used an RNA extraction kit produced by Universal Plant Total RNA Extraction Kit (BioTeKe, Beijing, China). To perform reverse transcription of RNA to produce cDNA, we used a kit (Rever Tra Ace® qPCR RT Master Mix with gDNA Remover, TOYOBO, Shanghai, China). Dilutions of cDNA were used as templates for semi-quantitative RT-PCR analysis. Upstream and downstream primers were designed based on the specific sequence of each gene, with 18s RNA serving as internal reference gene (Table 1). The reaction system for performing semi-quantitative RT-PCR was as follows: TaKaRa rTaqTM (5 U/µL) (TaKaRa, Beijing, China) 0.2 µL, cDNA 1.0 µL, 1 µL of each upstream and downstream primer (10 μmol/L), dNTP mixture (2.5 mmol each) 1.6 µL, and 10× PCR buffer (Mg2+ free) 3.2 µL. Sufficient ddH2O was then added to each sample to adjust the total volume to 20 μL. Semi-quantitative RT-PCR was conducted using thermal cycling at 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 30 s. Amplification was repeated for a total of 35 cycles. The volume of each reaction product solution was adjusted to achieve a consistent concentration of internal reference gene PCR product across samples (to represent a constant number of original plant cells per final adjusted unit volume). In this way, variations in fluorescence intensity of BhABC PCR product bands, as detected during gel electrophoresis, would reflect differences in BhABC mRNA quantity in the original cells instead of differences due to variations in sample loading among gel lanes. Each standardized PCR product solution was then electrophoresed on 1% agarose gels and the intensity of each amplified fragment on the electropherogram was analyzed using Tanon Gis software (developer: Tanon, Shanghai, China) to generate a number representing the relative expression level of a given gene. Finally, heat maps were generated using HemI v1.0 software (developer: The CUCKOO Workgroup, China) based on the following parameter selections: linear normalized intensity data, average linkage clustering method, and similarity metric of Euclidean distance.

3. Results

3.1. Sequence Analysis of BhABC Genes in B. halophila

3.1.1. Analysis of Physicochemical Properties of BhABC Genes

We analyzed basic characteristics including open reading frame (ORF) length, amino acid number, isoelectric point, subcellular localization, signal peptide, and transmembrane structure of proteins predicted from 15 BhABC genes predicted from the B. halophila transcriptome (Table 2). ORF lengths within genes encoding BhABC proteins varied greatly, from 786 bp (BhABC2) to 4296 bp (BhABC12). Isoelectric points of BhABC proteins ranged between 5.41 and 9.68. It was predicted that only BhABC14 contained a signal peptide. Transporter proteins predicted to be located on the cell membrane were BhABC1, BhABC2, BhABC3, BhABC7, BhABC9, BhABC10, BhABC11, BhABC12, and BhABC14. BhABC15, BhABC4, BhABC6, and BhABC8 were predicted to be localized to chloroplast, whereas BhABC5 and BhABC13 were predicted to be located within mitochondria and nucleus, respectively. The number of transmembrane helices in BhABC transporters varied greatly. BhABC2, BhABC4, BhABC5, BhABC6, BhABC8, and BhABC13 had no transmembrane helix. By contrast, BhABC1, BhABC10, and BhABC12 proteins each had 13 transmembrane helices, whereas BhABC9 and BhABC11 had 11 and 10 transmembrane helices, respectively. BhABC15 had seven transmembrane helices, BhABC14 had six, and BhABC3 and BhABC7 each had four.

3.1.2. Analysis of BhABC Protein Domains

The ABC transporter domain has various histological forms. In this paper, BlastP provided by the National Center of Biotechnology Information (https://blast.n cbi.nlm.nih.gov/Blast.cgi?PAGE=Proteins) was used to predict conserved NBDs of 15 BhABC proteins (see Figure 1). Using numbers of NBDs, lengths of protein molecules, and results of phylogenetic tree analysis, the 15 BhABC proteins were divided into subfamilies (ABCB, ABCG, ABCF, and ABCI). Within these subfamilies, ABCB (MDR) and ABCG (PDR) proteins are full transporters and each contains two NBDs, whereas ABCB (TAP) and ABCG (WBC) proteins are half transporters with one NBD each. ABCF and ABCI subfamily proteins are soluble ABC proteins containing one NBD domain each.

3.1.3. Phylogenetic Analysis of BhABC Proteins

For phylogenetic analysis, a total of 68 ABC transporters were selected, comprising 24 Oryza sativa transporters, 29 Arabidopsis transporters [27], and 15 BhABC transporters. Phylogenetic tree analysis, carried out using MEGA software, sorted the 68 protein sequences into eight subfamilies (ABCA-ABCG and ABCI) unique to plants (see Figure 2). The ABCB subfamily was further divided into MDR, TAP, and ATM subgroups and the ABCG subfamily into PDR and WBC subgroups. Most BhABC transporters were found within a limited set of subfamilies (with or without subgroup in parentheses) as follows: ABCB (MDR), ABCB (TAP), ABCF, ABCG (PDR), ABCG (WBC), and ABCI. More specifically, BhABC7 and BhABC11 belonged to ABCB (MDR); BhABC3 belonged to ABCB (TAP); BhABC1, BhABC9, BhABC10, BhABC12, and BhABC15 belonged to ABCG (PDR); BhABC14 belonged to ABCG (WBC); and BhABC5 and BhABC6 belonged to subfamily ABCF. BhABC2, BhABC4, BhABC8, and BhABC13 belonged to subfamily ABCI.

3.2. Responses of BhABC Genes to Hormone Treatments

3.2.1. Responses of BhABC Genes to 6-Benzylaminopurine (6-BA)

Under 6-BA treatment, altered mRNA expression of most BhABC genes encoding full transporters and half transporters was observed in xylem, roots, and leaves, whereas in apical buds only the expression of BhABC genes encoding full transporters changed in response to treatment (see Figure 3). In xylem, mRNA levels reflecting expression of BhABC1, BhABC2, BhABC4, BhABC7, and BhABC11 genes were mainly upregulated at all treatment time points except at 72 h. Meanwhile, mRNA expression of BhABC1 and BhABC2 peaked at 6 h and of BhABC4 peaked at 24 h. BhABC8, BhABC12, and BhABC13 genes showed upregulated transcriptional responses after 6 h of treatment, whereas BhABC15 exhibited a transcriptional response that was first upregulated then downregulated. BhABC3, BhABC5, BhABC6, BhABC9, BhABC10, and BhABC14 expression levels did not change with treatment. In roots, mRNA expression levels of BhABC4 and BhABC14 were transiently upregulated at 6 h and 48 h, respectively. BhABC1, BhABC2, BhABC7, BhABC8, BhABC11, and BhABC15 genes were mainly upregulated at time points during the middle stage of treatment. Both BhABC1 and BhABC2 exhibited peak expression at 6 h. Expression levels of BhABC12 and BhABC13 genes increased during middle and late treatment stages, whereas expression of BhABC3, BhABC5, BhABC6, BhABC9, and BhABC10 genes did not change. In leaves, BhABC1, BhABC4, BhABC7, BhABC11, BhABC12, BhABC13, and BhABC15 were mainly upregulated after 12 h, but BhABC1 and BhABC4 reached peak expression levels only at 72 h and expression of other genes in leaves remained unchanged. In apical buds, only BhABC1, BhABC7, and BhABC15 responded to 6-BA treatment, with expression of BhABC15 in bud similar to expression in xylem, such that both were upregulated then downregulated, whereas BhABC1 and BhABC7 exhibited upregulation at 12 h and 4 h of treatment, respectively.

3.2.2 Responses of BhABC Genes to Brassinolide (BR)

During BR treatment, BhABC full transporter genes were the main genes with altered expression in xylem and apical buds, whereas most BhABC genes among all three subgroups (full transporter, half transporter, soluble ABC proteins) responded to BR in roots and leaves (see Figure 4). In xylem, only BhABC1, BhABC11, BhABC12, BhABC14, and BhABC15 responded to BR, with upregulated expression of each after 12 h, whereas expression of BhABC1 peaked at 48 h. In roots, BhABC15 was first upregulated then downregulated, BhABC12 was upregulated early, and BhABC3 and BhABC10 genes were upregulated at 72 h. BhABC1, BhABC2, BhABC4, BhABC5, BhABC8, BhABC11, and BhABC14 genes all showed different degrees of upregulation in middle and late treatment stages, with BhABC1 mRNA expression peaking at 72 h. BhABC6, BhABC7, BhABC9, and BhABC13 were unresponsive to BR treatment, with mRNA expression levels remaining unchanged. In leaves, only BhABC3, BhABC13, and BhABC14 mRNA levels remained unchanged, whereas the remaining genes responded to BR hormone treatment; the expression level of BhABC15 was initially downregulated then upregulated, whereas other genes were mainly upregulated in the middle and late stages of treatment and BhABC4 expression peaked at 72 h. In apical buds, only BhABC1, BhABC5, BhABC10, BhABC11, BhABC12, and BhABC15 responded to BR, with BhABC15 mainly showing a downregulated transcriptional response and the other genes exhibiting upregulation during middle and late treatment stages.

3.2.3. Responses of BhABC Genes to Gibberellin (GA3)

During GA3 treatment (see Figure 5), only BhABC11, BhABC14, and BhABC15 mRNA expression levels changed in xylem, with downregulation of expression of BhABC11 and upregulation of BhABC14 and BhABC15 observed after 12 h. In roots, mRNA levels of BhABC1, BhABC2, BhABC3, BhABC4, BhABC5, BhABC7, BhABC9, BhABC10, BhABC12, and BhABC14 were upregulated after 6 h, with expression of BhABC1 and BhABC3 peaking at 48 h. BhABC6, BhABC8, BhABC11, and BhABC13 expression did not change, whereas BhABC15 was downregulated after 12 h. In leaves, BhABC1, BhABC2, BhABC5, and BhABC11 showed upregulated transcriptional responses during the middle stage of treatment, with BhABC1 and BhABC2 reaching highest expression levels at 48 h. BhABC10, BhABC12, BhABC13, BhABC14, and BhABC15 were upregulated during middle and late stages of treatment, whereas BhABC3, BhABC4, BhABC6, BhABC7, BhABC8, and BhABC9 genes were not expressed. In apical buds, BhABC15 showed alternate upregulation and downregulation, whereas mRNA levels of BhABC1, BhABC5, BhABC10, BhABC11, BhABC12, BhABC13, and BhABC14 genes were upregulated at most time points throughout the experiment, with expression of BhABC1 reaching a peak at 48 h. No changes in the expression of remaining genes were observed.

3.2.4. Responses of BhABC Genes to Salicylic Acid (SA)

During SA treatment, genes encoding three subgroups of two subfamilies of BhABC transporters, namely ABCG (PDR), ABCG (WBC), and ABCB (MDR), exhibited differing degrees of responses among all four tissue sites (see Figure 6). In xylem, mRNA-level expression of BhABC11 and BhABC15 was downregulated during early treatment stages, whereas BhABC13 and BhABC14 showed upregulated expression after 12 h. No changes in the expression of remaining genes were observed. In roots, only seven genes responded to SA, with expression of BhABC15 downregulated, whereas BhABC12 was upregulated at 72 h. Expression levels of BhABC2, BhABC3, BhABC7, BhABC11, and BhABC14 peaked in middle and later treatment stages, with mRNA transcription levels of BhABC2 and BhABC3 highest at 48 h. In leaves, BhABC14 and BhABC15 were downregulated in later treatment stages, BhABC1, BhABC2, BhABC3, BhABC5, BhABC6, BhABC7, BhABC10, BhABC11, and BhABC12 genes were upregulated in middle and later treatment stages, and no changes in expression of BhABC4, BhABC8, BhABC9, and BhABC13 were observed. In apical buds, BhABC14 exhibited upregulation then downregulation of transcriptional response. Meanwhile, BhABC11 and BhABC12 were briefly upregulated between 2 h and 4 h, whereas BhABC1, BhABC6, BhABC10, and BhABC15 genes were upregulated during middle and later treatment stages, and BhABC15 expression peaked at 72 h. No changes in the expression of remaining genes were observed in response to SA treatment.

3.2.5. Responses of BhABC Genes to Jasmonic Acid (JA)

During JA treatment, generally most BhABC full transporter and half transporter gene subgroups responded to JA in all four tissues (see Figure 7). In xylem, only BhABC11, BhABC14, and BhABC15 responded to JA, with mRNA expression of BhABC11 and BhABC14 upregulated then downregulated during middle and later treatment stages. In roots, five genes responded to JA, including BhABC14, which was upregulated then downregulated, whereas BhABC9, BhABC11, BhABC12, and BhABC15 were all upregulated and BhABC15 peaked at 2 h. In leaves, BhABC2, BhABC7, BhABC9, BhABC11, and BhABC12 were all upregulated after 24 h. By contrast, expression levels of BhABC14 and BhABC15 decreased during early treatment stages and the remaining genes experienced no changes in expression. In apical buds, BhABC15 exhibited upregulation followed by downregulation, whereas BhABC1, BhABC2, BhABC3, BhABC4, BhABC6, BhABC7, BhABC9, BhABC11, BhABC13, and BhABC14 were upregulated during middle and late treatment stages. No changes were observed in BhABC5, BhABC8, BhABC10, BhABC12, and BhABC13 expression.

3.2.6 Responses of BhABC Genes to Indole-3-Acetic Acid (IAA)

After IAA treatment (see Figure 8), in xylem and roots BhABC genes responding to IAA were mainly full and half transporters, whereas in leaf and terminal buds all three types of BhABC proteins responded to IAA. In xylem, only BhABC14 responded to IAA and exhibited upregulated expression in middle and late treatment stages. In roots, BhABC2, BhABC11, BhABC14, and BhABC15 were upregulated during middle and later stages of IAA treatment, whereas remaining genes were not induced. In leaves, BhABC2, BhABC3, BhABC4, BhABC5, BhABC6, BhABC7, BhABC9, BhABC11, BhABC14, and BhABC15 exhibited different degrees of upregulation during middle and late treatment stages, with BhABC11 peaking at 48 h and expression of BhABC1, BhABC8, BhABC10, BhABC12, and BhABC13 unchanged. Expression patterns of BhABC genes in apical buds were similar to patterns in leaves, with BhABC11 expression peaking at 48 h as well.

3.2.7. Responses of BhABC Genes to Abscisic Acid (ABA)

In response to ABA treatment, expression of the three subgroups of BhABC genes in all four studied tissues responded to ABA (see Figure 9). In xylem, only BhABC3, BhABC11, BhABC14, and BhABC15 showed upregulated expression, which occurred during middle and late treatment stages, with remaining genes not induced. In roots, BhABC1, BhABC6, BhABC8, BhABC11, BhABC12, BhABC14, and BhABC15 were upregulated during middle and late stages of treatment, whereas no other genes were induced. In leaves, BhABC1, BhABC2, BhABC3, BhABC6, BhABC8, BhABC11, BhABC12, BhABC14, and BhABC15 all exhibited upregulated expression after 48 h, with expression levels of BhABC1 and BhABC15 peaking at 72 h and remaining genes not induced. In apical buds, BhABC4, BhABC5, and BhABC13 RNA levels were unchanged, but the other genes exhibited upregulated expression to varying degrees during middle and late stages of treatment, with BhABC1, BhABC2, BhABC3, and BhABC15 upregulated to the greatest extent between 48 h and 72 h.

3.3. Expression Characteristics of BhABC Genes under Abiotic Stress

3.3.1. Expression of BhABC Genes under NaCl Stress

Under conditions of NaCl stress, the three subgroups of BhABC proteins showed variable degrees of responsiveness among all four tissue sites (see Figure 10). In xylem, BhABC15 exhibited downregulated expression after 6 h, whereas BhABC2, BhABC3, BhABC5, BhABC6, BhABC10, BhABC11, BhABC12, BhABC13, and BhABC14 all exhibited upregulated expression to varying degrees during middle and later stages of treatment. No changes in expression of BhABC1, BhABC4, BhABC7, BhABC8, and BhABC9 were observed. In roots, BhABC15 exhibited downregulated expression, whereas BhABC2 and BhABC6 exhibited upregulated expression at 72 h and BhABC7 exhibited a transient increase in expression at 24 h. Meanwhile, BhABC3, BhABC5, BhABC11, BhABC13, and BhABC14 showed higher expression levels during middle or later treatment stages, whereas expression of BhABC3 and BhABC11 peaked at 24 h. No changes in the expression of remaining genes were observed. In leaves, only BhABC8 did not respond to NaCl treatment, whereas BhABC15 showed upregulation followed by downregulation. All remaining genes were upregulated during middle and late treatment stages, with expression of BhABC1 and BhABC9 peaking at 24 h. In apical buds, BhABC3, BhABC8, and BhABC15 were not induced, whereas all other genes exhibited upregulation during the middle treatment stage.

3.3.2. Expression of BhABC Genes under CdCl2 Stress

As for NaCl stress, three subgroups of BhABC proteins responded to CdCl2 stress in all four tissues (see Figure 11). In xylem, BhABC11 and BhABC15 were upregulated then downregulated, whereas BhABC1, BhABC2, BhABC5, BhABC6, BhABC8, BhABC12, and BhABC14 were upregulated during middle and later stages of treatment, with expression of BhABC1, BhABC2, and BhABC6 genes significantly upregulated at 48 h. In roots, only BhABC7, BhABC10, and BhABC13 did not respond to CdCl2, whereas BhABC1, BhABC3, BhABC6, and BhABC8 exhibited downregulation. BhABC11, BhABC12, and BhABC15 showed upregulation then downregulation, whereas all remaining genes were upregulated to varying degrees. In leaves, all genes except BhABC7 responded to CdCl2 treatment, with BhABC14 and BhABC15 exhibiting upregulation then downregulation and remaining genes exhibiting upregulation to varying degrees during middle and later treatment stages. In apical buds, BhABC10 was downregulated in the middle treatment stage, whereas BhABC1, BhABC9, BhABC14, and BhABC15 exhibited upregulation then downregulation. Meanwhile, BhABC3, BhABC4, BhABC5, and BhABC6 were upregulated dramatically at 6 h, with upregulation and high expression of BhABC11 observed at 72 h. No changes in the expression of remaining genes were observed.

3.3.3. Expression of BhABC Genes under NaHCO3 Stress

During NaHCO3 stress, BhABC genes generally exhibited low levels of expression in xylem, leaves, and apical buds (see Figure 12). In xylem, only BhABC1, BhABC3, BhABC14, and BhABC15 responded to NaHCO3 stress, with BhABC15 showing downregulated expression during the middle treatment stage, BhABC1 and BhABC3 showing upregulation at 6 h, and upregulation observed for BhABC14 at 72 h. In leaves, regulation of BhABC15 expression resembled its regulation pattern in xylem, showing a downregulated expression pattern during later treatment stages. BhABC2 expression was upregulated to a relatively high level at 24 h, whereas BhABC11 was upregulated during middle and late treatment stages. In apical buds, BhABC2, BhABC11, BhABC12, BhABC14, and BhABC15 expression levels were mainly upregulated during middle and later treatment stages. In roots, BhABC1, BhABC3, BhABC6, BhABC7, BhABC8, BhABC9, BhABC10, BhABC11, BhABC14, and BhABC15 exhibited upregulation during middle and later stages of treatment, with BhABC3, BhABC7, BhABC9, BhABC11, and BhABC14 exhibiting significantly increased expression levels at 72 h. No changes in the expression of remaining genes were observed.

3.3.4. Expression of BhABC Genes under Polyethylene Glycol (PEG) stress

Genes exhibiting altered mRNA expression after plant exposure to PEG stress were mainly BhABC full and half transporters, with altered expression observed in the four tissues studied (see Figure 13). In xylem, BhABC11 and BhABC15 showed opposing transcriptional responses of upregulation and downregulation, respectively. BhABC1 and BhABC2 were downregulated at 6 h and 48 h, respectively, whereas BhABC6 and BhABC14 were upregulated at 72 h. In roots, BhABC11 was downregulated during the middle treatment stage, whereas BhABC12 and BhABC15 were upregulated then downregulated. Meanwhile, BhABC1, BhABC2, BhABC3, BhABC5, and BhABC14 genes were upregulated at some time points, whereas no changes in the expression of remaining genes were observed. In leaves, expression levels of BhABC6 and BhABC15 were first downregulated then upregulated and expression levels of BhABC1, BhABC2, BhABC3, BhABC5, BhABC7, BhABC8, BhABC11, BhABC12, and BhABC14 were all upregulated to varying degrees over the course of treatment. No changes in the expression of remaining genes were observed. In apical buds, BhABC11, BhABC14, and BhABC15 were all upregulated then downregulated, whereas BhABC1, BhABC5, BhABC6, BhABC7, BhABC8, and BhABC12 were all upregulated, with expression of BhABC12 peaking during the first PEG treatment stage. No changes in the expression of remaining genes were observed.

4. Discussion

After analyzing physical and chemical properties of 15 BhABC family proteins deduced from transcriptome gene sequences, six BhABC proteins were found to lack transmembrane domains. Subsequent prediction of structural domains and phylogenetic tree analysis revealed six genes coding for soluble ABC proteins belonging to ABCF and ABCI subfamilies. We constructed a preliminary phylogenetic tree of BhABC transporter proteins showing that they were distributed among six subfamilies of which several contained subgroups (in parentheses): ABCB (MDR), ABCB (TAP), ABCF, ABCG (PDR), ABCG (WBC), and ABCI. Except for the ABCI subfamily, all other subfamilies were associated with single phylogenetic tree branches (see Figure 2), a result that aligns with previously reported phylogenetic tree results for Arabidopsis and O. sativa ABC transporter proteins [27]. As ABCI proteins contain only a single domain (NBD or auxiliary domain), clustering of members of this subfamily was observed within three distinct phylogenetic tree branches, each closely associated with different subfamilies. The phylogenetic tree shows that protein pairs with greatest homology, namely BhABC7 paired with BhABC11 and BhABC10 paired with BhABC15, exhibited 72.33% and 92.87% amino acid sequence similarity, respectively. Comparisons among ABC transporters of B. halophila, A. thaliana, and O. sativa demonstrated variability in relative evolutionary distances between proteins. For example, three pairs of close homologs, BhABC8 and OsABCI15, BhABC14 and AtABCG24, and BhABC2 and AtABCI17, exhibited protein sequence similarities of 77.03%, 60.59%, and 70.79%, respectively. Greater homology of transporters across subfamilies than among members within a given subfamily may be explained by the functional conservation of structure between protein homologs of herbs and woody plants. However, although the similarity between BhABC3 and OsABCB25 was 65%, the similarity between BhABC5 homologs of A. thaliana and O. sativa was only about 50%, suggesting that substantial genetic and functional differences exist between woody and herbaceous plants.
We studied expression characteristics of BhABC genes in response to exogenous plant hormones and abiotic stressors using semi-quantitative RT-PCR analysis. Of the genes responding to these stimuli, a high proportion belonged to ABCB and ABCG subfamilies, which happen to be the same plant subfamilies currently under study for their suspected roles in exogenous hormone and abiotic stressor responses [4].As BhABCs are known to exhibit variable expression patterns in response to exogenous hormones, under IAA treatment BhABC11 (ABCB subfamily, subgroup MDR) was upregulated in roots and BhABCB (MDR) genes BhABC7 and BhABC11 were upregulated in leaves and apical buds. At the same time, IAA led to increased gene expression in B. halophila roots, leaves, and apical buds of ABCG (PDR) genes BhABC9 and BhABC15. In A. thaliana, the AtABCB19, AtABCB4, AtABCB11/MDR8, AtABCB14/MDR12, and AtABCB15/MDR13 genes are involved in auxin transport and regulation [11,12,28], with Indole-3-Butytric acid (IBA ) serving as a storage form of IAA. AtABCG36/PDR8 mediates IBA output and regulates its accumulation in cells, contributing to the regulation of intracellular auxin dynamic balance [29]. We found that treatment with IAA led to increased gene expression in B. halophila roots, leaves, and apical buds of ABCG (PDR) genes BhABC9 and BhABC15. Meanwhile, cytokinins are substances mainly synthesized in root tips which regulate plant growth during water transport from xylem to aboveground plant tissues. The AtABCG14 gene, a member of subgroup ABCG (WBC), is involved in transport of cytokinins in roots [24]. Notably, in B. halophila, 6-BA treatment led to upregulated expression of the ABCG (WBC) gene BhABC14 only in roots, raising speculation that BhABC14 may share functionality with AtABCG14. Likewise, after ABA treatment, some BhABCG subfamilies showed upregulated expression patterns in the four tissue types studied here; some of these results align with results of an earlier study demonstrating that stomata of loss-of-function AtABCG40 mutants closed more slowly in response to ABA, resulting in reduced drought tolerance [21]. In addition, another transport protein, AtABCG22, may play a role in ABA signal transduction and ABA biosynthesis [30,31]. Meanwhile, GmPDR12 in soybean (Glycine max) can be expressed rapidly and in large quantities in response to treatment with salicylic acid and its functional derivatives [32]; here, after salicylic acid treatment BhABC15 (PDR) was downregulated in xylem, roots, and leaves. Taken together, the collective results demonstrate that ABC transporters may have different functions in woody versus herbaceous plants.
When under abiotic stress from cadmium treatment, Arabidopsis seedlings upregulate AtPDR8 (ABCG subfamily) in roots, stems, and other plant tissues [33], whereas ABCB HMT1 protein can improve cadmium tolerance in yeast cells [34,35]. The relationship between ABC transporter proteins and drought resistance has also been studied, with expression of proteins encoded by the ABCG gene subfamily in millet found to vary to differing degrees in response to PEG stress [36]. Moreover, in A. thaliana, AtABCG40 (PDR) gene expression relies on the ABA signaling pathway to regulate the rate of stomatal closure, thereby increasing the ability of plants to resist drought [19]. Meanwhile, AtABCG36 helps plants resist drought and salt by reducing the amount of sodium in the plant [37]. Here, CdCl2 treatment resulted in variable changes in expression levels of most BhABCG (PDR) genes in the four plant tissues studied, with BhABCB genes mainly downregulated in xylem and roots. During PEG treatment, ABCG gene expression was altered in all four tissues, whereas during NaCl stress, expression of ABCG (PDR) genes in xylem, leaves, and apical buds were all upregulated.
Under stress, the balance between various hormone levels is disrupted, leading to disturbances in plant growth rhythms and disordered metabolic functions. Therefore, below a certain limit, plants can apparently adjust their physiological functions to compensate for changing hormone levels in order to adapt to adverse environmental conditions. In the abovementioned experiment, all genes that were upregulated in response to ABA hormone treatment were upregulated in all four tissues in this study. The expression patterns of BhABC transporters in response to NaCl, PEG, NaHCO3, CdCl2, and ABA treatments suggest that BhABC genes, which are involved in different abiotic stress responses, may be regulated by ABA-dependent stress signaling pathways.

5. Conclusions

The 15 identified BhABC genes were assigned to four major subfamilies. In the ABCB subfamily were BhABC7 and BhABC11 (MDR) and BhABC3 (TAP); in the ABCG subfamily were BhABC1, BhABC9, BhABC10, BhABC12, BhABC15 (PDR), and BhABC14 (WBC); the ABCF subfamily contained BhABC5 and BhABC6; all remaining genes (BhABC2, BhABC4, BhABC8, and BhABC13) were assigned to subfamily ABCI. After treatment with seven exogenous phytohormones and four abiotic stress treatments, it was found that most ABCB and ABCG genes were involved in plant responses to hormones and abiotic stress. We note that molecular mechanisms underlying these responses require further study.

Author Contributions

Conceptualization, J.J., H.L., and L.A.; Formal analysis, L.A., Q.M., M.Y. and F.L.; Software, L.A., J.D., and J.L.; Writing—original draft, L.A.; Writing—review and editing, H.L.

Funding

This work was supported by the Provincial Funding for Major National Science and Technology Projects and Key R&D Projects in Heilongjiang Province (GX18B027), the Innovation Project of State Key Laboratory of Tree Genetics and Breeding (Northeast Forestry University) (2015B01), and the 111 Project (B16010).

Conflicts of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as, or have the appearance of being, a potential conflict of interest.

Abbreviations

NBDNucleotide binding domains
TMDTransmembrane domains
ORFOpen reading frame
6-BA6-Benzylaminopurine
BRBrassinolide
GA3Gibberellin
SASalicylic acid
JAJasmonic acid
IAAIndole-3-acetic acid
ABAAbscisic acid
PDRPleiotropic drug resistance
WBCWhite-brown complex
ATHABC2 homologue
MDRMultidrug resistance protein
TAPTransporter associated with antigen processing
ATMABC transporter of the mitochondria
MRPMultidrug resistance-associated protein

References

  1. Glavinas, H.; Krajcsi, P.; Cserepes, J.; Sarkadi, B. The role of ABC transporters in drug resistance, metabolism and toxicity. Curr. Drug Deliv. 2004, 1, 27–42. [Google Scholar] [CrossRef] [PubMed]
  2. Shukla, S.; Wu, C.P.; Ambudkar, S.V. Development of inhibitors of ATP-binding cassette drug transporters—present status and challenges. Expert Opin. Drug Metab. Toxicol. 2008, 4, 205–223. [Google Scholar] [CrossRef] [PubMed]
  3. Beek, J.T.; Guskov, A.; Slotboom, D.J. Structural diversity of ABC transporters. J. Gen. Physiol. 2014, 143, 419–435. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Wang, X.Z.; Sun, W.M.; Ma, Y.F.; Han, E.Q.; Han, L.; Sun, L.P.; Peng, Z.H.; Wang, B.J. Research progress of ABC transporters in Arabidopsis thaliana. Plant. Physiol. 2017, 2, 4–15. [Google Scholar]
  5. Verrier, P.J.; Bird, D.; Burla, B.; Dassa, E.; Forestier, C.; Geisler, M.; Klein, M.; Kolukisaoglu, U.; Lee, Y.; Martinoia, E.; et al. Plant ABC proteins—A unifi ed nomenclature and updated inventory. Trends Plant. Sci. 2008, 13, 151–159. [Google Scholar] [CrossRef] [PubMed]
  6. Kang, J.; Park, J.; Choi, H.; Burla, B.; Kretzschmar, T.; Lee, Y.; Martinoia, E. Plant ABC transporters. In Arabidopsis Book; BioOne: Washington, DC, USA, 2011; Volume 9, p. e0153. [Google Scholar]
  7. Dudle, R.; Hertig, C. Structure of an mdr-like gene from Arabidopsis thaliana. J. Biol. Chem. 1992, 267, 5882–5888. [Google Scholar]
  8. Kougioumoutzi, E.; Cartolano, M.; Canales, C.; Dupré, M.; Bramsiepe, J.; Vlad, D.; Rast, M.; Dello Ioio, R.; Tattersall, A.; Schnittger, A.; et al. SIMPLE LEAF3 encodes a ribosome-associated protein required for leaflet development in Cardamine hirsuta. Plant J. 2013, 73, 533–545. [Google Scholar] [CrossRef]
  9. Navarro-Quiles, C.; Mateo-Bonmati, E.; Micol, J.L. ABCE Proteins: From Molecules to Development. Front. Plant Sci. 2018, 9, 1125. [Google Scholar] [CrossRef]
  10. Maathuis, F.J.; Filatov, V.; Herzyk, P.C.; Krijger, G.B.; Axelsen, K.; Chen, S.; Green, B.J.; Li, Y.; Madagan, K.L.; Sanchez-Fernandez, R.; et al. Transcriptome analysis of root transporters reveals participation of multiple gene families in the response to cation stress. Plant J. 2003, 35, 675–692. [Google Scholar] [CrossRef]
  11. Wu, G.; Carville, J.S.; Spalding, E.P. ABCB19-mediated polar auxin transport modulates Arabidopsis hypocotyl elongation and the endoreplication variant of the cell cycle. Plant J. 2016, 85, 209–218. [Google Scholar] [CrossRef]
  12. Kubeš, M.; Yang, H.; Richter, G.L.; Cheng, Y.; Młodzińska, E.; Wang, X.; Blakeslee, J.J.; Carraro, N.; Petrášek, J.; Zažímalová, E.; et al. The Arabidopsis concentration-dependent infl ux/effl ux transporter ABCB4 regulates cellular auxin levels in the root epidermis. Plant J. 2012, 69, 640–654. [Google Scholar] [CrossRef] [PubMed]
  13. Chen, S.X.; et al. Functional Characterization of AtATM1, AtATM2, and AtATM3, a subfamily of Aradopsis half-molecule ATP-binding cassette transporters implicated in iron homeostasis. J. Bio. Chem. 2001, 282, 21561–21571. [Google Scholar] [CrossRef] [PubMed]
  14. Kim, D.Y.; Bovet, L.; Kushnir, S.; Noh, E.W.; Martinoia, E.; Lee, Y. ArATM3 is invovled in heavy metal resistance in Arabidopsis. Plant Physiol. 2006, 140, 922–932. [Google Scholar] [CrossRef] [PubMed]
  15. Kim, S.; Selote, D.S.; Vatamaniuk, O.K. The N-terminal extension domain of the C. elegans half-molecule ABC transporter, HMT-1, is required for protein-protein interactions and function. PLoS ONE 2010, 5, e12938. [Google Scholar] [CrossRef] [PubMed]
  16. Park, J.; Song, W.Y.; Ko, D.; Eom, Y.; Hansen, T.H.; Schiller, M.; Lee, T.G.; Martinoia, E.; Lee, Y. The phytochelatin transporters AtABCC1 and AtABCC2 mediate tolerance to cadmium and mercury. Plant J. 2012, 69, 278–288. [Google Scholar] [CrossRef] [PubMed]
  17. Song, W.Y.; Park, J.; Mendoza-Cózatl, D.G.; Suter-Grotemeyer, M.; Shim, D.; Hörtensteiner, S.; Geisler, M.; Weder, B.; Rea, P.A.; Rentsch, D.; et al. Arsenic tolerance in Arabidopsis is mediated by two ABCC-type phytochelatin transporters. Proc. Natl. Acad. Sci. USA 2010, 107, 21187–21192. [Google Scholar] [CrossRef] [PubMed]
  18. Brunetti, P.; Zanella, L.; De, P.A.; Di Litta, D.; Cecchetti, V.; Falasca, G.; Barbieri, M.; Altamura, M.M.; Costantino, P.; Cardarelli, M. Cadmium-inducible expression of the ABC-type transporter AtABCC3 increases phytochelatin-mediated cadmium tolerance in Arabidopsis. J. Exp. Bot. 2015, 66, 3815–3829. [Google Scholar] [CrossRef]
  19. Nagy, R.; Grob, H.; Weder, B.; Green, P.; Klein, M.; Frelet-Barrand, A.; Schjoerring, J.K.; Brearley, C.; Martinoia, E. The Arabidopsis ATP-binding cassette protein AtMRP5/AtABCC5 is a high affinity inositol hexakisphosphate transporter involved in guard cell signaling and phytate storage. J. Biol. Chem. 2009, 284, 33614–33622. [Google Scholar] [CrossRef]
  20. Moons, A. Ospdr9, which encodes a PDR- type ABCtransporter, is induced by heavy metals, hypoxic stress and redox perturbations in rice roots. FEBS Lett. 2003, 553, 370–375. [Google Scholar] [CrossRef]
  21. Kang, J.; Hwang, J.U.; Lee, M.; Kim, Y.Y.; Assmann, S.M.; Martinoia, E.; Lee, Y. PDR-Type ABC Transporter Mediates Cellular Uptake of the Phytohormone Abscisic Acid. Proc. Natl. Acad. Sci. USA 2010, 107, 2355–2360. [Google Scholar] [CrossRef]
  22. Kang, J.; Yim, S.; Choi, H.; Kim, A.; Lee, K.P.; Lopez-Molina, L.; Martinoia, E.; Lee, Y. Abscisic acid transporters cooperate to control seed germination. Nat. Commun. 2015, 6, 8113. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Kuromori, T.; Miyaji, T.; Yabuuchi, H.; Shimizu, H.; Sugimoto, E.; Kamiya, A.; Moriyama, Y.; Shinozaki, K. ABC transporter AtABCG25 is involved in abscisic acid transport and responses. Proc. Natl. Acad Sci USA 2010, 107, 2361–2366. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Ko, D.; Kang, J.; Kiba, T.; Park, J.; Kojima, M.; Do, J.; Kim, K.Y.; Kwon, M.; Endler, A.; Song, W.Y.; et al. Arabidopsis ABCG14 is essential for the root-to-apical bud translocation of cytokinin. Proc. Natl. Acad. Sci. USA 2014, 111, 7150–7155. [Google Scholar] [CrossRef] [PubMed]
  25. Zhang, K.; Novak, O.; Wei, Z.; Gou, M.; Zhang, X.; Yu, Y.; Yang, H.; Cai, Y.; Strnad, M.; Liu, C.J. Arabidopsis ABCG14 protein controls the acropetal translocation of root-synthesized cytokinins. Nat. Commun. 2014, 5, 3247. [Google Scholar] [CrossRef] [PubMed]
  26. Shao, F.J.; Zhang, L.S.; Iain, W.W.; Qiu, D.Y. Transcriptomic Analysis of Betula halophila in Response to Salt Stress. Int. J. Mol. Sci. 2018, 19, 3412. [Google Scholar]
  27. Nguyen, V.N.T.; Moon, S.; Jung, K.H. Genome-wide expression analysis of rice ABC transporter family across spatio-temporal samples and in response to abiotic stresses. J. Plant Physiol. 2014, 171, 1276–1288. [Google Scholar] [CrossRef] [PubMed]
  28. Kaneda, M.; Schuetz, M.; Lin, B.S.P.; Chanis, C.; Hamberger, B.; Western, T.L.; Ehlting, J.; Samuels, A.L. ABC transporters coordinately expressed during lignifi cation of Arabidopsis stems include a set of ABCBs associated with auxin transport. J. Exp. Bot. 2011, 62, 2063–2077. [Google Scholar] [CrossRef]
  29. Strader, L.C.; Bartel, B. The Arabidopsis PLEIOTROPIC DRUG RESISTANCE8/ABCG36 ATP binding cassette transporter modulates sensitivity to the auxin precursor indole-3-butyric acid. Plant Cell 2009, 21, 1992–2007. [Google Scholar] [CrossRef]
  30. Ha, C.V.; Leyva-González, M.A.; Osakabe, Y.; Tran, U.T.; Nishiyama, R.; Watanabe, Y.; Tanaka, M.; Seki, M.; Yamaquchi, S.; Dong, N.V.; et al. Positive regulatory role of strigolactone in plant responses to drought and salt stress. Proc. Natl. Acad. Sci. USA 2014, 11, 851–856. [Google Scholar] [CrossRef]
  31. Merilo, E.; Jalakas, P.; Laanemets, K.; Mohammadi, O.; Hõrak, H.; Kollist, H.; Brosché, M. Abscisic acid transport and homeostasis in the context of stomatal regulation. Mol. Plant 2015, 8, 1321–1333. [Google Scholar] [CrossRef]
  32. Eichhorn, H.; Klinghammer, M.; Becht, P.; Tenhaken, R. Isolation of a novel ABC-transporter gene from soybean induced by salicylic acid. J. Exp. Bot. 2006, 57, 2193–2201. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Kim, D.Y.; Bovet, L.; Maeshima, M.; Martinoia, E.; Lee, Y. The ABC transporter AtPDR8 is a cadmium extrusion pump conferring heav ymetal resistance. Plant J. 2007, 50, 207–218. [Google Scholar] [CrossRef] [PubMed]
  34. Ortiz, D.F.; Kreppel, L.; Speiser, D.M.; Scheel, G. Heavy metal tolerance in the fission yeast requires an ATP-binding cassette- type vacuolar membrane transporter. EMBO J. 1992, 11, 3491–3499. [Google Scholar] [CrossRef] [PubMed]
  35. Ortiz, D.F.; Ruscitti, T.; McCue, K.F.; Ow, D.W. Transport of metal-binding peptides by HMT1, a fission yeast ABC-type vacuolar membrane protein. J. Biol. Chem. 1995, 270, 4721–4728. [Google Scholar] [CrossRef] [PubMed]
  36. Zhang, R.J.; Wang, Z.; Lian, B.Y.; Guo, Z.; Wei, D.; Yu, S.H.; Li, H.Y.; Liu, X.D. Study on the relationship between ABC transporter genes and drought tolerance in foxtail millet. Shanxi Agric. Univ. 2018, 38, 011. [Google Scholar]
  37. Kim, D.Y.; Jin, J.Y.; Alejandro, S.; Lee, Y. Overexpression of AtABCG36 improves drought and salt stress resistance in Arabidopsis. Physiol. Plant. 2010, 139, 170–180. [Google Scholar] [CrossRef] [PubMed]
Forests 10 00722 g001 550
Figure 1. Prediction of conserved domains of BhABC genes. Gray areas represent exons, blue areas represent introns, and orange areas represent locations of nucleotide-binding domains (NBDs).
Figure 1. Prediction of conserved domains of BhABC genes. Gray areas represent exons, blue areas represent introns, and orange areas represent locations of nucleotide-binding domains (NBDs).
Forests 10 00722 g001
Forests 10 00722 g002 550
Figure 2. Phylogenetic tree of ABC transporter proteins (BhABC transporters noted with red/orange diamonds). Phylogenetic subclasses are marked with different colors and corresponding subfamily names. The phylogenetic tree was drawn using MEGA 5.0 and was based on the following parameters: neighbor-joining tree method, complete deletion, and 500 bootstrap replicates. OsABC denotes Oryza sativa ABC proteins (including 24 members), AtABC denotes Arabidopsis ABC proteins (including 29 members), and BhABC denotes B. halophila ABC proteins (including 15 members). Numeric values indicate estimated evolutionary distances.
Figure 2. Phylogenetic tree of ABC transporter proteins (BhABC transporters noted with red/orange diamonds). Phylogenetic subclasses are marked with different colors and corresponding subfamily names. The phylogenetic tree was drawn using MEGA 5.0 and was based on the following parameters: neighbor-joining tree method, complete deletion, and 500 bootstrap replicates. OsABC denotes Oryza sativa ABC proteins (including 24 members), AtABC denotes Arabidopsis ABC proteins (including 29 members), and BhABC denotes B. halophila ABC proteins (including 15 members). Numeric values indicate estimated evolutionary distances.
Forests 10 00722 g002
Forests 10 00722 g003 550
Figure 3. Expression patterns of BhABC genes in xylem, roots, leaves, and apical buds after 6-BA treatment. Heat map showing responses of BhABC genes to 6-BA (right); semi-quantitative RT-PCR analysis with 18s RNA internal reference (left).
Figure 3. Expression patterns of BhABC genes in xylem, roots, leaves, and apical buds after 6-BA treatment. Heat map showing responses of BhABC genes to 6-BA (right); semi-quantitative RT-PCR analysis with 18s RNA internal reference (left).
Forests 10 00722 g003
Forests 10 00722 g004 550
Figure 4. Expression patterns of BhABC genes in xylem, roots, leaves, and apical buds after BR treatment. Heat map showing responses of BhABC genes to BR (right); semi-quantitative RT-PCR analysis with 18s RNA internal reference (left).
Figure 4. Expression patterns of BhABC genes in xylem, roots, leaves, and apical buds after BR treatment. Heat map showing responses of BhABC genes to BR (right); semi-quantitative RT-PCR analysis with 18s RNA internal reference (left).
Forests 10 00722 g004
Forests 10 00722 g005 550
Figure 5. Expression patterns of BhABC genes in xylem, roots, leaves, and apical buds after GA3 treatment. Heat map showing responses of BhABC genes to GA3 (right); semi-quantitative RT-PCR analysis with 18s RNA internal reference (left).
Figure 5. Expression patterns of BhABC genes in xylem, roots, leaves, and apical buds after GA3 treatment. Heat map showing responses of BhABC genes to GA3 (right); semi-quantitative RT-PCR analysis with 18s RNA internal reference (left).
Forests 10 00722 g005
Forests 10 00722 g006 550
Figure 6. Expression patterns of BhABC genes in xylem, roots, leaves, and apical buds after SA treatment. Heat map showing responses of BhABC genes to SA (right); semi-quantitative RT-PCR analysis with 18s RNA internal reference (left).
Figure 6. Expression patterns of BhABC genes in xylem, roots, leaves, and apical buds after SA treatment. Heat map showing responses of BhABC genes to SA (right); semi-quantitative RT-PCR analysis with 18s RNA internal reference (left).
Forests 10 00722 g006
Forests 10 00722 g007 550
Figure 7. Expression patterns of BhABC genes in xylem, roots, leaves, and apical buds after JA treatment. Heat map showing responses of BhABC genes to JA (right); semi-quantitative RT-PCR analysis with 18s RNA internal reference (left).
Figure 7. Expression patterns of BhABC genes in xylem, roots, leaves, and apical buds after JA treatment. Heat map showing responses of BhABC genes to JA (right); semi-quantitative RT-PCR analysis with 18s RNA internal reference (left).
Forests 10 00722 g007
Forests 10 00722 g008 550
Figure 8. Expression patterns of BhABC genes in xylem, roots, leaves, and apical buds after IAA treatment. Heat map showing responses of BhABC genes to IAA (right); semi-quantitative RT-PCR analysis with 18s RNA internal reference (left).
Figure 8. Expression patterns of BhABC genes in xylem, roots, leaves, and apical buds after IAA treatment. Heat map showing responses of BhABC genes to IAA (right); semi-quantitative RT-PCR analysis with 18s RNA internal reference (left).
Forests 10 00722 g008
Forests 10 00722 g009 550
Figure 9. Expression patterns of BhABC genes in xylem, roots, leaves, and apical buds after ABA treatment. Heat map showing responses of BhABC genes to ABA (right); semi-quantitative RT-PCR analysis with 18s RNA internal reference (left).
Figure 9. Expression patterns of BhABC genes in xylem, roots, leaves, and apical buds after ABA treatment. Heat map showing responses of BhABC genes to ABA (right); semi-quantitative RT-PCR analysis with 18s RNA internal reference (left).
Forests 10 00722 g009
Forests 10 00722 g010 550
Figure 10. Expression patterns of BhABC genes in xylem, roots, leaves, and apical buds after NaCl treatment. Heat map showing responses of BhABC genes to NaCl (right); semi-quantitative RT-PCR analysis with 18s RNA internal reference (left).
Figure 10. Expression patterns of BhABC genes in xylem, roots, leaves, and apical buds after NaCl treatment. Heat map showing responses of BhABC genes to NaCl (right); semi-quantitative RT-PCR analysis with 18s RNA internal reference (left).
Forests 10 00722 g010
Forests 10 00722 g011 550
Figure 11. Expression patterns of BhABC genes in xylem, roots, leaves, and apical buds after CdCl2 treatment. Heat map showing responses of BhABC genes to CdCl2 (right); semi-quantitative RT-PCR analysis with 18s RNA internal reference (left).
Figure 11. Expression patterns of BhABC genes in xylem, roots, leaves, and apical buds after CdCl2 treatment. Heat map showing responses of BhABC genes to CdCl2 (right); semi-quantitative RT-PCR analysis with 18s RNA internal reference (left).
Forests 10 00722 g011
Forests 10 00722 g012 550
Figure 12. Expression patterns of BhABC genes in xylem, roots, leaves, and apical buds after NaHCO3 treatment. Heat map showing responses of BhABC genes to NaHCO3 stress (right); semi-quantitative RT-PCR analysis with 18s RNA internal reference (left).
Figure 12. Expression patterns of BhABC genes in xylem, roots, leaves, and apical buds after NaHCO3 treatment. Heat map showing responses of BhABC genes to NaHCO3 stress (right); semi-quantitative RT-PCR analysis with 18s RNA internal reference (left).
Forests 10 00722 g012
Forests 10 00722 g013 550
Figure 13. Expression patterns of BhABC genes in xylem, roots, leaves, and apical buds after PEG treatment. Heat map showing responses of BhABC genes to PEG (right); semi-quantitative RT-PCR analysis with 18s RNA internal reference (left).
Figure 13. Expression patterns of BhABC genes in xylem, roots, leaves, and apical buds after PEG treatment. Heat map showing responses of BhABC genes to PEG (right); semi-quantitative RT-PCR analysis with 18s RNA internal reference (left).
Forests 10 00722 g013
Table
Table 1. Primer sequences of BhABC1–BhABC15 genes and internal reference gene 18s RNA.
Table 1. Primer sequences of BhABC1–BhABC15 genes and internal reference gene 18s RNA.
GeneUpstream Primer Sequence (5′→3′)Downstream Primer Sequence (5′→3′)Length of Product
BhABC1CTTACCGGTACATACCTGTAGGGTATCATGGTGCATTGTTGTCC295 bp
BhABC2GGTGGTGGACGTAGAAGATCCGGAAGCTGGAAGAGCATGCC297 bp
BhABC3TCTCATTCGCTTACGTGTCCGACCTTACTGAGCAGCTTCC289 bp
BhABC4CCTCTACCTCCAGGATTAATGCGCATCACTACCTGATGGTCTGG282 bp
BhABC5GGATGTTAGCTATCGACCTCCTGCCACAAAGAACCTCTCAGG274bp
BhABC6GAATGGATGAGCAGCAAGTTCCAACCATCCACAATGAGCTCACG279 bp
BhABC7AAAGGCAATGCAGAAGCAGGCTGGTGTCATTTTGGCTACTGC251 bp
BhABC8CGAACAAAGAAGCTTCGAAGCCCACATCTCTTCCTCCTACC273 bp
BhABC9GGATGTTGGAAGTGACTACAGCGAACTCTATCACGAGCTGTCC272 bp
BhABC10CATAAGCAGTTCCAACACCTGGCGGTCCTTGAGCTTTAACAGG276 bp
BhABC11GCATGTTGGATGGTCACTGGTAGCATGACGAGAGCAAGAAGC261 bp
BhABC12TCGGTATGGAGGAACAATGCGCAATTCCAACTCTGTCGAGG290 bp
BhABC13GAGAACCGTGCATCATTCTGGTTCTTCTTCTCGTCTTGTCTGC254 bp
BhABC14GAATCTCGATTGGAATGGTGCGGTCAACCTTGTGGTCTTCG260 bp
BhABC15GGCTGCTTTAGAGAGACTGCGTAGGCAATGCTCTGCTTCC285 bp
18s rRNAATCTTGGGTTGGGCAGATCGCATTACTCCGATCCCGAAGG265 bp
Table
Table 2. Analysis of physical and chemical properties of BhABC genes in Betula halophila.
Table 2. Analysis of physical and chemical properties of BhABC genes in Betula halophila.
NameLength of ORF (bp)Number of Amino AcidsIsoelectric PointSubcellular Localization 1Signal PeptideNumber of Transmembrane Helix
BhABC1426614218.54PMNO13
BhABC27862615.41PMNO0
BhABC322657549.34PMNO4
BhABC47892626.44CMNO0
BhABC58372789.59MNO0
BhABC621487155.55CMNO0
BhABC7374212059.12PMNO4
BhABC89002995.81CMNO0
BhABC9352811756.97PMNO11
BhABC10428114266.65PMNO13
BhABC11356411878.27PMNO10
BhABC12429614318.57PMNO13
BhABC1311763919.68NNO0
BhABC14323110769.17PMYES6
BhABC15344711485.47PMNO7
1 Mitochondrial membrane (M); chloroplast membrane (CM); plasma membrane (PM); nuclear (N).

Share and Cite

MDPI and ACS Style

An, L.; Ma, Q.; Du, J.; Yu, M.; Li, F.; Luan, J.; Jiang, J.; Li, H. Preliminary Classification of the ABC Transporter Family in Betula halophila and Expression Patterns in Response to Exogenous Phytohormones and Abiotic Stresses. Forests 2019, 10, 722. https://0-doi-org.brum.beds.ac.uk/10.3390/f10090722

AMA Style

An L, Ma Q, Du J, Yu M, Li F, Luan J, Jiang J, Li H. Preliminary Classification of the ABC Transporter Family in Betula halophila and Expression Patterns in Response to Exogenous Phytohormones and Abiotic Stresses. Forests. 2019; 10(9):722. https://0-doi-org.brum.beds.ac.uk/10.3390/f10090722

Chicago/Turabian Style

An, Linjun, Qing Ma, Jinxia Du, Miao Yu, Fangrui Li, Jiayu Luan, Jing Jiang, and Huiyu Li. 2019. "Preliminary Classification of the ABC Transporter Family in Betula halophila and Expression Patterns in Response to Exogenous Phytohormones and Abiotic Stresses" Forests 10, no. 9: 722. https://0-doi-org.brum.beds.ac.uk/10.3390/f10090722

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop