Next Article in Journal
Evaluating the Phytochemical Composition and Antioxidant Activity of Leaves of Different Rose Varieties
Previous Article in Journal
Tobacco Leaf-Surface Extracts: Antimicrobial Potential against Phytopathogenic Fungi and In Vitro Culture Bacterial Contaminants
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJPB
Volume 14
Issue 4
10.3390/ijpb14040075
ijpb-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Plant-Specific Insert (PSI)-Mediated Vacuolar Sorting Is Not Disrupted in Arabidopsis Mutant with Abnormal ER Morphology

by
Tatiana Cardoso
1,2,
Miguel Sampaio
1,2,
João Neves
1,
Sofia Oliveira
1,
Inês Moura
1,
Ana Séneca
1,2,
José Pissarra
1,2,
Susana Pereira
1,2 and
Cláudia Pereira
1,2,*
1
Departamento de Biologia, Faculdade de Ciências, Universidade do Porto, Rua do Campo Alegre, s/n, 4169-007 Porto, Portugal
2
GreenUPorto-Sustainable Agrifood Production Research Centre and Inov4Agro—Institute for Innovation, Training and Sustainability of Agrifood Production, Rua do Campo Alegre, s/n, 4169-007 Porto, Portugal
*
Author to whom correspondence should be addressed.
Int. J. Plant Biol. 2023, 14(4), 1034-1050; https://0-doi-org.brum.beds.ac.uk/10.3390/ijpb14040075
Submission received: 27 October 2023 / Revised: 10 November 2023 / Accepted: 12 November 2023 / Published: 16 November 2023
(This article belongs to the Section Plant Biochemistry and Genetics)
Browse Figures
Versions Notes

Abstract

:
The endomembrane system in plant cells enables the cell to manage and coordinate a variety of membranous compartments so that they and their contents arrive at the right location. The secretory pathway is an essential part of this complex network and has its gateway at the Endoplasmic Reticulum. Therefore, alterations at the ER can affect how protein trafficking takes place and how cargo leaves this organelle. With this work, we assessed how abnormalities at the Endoplasmic Reticulum would interfere with protein sorting and trafficking. We used an Arabidopsis mutant—leb-2 GFP-h, presenting abnormal ER morphology, and evaluated the expression of aspartic proteinases and genes related to vacuolar transport along with the localization of a specific vacuolar sorting signal—plant-specific insert (PSI). Our results show that alterations in the leb-2 GFP-h mutant did not disrupt the transport of PSI–mCherry to the vacuole but influenced the expression of endogenous aspartic proteinases. Furthermore, the study of key endomembrane genes expression revealed an upregulation of the SNARE proteins AtVAMP722 and AtVAMP723. The leb-2 mutant seems not to interfere with vacuolar routes but may be implicated in secretion events.

1. Introduction

The eukaryotic cells’ endomembrane trafficking system is critical for essential cellular processes, such as maintaining cellular homeostasis and proliferation, alongside multicellular organism-specific requirements (for instance, physiological processes, responses to environmental stimuli, defense mechanisms, etc.) [1,2]. In plant cells, this network of membrane compartments that transports cargo molecules is particularly intricate and well-coordinated [3], occurring along numerous partitioned organelles: the Endoplasmic Reticulum (ER), the Golgi, the Trans-Golgi Network (TGN), the Pre-Vacuolar Compartment (PVC), the vacuole, secretory vesicles, and endosomes [4,5,6]. In plants, the secretory pathway begins at the ER. This flexible and multifunctional organelle contacts with several other key structures in the cell, including the Plasma Membrane (PM), the Golgi, endosomes, lysosomes, mitochondria, and peroxisomes, in a three-dimensional network of continuous tubules and cisterns. Thereby, this organelle communicates with numerous membrane compartments along both the secretory and endocytic pathways [7,8,9]. In contrast to what is observed in mammalian cells and yeasts, plants’ ER maintains its broad distribution and movement throughout the cell but is constrained to a little area in the cytoplasm between the PM and the tonoplast of the vacuole [10,11]. Some organisms may even generate distinctive ER-derived structures, such as the ER bodies, which are spindle-shaped storage spaces for the build-up of glucosidase (PYK10) and are possibly implicated in plant defense mechanisms that are present in Brassicaceae plants and some related species [12,13]. Also, ER bodies may function as intermediates in vacuolar trafficking routes in response to ER stress [14], underscoring the adaptability of this organelle in plant cells.
Conventionally, proteins trafficking through the secretory pathway are led from the ER to the Golgi apparatus and then reach their final location, which may be the vacuole, other compartments, or the PM [15,16]. Since plant cells have two distinct types of vacuoles (protein storage vacuoles (PSVs) and lytic vacuoles (LVs)) and both may be found within the same cell [17,18], it is crucial to comprehend the mechanisms and regulation governing trafficking to the vacuole, as these compartments are essential for maintaining the homeostasis of plant cells. Our team has been especially interested in cardosin A and cardosin B, which are two well-characterized aspartic proteinases (APs) found in Cynara cardunculus [19,20]. Although highly similar in protein sequence, these enzymes are stored in different cell compartments as plants develop [20,21]. It has been evidenced that cardosin A differentiates its accumulation in PSVs or LVs, according to the developmental stage and particular cellular requirements [21,22], whereas cardosin B is found extracellularly [20]. This is most probably related to their different roles in cardoon flowers and can be related to the activity of the enzymes—cardosin A has higher activity, while cardosin B, despite being less active, has a broader specificity [21]. Yet, when expressed in Arabidopsis thaliana or Nicotiana tabacum, both cardosins A and B demonstrated the same localization patterns, being found in LVs [23]. Such features make cardosins puzzling and intriguing study objects, offering solid evidence for their usefulness as reporters in studying vacuolar trafficking and vacuolar-sorting determinants (VSDs) in plants.
Plant-specific inserts (PSIs) are unique protein domains of about 100 amino acids [24,25] found in both cardosin A and B. Since this domain exhibits multiple functions, when isolated and in vitro, including acting as a detergent, mediating lipid membrane interactions, exhibiting putative antimicrobial activity, and inducing membrane permeabilization, along with membrane modulation, it is frequently referred to as “an enzyme within an enzyme” [26,27,28,29,30]. Even if its roles in cells remain to be fully established, the PSI has been linked to APs’ vacuolar targeting [26,30]. Understanding how the PSI fits into the intricate web of vacuolar protein trafficking is essential given the discovery of novel unconventional routes for vacuolar sorting in which proteins are directly sorted to the LV from the ER [23,31,32,33,34]. Although the APs can be directed to the vacuole by both cardosin A PSI (PSI A) and cardosin B PSI (PSI B), the ways in which they do so differ greatly. In contrast to PSI A-mediated sorting, which is COPII-independent, PSI B-mediated sorting involves transport from the ER to the Golgi in a COPII-dependent manner [35]. Little is known about the processes governing this sorting, even though PSIs are regarded as vacuolar-sorting determinants given their capacity to mediate trafficking to the vacuole.
To better understand the processes involved in PSI-mediated sorting, and since the ER appears to be a key checkpoint in these routes, we posed the question of whether abnormalities in the ER morphology affect protein sorting. Thus, we used the Nottingham Arabidopsis Stock Center (NASC) database to search for ER-associated phenotypes and found a few Arabidopsis thaliana lines with gene mutations causing changes in ER morphology. From those, the leb-2 GFP-h mutant was selected for this study—a codon mutation in the leb-2 (CCT to TCT) results in a P41S mutation in the PYK10/BGLU23 protein, which elongates ER bodies, thus affecting the route to the PSV. In addition, these plants also carry the GFP-h gene, encoding a fusion between an ER retention signal (HDEL) and the Green Fluorescent Protein (GFP), enabling the visualization of the entire ER network. This Arabidopsis line has not been characterized yet, despite being accepted that it would behave like its homologous leb-1 [36]. For this reason, a brief developmental assay and an ultrastructural characterization were completed before the evaluation of the expression of the PSIs and genes involved in vacuolar sorting and other relevant steps of the endomembrane trafficking system to fully understand the repercussions of the mutation in these plants. In the end, we hope to offer further insight into the interactions between the various endomembrane system organelles and how unconventional PSI-mediated trafficking and sorting take place within plant cells coupled with a thorough analysis of the leb-2 GFP-h mutant.

2. Materials and Methods

2.1. Biological Material

From the Nottingham Arabidopsis Stock Center (NASC), one Arabidopsis thaliana line bearing defects in ER morphology was selected: N69081 (leb-2 GFP-h). This line also has a GFP-HDEL (GFP-h) marker that allows ER visualization. A GFP-HDEL control line (Arabidopsis col0) produced in our lab (unpublished) was also used for ER patterns comparison. Seeds from the mutant line, as well as a wild-type (WT; col0) and GFP-HDEL, were sown and germinated in plates containing 2.2 g/L of Mourashige and Skoog medium (MS, Duchefa, The Netherlands), with 1.5% (w/v) sucrose, 0.7% (w/v) Bacto-agar and pH 5.7. Plants were kept for 48 h at 4 °C and, following stratification, were maintained in a growth chamber at 22 °C with 60% humidity and 16 h light over 8 h dark photoperiod (OSRAM L 36 W/77 e OSRAM L 36 W/840) at the intensity of 110 µmol·m−2·s. After 12–15 days, seedlings were transferred to individual pots with a fertilized substrate (SIRO PLANT, Portugal) and transferred to a growth chamber at 22 °C with 50–60% relative humidity and light intensity at 180 µmol·m−2·s. The identification of leb-2 GFP-h homozygous plants was performed by PCR using the following primers: 5′ end gene-specific primer, 5′-TGTCAAGAGGTGCTCACAGAGGAAC, 3′ end gene-specific primer, 5′-CCAGCAAATGCAGATGGACCTGTAT. The PCR reactions were followed by a purification step using illustra™ GFX™ PCR DNA and a Gel Band Purification Kit (Cytiva, United States) and sent for sequencing. Genomic DNA was amplified by PCR using the conditions described in the manufacturer’s instructions (NZYTech, Portugal).

2.2. Transmission Electron Microscopy (TEM)

Small pieces of approximately 1–2 mm from cotyledonary leaves obtained from 12–15-day-old seedlings of the leb-2 GFP-h mutant and wild type were fixed in Na-PIPES (1.25% (w/v) and pH 7.2) with glutaraldehyde 2.5% (v/v) for 1 h at room temperature (RT). The samples were then washed with Na-PIPES 1.25% (w/v) (3 times for 10 min each) and post-fixated with OsO4 4% (w/v), prepared in Na-PIPES 2.5% (w/v) pH 7.2, in a proportion of 1:1, for 1 h at RT. Samples were washed 3 times with Na-PIPES 1.25% (p/v) pH 7.2 for 10 min each. The dehydration steps proceeded in an ethanol-graded series at RT as follows: 10% (v/v) for 10 min; 20% (v/v), 30% (v/v) and 50% (v/v) for 15 min; and 70% (v/v) and 100% (v/v) for 20 min. The ethanol was then exchanged with propylene oxide for 20 min. The samples were gradually embedded in increasing concentrations of Epoxi resin (Agar scientific, UK): 10% (for 15 min), drop by drop until 50% (overnight) and 100% (overnight). The samples were then transferred to oriented molds, covered with resin, and polymerized at 60 °C overnight. Ultrathin sections (60–80 nm) were obtained in a UC6 Ultramicrotome (Leica) using a diamond knife (Diatome) and placed in 400 mesh copper grids. Post-staining was performed with Uranyless EM Strain (Uranyless) and Reynolds Lead citrate 3% (Uranyless) for 5 min each. After washing 5 times in distilled water to remove excess stain, grids were air-dried and observed in a Jeol JEM 1400 Transmission Electron Microscope, and the images were acquired with an Orius DC200D camera (Gatan). Image analysis and processing were completed using ImageJ®/Fiji software version 1.52 i.

2.3. Transient Transformation of Arabidopsis thaliana Seedlings through Vacuum Infiltration

A. thaliana seedlings were transiently transformed using an adaptation of the protocol established by Bernat-Silvestre et al. [37]. Seeds from the leb-2 GFP-h mutant and wild type were sown and germinated in six-well plates and grown for 5 days in the conditions already described. Agrobacterium tumefaciens containing the SP-PSI A–mCherry and SP-PSI B-mCherry constructs [23,35] were inoculated in LB medium supplemented with kanamycin (50 µg/mL) and gentamicin (50 µg/mL) and incubated for 24 h under agitation, at 28 °C, until an OD600 of approximately 2.2 was reached. Cultures were centrifuged for 15 min at 6000× g, and the pellets were resuspended in infiltration buffer (liquid MS medium with 0.005% (v/v) Tween-20 and 200 µM acetosyringone). This suspension was kept at room temperature for 30 min and then poured onto the six-well plates with the Arabidopsis seedlings (4 mL per well), and a vacuum was applied at 300 mbar for 1 min. The pressure was then slowly increased to 400 mbar, and the process was repeated. Finally, the bacterial suspension was fully removed, and the plates were covered with aluminum foil for 1 h to improve agro-infection. After removing the aluminum foil, the plates were kept for 3 days under the previously mentioned growth conditions.

2.4. Transformation of Arabidopsis thaliana for Stable Expression

To generate transgenic PSI B plants, the transformation was performed by the floral dip method [38]. The SP-PSI B-mCherry construct, which was previously available in the lab, was used for this purpose [23]. A small aliquot of Agrobacterium tumefaciens containing the clone was inoculated into 5 mL of LB (Luria–Bertani) medium supplemented with the appropriate antibiotics (kanamycin 50 µg/mL and gentamicin 20 µg/mL) and allowed to grow overnight (ON) at 28 °C shaking. Then, the entire volume of the starter culture was inoculated in 250 mL of LB media supplemented with kanamycin and gentamicin at concentrations already described and stirred once more at 28 °C ON. The total volume was split into 50 mL Falcon tubes and centrifuged for 20 min at 5000× g. The supernatant was discarded, and the pellet was resuspended in a 5% (w/v) sucrose and 0.05% (v/v) Silwet solution. A. thaliana wild-type plants with a developed floral stem and flowers were used from which the previously produced siliques were removed. Then, the plants’ aerial portion was immersed in the Agrobacterium solution and gently shaken for 1 min. This process was repeated three times with four different plants. Finally, the plants were returned to the greenhouse, and a plastic bag was wrapped around them to allow for moisture. The plants were left in these conditions overnight before the bag was removed the next day. The flower stems were collected, dried, and the seeds they produced were collected when the plants showed well-developed siliques. The seeds from each initially transformed plant were stored separately and treated as different primary transformants. To select the transgenic plants, the antibiotic Hygromycin B (500 mg/mL; Duchefa Biochemie) was added to the growth medium, and the presence of the transgene was verified by PCR and Western blot. Further research was conducted using the homozygous T3 transgenic lines.

2.5. Drug Treatment Assays

Brefeldin A (BFA) solution (50 µg/mL) was prepared in MS liquid medium, and 4 mL was poured in each well of the 6-well plates, over the infiltrated seedlings, one day after the A. tumefaciens infiltration. Vacuum was applied as described before, and seedlings were kept in the BFA solution until the cells were imaged (16–18 h).

2.6. CLSM Analysis

Arabidopsis seedlings were observed and analyzed using a confocal laser scanning microscope (CLSM, Leica STELLARIS 8). Cotyledons from Arabidopsis seedlings were prepared by placing the lower epidermis facing up on a slide with a drop of water covered by a cover slip. For mCherry, emissions were detected between 580 and 630 nm, using 561 nm excitation. In the case of GFP, the emissions were detected between 500 and 528 nm, using an excitation wavelength of 488 nm. Image analysis and quantification were performed using the ImageJ®/Fiji software version 1.52 i.

2.7. cDNA Preparation

Total RNA was prepared using the “NZY Total RNA Isolation Kit” (NZYTech, Lisboa, Portugal), following the manufacturers’ guidelines. Three biological replicates were prepared, and the total RNA was quantified using a DS-11 microvolume Spectrophotometer (DeNovix, Wilmington, NC, USA). The RNAs were stored at −80 °C. To obtain the cDNA from the isolated RNA, an NZY First-Strand cDNA Synthesis kit (NZYTech, Lisboa, Portugal) was used following the provided instructions. The cDNA solution was stored at −20 °C.

2.8. Gene Selection

The genes selected for quantitative RT-PCR in this study were chosen based on their product localization, role, interaction partners, and literature references (Table 1).

2.9. Quantitative RT-PCR

All the primers used in this work were already available in the laboratory with all of their reactions optimized [49,50]. The plate design was created using the software Bio-Rad CFX Maestro 1.0 (BioRad, Hercules, CA, USA). The qPCR reaction had a final volume of 10 µL, where 2 µL was cDNA and 8 µL was a master mix composed by NZYSupreme qPCR Green Master Mix (2x) (NZYTech, Lisboa, Portugal), 400 nM of each primer (forward and reverse—Table 2) and water. The protocol used the following amplification conditions: initial denaturation (95 °C for 3 min); 40 cycles of amplification and quantification (95 °C for 10 s, 56 °C for 10 s and 72 °C for 30 s, with a single fluorescent measurement) and melting curve generation (65 °C to 95 °C, with one fluorescence read every 0.5 °C). The reaction was performed in a CFX96 Real-Time System (BioRad, Hercules, CA, USA) and analyzed using Bio-Rad CFX Maestro (version 1.0) software. The cycle threshold (Ct) and expression tests were calculated by comparing the mutant results with the wild type.

3. Results

3.1. Developmental Assays of leb-2 GFP-h

The leb-2 GFP-h Arabidopsis mutant (Figure 1A) is not characterized, yet a similar phenotype with leb-1 mutant is assumed [36]. Given this and to understand if ER abnormalities could interfere with the overall plant development, before starting the expression assays, it was decided to perform a developmental assay to compare several stages of the chronological progression of the plants’ growth; the developmental stages of the mutant were compared with those of the wild-type plants. Developmental differences between this line and the WT line are obvious, particularly concerning the size of plants, with leb-2 GFP-h presenting a much smaller size (Figure 1B). As may be observed in Figure 1C, until the appearance of the three rosette leaves, both lines reached the selected developmental stages at a similar rate. However, after the next stage evaluated (four rosette leaves), the leb-2 GFP-h mutated line presented a delay in development relative to the WT line, presenting the first siliques well beyond the 140 days after the seeds were sown.

3.2. Microscopic Characterization of the ER-Defective Plants

To further characterize the endomembrane system of the Arabidopsis mutant, the ultrastructure of cells from cotyledonary leaves was observed through TEM (Figure 2A), allowing a deeper understanding of the effects of this mutation. Our observations were especially focused on the ER, its associated vesicles, and the Golgi, as these are the most important features in terms of protein sorting, for the detection of subtle phenotypes in these organelles. The control was the wild-type line, depicting the normal organization of the cell. It exhibited organized chloroplasts, some cytoplasmic vesicles, and typical ER tubules (Figure 2B(a,b)).
In general, a typical chloroplast shape and thylakoid development were seen along with the correct organization of the thylakoid ultrastructure in grana stacks and stroma lamellae. Moreover, ribosomes and/or polyribosomes were abundant in the cell’s cytoplasm (Figure 2B(a,b)). In the leb-2 GFP-h mutant line, chloroplasts contained enormous, well-defined starch granules (Figure 2B(c–e)) and some detachment of the cytoplasmic membrane (Figure 2B(c), yellow arrows). Thylakoid membranes appeared loosely packed into grana, and chloroplasts were shown to have more plastoglobuli (Figure 2B(d)). Golgi cisternae showed a normal distribution (Figure 2B(d), pink arrow) despite enlarged and rounded cisternae of the Golgi being observed in some cells (Figure 2B(e), red arrow) alongside numerous vesicles found in the cytoplasm close to the ER and Golgi stacks. Additionally, in some cases, the ER presented abnormal morphology, as it appeared to be enlarged in the extremities (Figure 2B(f)).
Resorting to the expression of the GFP-HDEL present in the leb-2 mutant and an Arabidopsis line harboring GFP-HDEL, it was also possible to image the ER network using confocal laser scanning microscopy (Figure 3A). In the GFP-HDEL control line (Figure 3B), the ER network is clearly visible along with its tubules and cisternae. In the mutant line (Figure 3C), along with the ER network, some spindle-shaped structures—ER bodies—are also detected in the cell cytoplasm (Figure 3C, white arrows). These structures, after applying BFA, are no longer visible, and fluorescence aggregates, probably BFA bodies, are visible in the cytoplasm (Figure 3C +BFA, blue arrows).

3.3. SP-PSI A/B–mCherry Transient Expression in the Mutated Plants

Cardosins’ PSIs—PSI A and PSI B—are vacuolar-sorting domains, mediating different routes. PSI B mediates a conventional ER–Golgi route, while cardosin A PSI has the ability to follow a Golgi-independent route to the vacuole. However, the nature and the intervenients in such a route are not known. To assess whether ER bodies may participate in the process, we expressed PSI A and PSI B in the leb-2 GFP-h mutant background to assess its localization. As before, several images, from different experiments, were captured and analyzed, and the most representative are displayed (Figure 4). It is evident from the images shown in Figure 3 that both PSIs are mainly found in the vacuole both in the WT line and in the leb-2 GFP-h line (Figure 4B–D). In the mutant, we may also observe that no co-localization of PSI A/B-mCherry and GFP-HDEL markers was detected (Figure 4C,D), indicating that at the time of imaging, all the protein was already in the vacuole.

3.4. Endogenous Arabidopsis Aspartic Proteinases’ Analysis

Given our special interest in PSI A localization and trafficking routes and the alterations of ER morphology, an analysis of the endogenous Arabidopsis aspartic proteinases genes was performed with special focus on the PSI-coding ones—A1, A2 and A3. Importantly, all PSI-containing APs from Arabidopsis have a glycosylated PSI, contrary to PSI A, which is not glycosylated (Figure 5A, red box). Next, the relative expression of the three APs genes was evaluated in WT plants by qPCR. It is possible to observe that AP1 and AP2 are more expressed in WT when compared to the AP3, whose expression is significantly decreased (Figure 5B). However, looking at the expression of the same genes in the leb-2 GFP-h line, the AP3 was found to be upregulated when compared to WT plants, presenting itself with a three-fold expression increase (Figure 5C).

3.5. Endomembrane Genes Expression Testing

Given the alterations observed in the expression of Arabidopsis AP3 in the mutant background and given our interest in unravelling the intermediates in PSI A-mediated sorting, the expression of some key endomembrane trafficking genes was evaluated in the mutant background (Figure 6A). Regarding the genes involved in protein trafficking to LV (AtSYP52) and PSV (AtSYP51), no significant alterations were registered in our analysis. AtSYP22, a gene coding for a SNARE involved in the vacuolar assembly, also did not alter its expression. Its homologous AtSYP23, whose protein does not have a transmembrane domain and function is still unclear, was also analyzed without significant alterations (Figure 6B). Some genes coding for SNAREs involved in vesicle docking and fusion were also tested. AtSYP61 did not undergo any alterations in its expression, but AtVAMP722 demonstrated an upregulation in leb-2 GFP-h when compared to WT. AtVAMP723, an ER-related homologue of the AtVAMP722, is the gene that demonstrates a higher significant overexpression. However, AtVAMP721, a plasma membrane-related SNARE gene, did not alter its expression in the leb-2 GFP-h line (Figure 6B).

4. Discussion

The ER, a highly adaptable network of continuous tubules and cisterns contacting with several organelles in the cell and coordinating with membrane compartments along the secretory and endocytic pathways, serves as the starting point of the secretory routes, which are a major pathway of the endomembrane system [7,8,9]. PSIs from Cardosin A and B are vacuolar-sorting domains known for mediating the trafficking to the vacuole through different pathways: PSI A mediates an unconventional Golgi bypass, while PSI B mediates a conventional ER–Golgi route [35]. The direct ER-to-vacuole route has not been well characterized despite more proteins having been described to follow this route. The information available is fragmented, and not all events of direct ER-to-vacuole transport seem to depend on the same mechanisms. Here, we aim at exploring the role of ER bodies in PSIs ER export.

4.1. The leb-2 GFP-h Arabidopsis mutant

The leb-2 GFP-h mutant Arabidopsis line was described as similar to the leb-1 mutant [40]. The PYK10/BGLU23 gene’s first exon contains a single nucleotide mutation (CCT→TCT), resulting in an amino acid substitution (P41S) on the PYK10/BGLU23 protein in this mutant line, and it has been observed to accumulate in ER structures named ER bodies [36,51]. The mutated line, compared to WT, exhibited a clear delayed development at the appearance of the three rosette leaves, and this delay was maintained from this point forward. To further understand and characterize the effects of the mutation in this Arabidopsis line, the ultrastructure of the cells from cotyledonary leaves was assessed through TEM. No major alterations were observed when comparing to WT except for large starch grains and oil bodies in the chloroplasts, which can be related to stress conditions. Additionally, in some cells, enlarged Golgi cisternae and rounded Golgi bodies are visible along with numerous vesicles in the cytoplasm, which can be an indication of cells under high metabolic activity. The ER morphology in the leb-2 GFP-h line observed by confocal microscopy revealed that this mutant possesses elongated structures at the ER, resembling the long ER bodies observed by Nagano et al. (2009) [36]. We also exposed the mutant plants to BFA, and the ER morphology of the leb-2 GFP-h line is affected by this drug, as the ER bodies appeared more rounded, probably BFA bodies, so trafficking processes were affected as well.

4.2. PSIs-Mediated Sorting and Unconventional Routes

For the past few years, several studies have been focused on cardosins along with their PSI domains given their potential as model proteins for unveiling unconventional vacuolar-sorting routes [23,35]. In fact, PSI A and PSI B are capable of directing proteins to the vacuole without matching any of the classic VSD types [23]. PSI A was demonstrated to mediate a COPII-independent route in order to traffic between the ER and the Golgi, as it was shown that it still accumulates in the vacuole when co-expressed with the dominant negative mutant SarIH74L in Nicotiana tabacum leaves [35]. In the native organism (Cynara cardunculus-cardoon), cardosin A is mostly found in the PSVs of the stigmatic papillae [21]. However, when expressed in Arabidopsis thaliana or Nicotiana tabacum, cardosin A can be found in different types of vacuoles (PSV and LV) [23]. On the other hand, PSI B is secreted in cardoon flowers [35] and accumulates in vacuoles in heterologous systems [35]. Such characteristics highlight the advantageous use of these domains as reporters for the study of vacuolar trafficking and VSDs in plants.
In a process exclusive to plants, the ER bodies have been implicated as intermediate compartments in the transport of proteins destined to the PSV directly from the ER, bypassing the Golgi [13]. Therefore, given what we know about the PSI A-mediated trafficking, it would be interesting to assess if these subcellular structures would participate in PSI A and/or PSI B-mediated trafficking. Our results revealed a vacuolar localization of the PSI A and B both in the Arabidopsis WT and mutant, which is consistent with what had been previously described [23]. This strengthens the view of the cardoon PSIs as vacuolar-sorting domains, as both were efficient in targeting the mCherry tag to the vacuole and, therefore, seem to be not affected by the ER morphological defects. Moreover, in the leb-2 GFP-h line, no co-localization was observed with ER bodies nor interference with PSI A vacuolar sorting, indicating that probably this pathway is not used by the PSI A (Figure 7). On the contrary, preliminary results on PSI B overexpression in transgenic Arabidopsis cotyledons showed it to be accumulated in structures resembling ER bodies (Supplemental Figure S1B), which were not observed for PSI A (Supplemental Figure S1A). Being confirmed, these preliminary results open up new perspectives regarding the differences observed between the sorting processes mediated by the two PSIs that partially rely on the glycosylation, which are present in PSI B but absent in PSI A [35].
Interestingly, from the 51 genes identified for APs in the Arabidopsis genome, only three contain the PSI domain [52], and an alignment of the PSI domains from those APs with PSI A and B revealed that all contain the glycosylation site present in PSI B (Figure 5A, red box). Moreover, a search in the literature available shows that most of the identified PSIs have the glycosylation site, and that this glycosylation site seems to be involved in the ER-to Golgi transport, elevating the PSI A unconventional characteristic to a more interesting level. Future studies should focus on such glycosylation sites, and their presence or absence could interfere with protein trafficking and explain our observations.
Furthermore, the expression analysis of the three Arabidopsis APs also retrieved important information on the role of these proteinases. Chen and co-workers (2002) used specific probes to analyze the expression of the three different genes and showed that AP A1 is detected in all tissues but is more abundant in leaves, while A3 is mainly expressed in flowers and A2 is mainly expressed in seeds [53]. Our results are in accordance with these observations, as AP3 expressions levels are significantly lower when compared to AP1 and AP2, which is not surprising, since our study was conducted in Arabidopsis cotyledons and AP3 expression is mainly detected in flowers [53]. Remarkably, when comparing the AP3 expression in the leb-2 GFP-h line with the wild-type plants, we could verify a ~4-fold increase in the expression levels. Although intriguing, as AP3 is mainly expressed in flowers, this could indicate a putative connection between APs and the ER bodies’ dependent route and could be perceived as a more efficient manner of APs delivery to their destination. As APs are more abundant in flowers, and proteins tend to cluster in the ER before exiting this organelle, ER bodies could be used as faster vehicle for APs to reach the vacuole or to be secreted. Although little is known regarding the localization and function of AP3 in flowers, it has been described as a secreted protein in flower tissues. The parallel can be made with Cardosin B, which is a well-characterized AP from cardoon plants that was found to localize at the extracellular matrix [35]. Additionally, Nakano and his team [54] presented a thorough review of ER bodies and evidence that ER bodies can be involved in protein secretion, suggesting a role for these structures in the resistance against pathogens. It can be considered that both cardosin B and AP3 can be transported to the cell surface associated with ER bodies. Despite being a frail connection and lacking experimental evidence, it is worth exploring the trafficking of these proteins and their relationship with ER bodies in other physiological conditions and different organs.

4.3. Endomembrane System Effectors Expression Level Analysis

Given the alterations observed in the expression of Arabidopsis APs and cardosins’ PSIs, it was decided to check the expression of several key endomembrane system genes in the leb-2 GFP-h mutant, which is involved either in vacuolar sorting—AtSYP51/52 and AtSYP22, plasma membrane docking and fusion—AtSYP61, AtSYP121 and AtVAMP721/722, or involved in ER vesicle fusion—AtVAMP723 and AtSYP23. Most of the genes tested do not show any significative variance in relation to the wild-type plant genes, indicating that the mutation does not interfere with most of the trafficking events with special focus on the vacuolar trafficking. However, a significative upregulation was observed for AtVAMP722 and AtVAMP723, which is particularly evident for the last one. AtVAMP723 codes for an R-SNARE, involved in vesicle docking, fusion and budding, and its localization at the ER membranes [44] can be related to the formation and release of ER bodies, enhancing its expression in the mutant background. On the other hand, the homologue AtVAMP722 codes for a protein that shares the same roles but with a different localization, as it may be involved in the secretory trafficking to the plasma membrane [47]. Considering the results obtained for the AP3 expression in the mutant background and the hypothesis that the AP3 trafficking can be dependent on ER bodies, it is fair to assume an upregulation of a SNARE involved in trafficking to the cell membrane, as is AtVAMP722. It would be interesting to explore, in the future, the relation between AtVAMP722 and ER bodies, as to our knowledge, no studies have been made connecting the two. Moreover, it has been reported that AtVAMP722 forms a complex with AtVAMP721 and SYP121 [41,55], which do not show any changes in our study. This points to an isolated role of AtVAMP722, or in complex with other unknown proteins, in this route. In fact, it has been reported that probably VAMP722 is the most relevant member of the VAMP72 family [56]. Despite the amount of information available on the mechanisms of membrane fusion and the intermediates in the process, there is still a lot of fragmented information and novel data being released that challenges the established view of the different processes particularly when concerning the unconventional pathways.

Supplementary Materials

The following supporting information can be downloaded at https://0-www-mdpi-com.brum.beds.ac.uk/article/10.3390/ijpb14040075/s1, Figure S1: Subcellular localization of SP-PSIA/B-mCherry in cotyledon leaves of Arabidopsis transgenic plants overexpressing SP-PSIA/B-mCherry, respectively.

Author Contributions

Conceptualization and methodology, A.S., M.S., S.P., J.P. and C.P.; investigation, T.C., S.O. I.M., J.N. and M.S.; formal analysis and software, T.C., J.N., M.S., A.S. and C.P.; project administration and funding acquisition, C.P. and J.P.; writing—original draft, T.C., J.N., M.S., S.O., I.M. and C.P.; writing—review and editing, S.P, C.P. and J.P.; supervision, A.S., S.P., J.P. and C.P. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by national funds through the Portuguese Foundation for Science and Technology (FCT) within the scope of UIDB/05748/2020 and UIDP/05748/2020. Miguel Sampaio is the recipient of a PhD fellowship funded by the Portuguese Foundation for Science and Technology (FCT) (SFRH/UIDB/151042/2021).

Informed Consent Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Morita, M.T.; Shimada, T. The Plant Endomembrane System—A Complex Network Supporting Plant Development and Physiology. Plant Cell Physiol. 2014, 55, 667–671. [Google Scholar] [CrossRef] [PubMed]
  2. Cevher-Keskin, B. Endomembrane Trafficking in Plants. In Electrodialysis; IntechOpen: London, UK, 2020; pp. 1–22. [Google Scholar] [CrossRef]
  3. Stefano, G.; Hawes, C.; Brandizzi, F. ER—The Key to the Highway. Curr. Opin. Plant Biol. 2014, 22, 30–38. [Google Scholar] [CrossRef] [PubMed]
  4. Frigerio, L.; Hawes, C. The Endomembrane System: A Green Perspective. Traffic 2008, 9, 1563. [Google Scholar] [CrossRef]
  5. Wang, X.; Chung, K.P.; Lin, W.; Jiang, L. Protein Secretion in Plants: Conventional and Unconventional Pathways and New Techniques. J. Exp. Bot. 2018, 69, 21–37. [Google Scholar] [CrossRef]
  6. Wang, X.; Xu, M.; Gao, C.; Zeng, Y.; Cui, Y.; Shen, W.; Jiang, L. The Roles of Endomembrane Trafficking in Plant Abiotic Stress Responses. J. Integr. Plant Biol. 2020, 62, 55–69. [Google Scholar] [CrossRef] [PubMed]
  7. Staehelin, L.A. The Plant ER: A Dynamic Organelle Composed of a Large Number of Discrete Functional Domains. Plant J. 1997, 11, 1151–1165. [Google Scholar] [CrossRef]
  8. Stefan, C.J.; Manford, A.G.; Emr, S.D. ER-PM Connections: Sites of Information Transfer and Inter-Organelle Communication. Curr. Opin. Cell Biol. 2013, 25, 434–442. [Google Scholar] [CrossRef]
  9. Stefano, G.; Renna, L.; Lai, Y.; Slabaugh, E.; Mannino, N.; Buono, R.A.; Otegui, M.S.; Brandizzi, F. ER Network Homeostasis Is Critical for Plant Endosome Streaming and Endocytosis. Cell Discov. 2015, 1, 15033. [Google Scholar] [CrossRef]
  10. Nakano, R.T.; Matsushima, R.; Ueda, H.; Tamura, K.; Shimada, T.; Li, L.; Hayashi, Y.; Kondo, M.; Nishimura, M.; Hara-Nishimura, I. GNOM-LIKE1/ERMO1 and SEC24a/ERMO2 Are Required for Maintenance of Endoplasmic Reticulum Morphology in Arabidopsis Thaliana. Plant Cell 2009, 21, 3672–3685. [Google Scholar] [CrossRef]
  11. Quader, H.; Schnepf, E. Endoplasmic Reticulum and Cytoplasmic Streaming: Fluorescence Microscopical Observations in Adaxial Epidermis Cells of Onion Bulb Scales. Protoplasma 1986, 131, 250–252. [Google Scholar] [CrossRef]
  12. Matsushima, R.; Hayashi, Y.; Yamada, K.; Shimada, T.; Nishimura, M.; Hara-Nishimura, I. The ER Body, a Novel Endoplasmic Reticulum-Derived Structure in Arabidopsis. Plant Cell Physiol. 2003, 44, 661–666. [Google Scholar] [CrossRef] [PubMed]
  13. Hara-Nishimura, I.; Matsushima, R.; Shimada, T.; Nishimura, M. Diversity and Formation of Endoplasmic Reticulum-Derived Compartments in Plants. Are These Compartments Specific to Plant Cells? Plant Physiol. 2004, 136, 3435–3439. [Google Scholar] [CrossRef] [PubMed]
  14. Sampaio, M.; Neves, J.; Cardoso, T.; Pissarra, J.; Pereira, S.; Pereira, C. Coping with Abiotic Stress in Plants—An Endomembrane Trafficking Perspective. Plants 2022, 1, 338. [Google Scholar] [CrossRef] [PubMed]
  15. Marcos Lousa, C.; Gershlick, D.C.; Denecke, J. Mechanisms and Concepts Paving the Way towards a Complete Transport Cycle of Plant Vacuolar Sorting Receptors. Plant Cell 2012, 24, 1714–1732. [Google Scholar] [CrossRef] [PubMed]
  16. Rojo, E.; Denecke, J. What Is Moving in the Secretory Pathway of Plants? Plant Physiol. 2008, 147, 1493–1503. [Google Scholar] [CrossRef]
  17. Olbrich, A.; Hillmer, S.; Hinz, G.; Oliviusson, P.; Robinson, D.G. Newly Formed Vacuoles in Root Meristems of Barley and Pea Seedlings Have Characteristics of Both Protein Storage and Lytic Vacuoles. Plant Physiol. 2007, 145, 1383–1394. [Google Scholar] [CrossRef]
  18. Paris, N.; Stanley, C.M.; Jones, R.L.; Rogers, J.C. Plant Cells Contain Two Functionally Distinct Vacuolar Compartments. Cell 1996, 85, 563–572. [Google Scholar] [CrossRef]
  19. Ramalho-Santos, M.; Verissimo, P.; Cortes, L.; Samyn, B.; Van Beeumen, J.; Pires, E.; Faro, C. Identification and Proteolytic Processing of Procardosin A. Eur. J. Biochem. 1998, 255, 133–138. [Google Scholar] [CrossRef]
  20. Vieira, M.; Pissarra, J.; Veríssimo, P.; Castanheira, P.; Costa, Y.; Pires, E.; Faro, C. Molecular Cloning and Characterization of CDNA Encoding Cardosin B, an Aspartic Proteinase Accumulating Extracellularly in the Transmitting Tissue of Cynara cardunculus L. Plant Mol. Biol. 2001, 45, 529–539. [Google Scholar] [CrossRef]
  21. Ramalho-Santos, M.; Pissarra, J.; Veríssimo, P.; Pereira, S.; Salema, R.; Pires, E.; Faro, C.J. Cardosin A, an Abundant Aspartic Proteinase, Accumulates in Protein Storage Vacuoles in the Stigmatic Papillae of Cynara cardunculus L. Planta 1997, 203, 204–212. [Google Scholar] [CrossRef]
  22. Pereira, C.S.; da Costa, D.S.; Pereira, S.; de Moura Nogueira, F.; Albuquerque, P.M.; Teixeira, J.; Faro, C.; Pissarra, J. Cardosins in Postembryonic Development of Cardoon: Towards an Elucidation of the Biological Function of Plant Aspartic Proteinases. Protoplasma 2008, 232, 203–213. [Google Scholar] [CrossRef]
  23. Pereira, C.; Pereira, S.; Satiat-Jeunemaitre, B.; Pissarra, J. Cardosin A Contains Two Vacuolar Sorting Signals Using Different Vacuolar Routes in Tobacco Epidermal Cells. Plant J. 2013, 76, 87–100. [Google Scholar] [CrossRef] [PubMed]
  24. Simões, I.; Faro, C. Structure and Function of Plant Aspartic Proteinases. Eur. J. Biochem. 2004, 271, 2067–2075. [Google Scholar] [CrossRef] [PubMed]
  25. Soares, A.; Ribeiro Carlton, S.M.; Simões, I. Atypical and Nucellin-like Aspartic Proteases: Emerging Players in Plant Developmental Processes and Stress Responses. J. Exp. Bot. 2019, 70, 2059–2076. [Google Scholar] [CrossRef]
  26. Egas, C.; Lavoura, N.; Resende, R.; Brito, R.M.M.; Pires, E.; de Lima, M.C.P.; Faro, C. The Saposin-like Domain of the Plant Aspartic Proteinase Precursor Is a Potent Inducer of Vesicle Leakage. J. Biol. Chem. 2002, 275, 38190–38196. [Google Scholar] [CrossRef] [PubMed]
  27. Terauchi, K.; Asakura, T.; Ueda, H.; Tamura, T.; Tamura, K.; Matsumoto, I.; Misaka, T.; Hara-Nishimura, I.; Abe, K. Plant-Specific Insertions in the Soybean Aspartic Proteinases, SoyAP1 and SoyAP2, Perform Different Functions of Vacuolar Targeting. J. Plant Physiol. 2006, 163, 856–862. [Google Scholar] [CrossRef]
  28. De Moura, D.C.; Bryksa, B.C.; Yada, R.Y. In Silico Insights into Protein-Protein Interactions and Folding Dynamics of the Saposin-like Domain of Solanum Tuberosum Aspartic Protease. PLoS ONE 2014, 9, 18–22. [Google Scholar] [CrossRef]
  29. Frey, M.E.; D’Ippolito, S.; Pepe, A.; Daleo, G.R.; Guevara, M.G. Transgenic Expression of Plant-Specific Insert of Potato Aspartic Proteases (StAP-PSI) Confers Enhanced Resistance to Botrytis Cinerea in Arabidopsis Thaliana. Phytochemistry 2018, 149, 1–11. [Google Scholar] [CrossRef]
  30. Muñoz, F.; Palomares-Jerez, M.F.; Daleo, G.; Villalaín, J.; Guevara, M.G. Possible Mechanism of Structural Transformations Induced by StAsp-PSI in Lipid Membranes. Biochim. Biophys. Acta-Biomembr. 2014, 1838, 339–347. [Google Scholar] [CrossRef]
  31. De Caroli, M.; Lenucci, M.S.; Di Sansebastiano, G.-P.; Dalessandro, G.; De Lorenzo, G.; Piro, G. Protein Trafficking to the Cell Wall Occurs through Mechanisms Distinguishable from Default Sorting in Tobacco. Plant J. 2011, 65, 295–308. [Google Scholar] [CrossRef]
  32. De Marchis, F.; Bellucci, M.; Pompa, A. Unconventional Pathways of Secretory Plant Proteins from the Endoplasmic Reticulum to the Vacuole Bypassing the Golgi Complex. Plant Signal. Behav. 2013, 8, e25129. [Google Scholar] [CrossRef] [PubMed]
  33. Stigliano, E.; Faraco, M.; Neuhaus, J.-M.M.; Montefusco, A.; Dalessandro, G.; Piro, G.; Di Sansebastiano, G.-P. Pietro Two Glycosylated Vacuolar GFPs Are New Markers for ER-to-Vacuole Sorting. Plant Physiol. Biochem. 2013, 73, 337–343. [Google Scholar] [CrossRef] [PubMed]
  34. Di Sansebastiano, G.P.; Barozzi, F.; Piro, G.; Denecke, J.; Lousa, C.D.M. Trafficking Routes to the Plant Vacuole: Connecting Alternative and Classical Pathways. J. Exp. Bot. 2018, 69, 79–90. [Google Scholar] [CrossRef] [PubMed]
  35. Vieira, V.; Peixoto, B.; Costa, M.; Pereira, S.; Pissarra, J.; Pereira, C. N-Linked Glycosylation Modulates Golgi-Independent Vacuolar Sorting Mediated by the Plant Specific Insert. Plants 2019, 8, 312. [Google Scholar] [CrossRef]
  36. Nagano, A.J.; Maekawa, A.; Nakano, R.T.; Miyahara, M.; Higaki, T.; Kutsuna, N.; Hasezawa, S.; Hara-Nishimura, I. Quantitative Analysis of ER Body Morphology in an Arabidopsis Mutant. Plant Cell Physiol. 2009, 50, 2015–2022. [Google Scholar] [CrossRef]
  37. Bernat-Silvestre, C.; De Sousa Vieira, V.; Sánchez-Simarro, J.; Aniento, F.; Marcote, M.J. Transient Transformation of A. Thaliana Seedlings by Vacuum Infiltration BT—Arabidopsis Protocols. In Methods in Molecular Biology; Sanchez-Serrano, J.J., Salinas, J., Eds.; Springer: New York, NY, USA, 2021; Volume 2200, pp. 147–155. ISBN 978-1-0716-0880-7. [Google Scholar]
  38. Clough, S.J.; Bent, A.F. Floral Dip: A Simplified Method for Agrobacterium-Mediated Transformation of Arabidopsis Thaliana. Plant J. 1998, 16, 735–743. [Google Scholar] [CrossRef]
  39. Czechowski, T.; Stitt, M.; Altmann, T.; Udvardi, M.K.; Scheible, W.-R. Genome-Wide Identification and Testing of Superior Reference Genes for Transcript Normalization in Arabidopsis. Plant Physiol. 2005, 139, 5–17. [Google Scholar] [CrossRef]
  40. De Benedictis, M.; Bleve, G.; Faraco, M.; Stigliano, E.; Grieco, F.; Piro, G.; Dalessandro, G.; Di Sansebastiano, G. Pietro AtSYP51/52 Functions Diverge in the Post-Golgi Traffic and Differently Affect Vacuolar Sorting. Mol. Plant 2013, 6, 916–930. [Google Scholar] [CrossRef]
  41. Hachez, C.; Laloux, T.; Reinhardt, H.; Cavez, D.; Degand, H.; Grefen, C.; De Rycke, R.; Inzé, D.; Blatt, M.R.; Russinova, E.; et al. Arabidopsis SNAREs SYP61 and SYP121 Coordinate the Trafficking of Plasma Membrane Aquaporin PIP2;7 to Modulate the Cell Membrane Water Permeability. Plant Cell 2014, 26, 3132–3147. [Google Scholar] [CrossRef]
  42. Eisenach, C.; Chen, Z.H.; Grefen, C.; Blatt, M.R. The Trafficking Protein SYP121 of Arabidopsis Connects Programmed Stomatal Closure and K+ Channel Activity with Vegetative Growth. Plant J. 2012, 69, 241–251. [Google Scholar] [CrossRef]
  43. Shirakawa, M.; Ueda, H.; Shimada, T.; Koumoto, Y.; Shimada, T.L.; Kondo, M.; Takahashi, T.; Okuyama, Y.; Nishimura, M.; Hara-Nishimura, I. Arabidopsis Qa-SNARE SYP2 Proteins Localized to Different Subcellular Regions Function Redundantly in Vacuolar Protein Sorting and Plant Development. Plant J. 2010, 64, 924–935. [Google Scholar] [CrossRef]
  44. Zhang, B.; Karnik, R.; Wang, Y.; Wallmeroth, N.; Blatt, M.R.; Grefen, C. The Arabidopsis R-SNARE VAMP721 Interacts with KAT1 and KC1 K+ Channels to Moderate K+ Current at the Plasma Membrane. Plant Cell 2015, 27, 1697–1717. [Google Scholar] [CrossRef]
  45. Kwon, C.; Bednarek, P.; Schulze-Lefert, P. Secretory Pathways in Plant Immune Responses. Plant Physiol. 2008, 147, 1575–1583. [Google Scholar] [CrossRef]
  46. Kwon, C.; Neu, C.; Pajonk, S.; Yun, H.S.; Lipka, U.; Humphry, M.; Bau, S.; Straus, M.; Kwaaitaal, M.; Rampelt, H.; et al. Co-Option of a Default Secretory Pathway for Plant Immune Responses. Nature 2008, 451, 835–840. [Google Scholar] [CrossRef] [PubMed]
  47. Zhang, L.; Zhang, H.; Liu, P.; Hao, H.; Jin, J.B.; Lin, J. Arabidopsis R-SNARE Proteins VAMP721 and VAMP722 Are Required for Cell Plate Formation. PLoS ONE 2011, 6, e26129. [Google Scholar] [CrossRef] [PubMed]
  48. Mazorra-Manzano, M.A.; Yada, R.Y. Expression and Characterization of the Recombinant Aspartic Proteinase A1 from Arabidopsis Thaliana. Phytochemistry 2008, 69, 2439–2448. [Google Scholar] [CrossRef]
  49. Neves, J.; Sampaio, M.; Séneca, A.; Pereira, S.; Pissarra, J.; Pereira, C. Abiotic Stress Triggers the Expression of Genes Involved in Protein Storage Vacuole and Exocyst-Mediated Routes. Int. J. Mol. Sci. 2021, 22, 644. [Google Scholar] [CrossRef]
  50. Neves, J.; Monteiro, J.; Sousa, B.; Soares, C.; Pereira, S.; Fidalgo, F.; Pissarra, J.; Pereira, C. Relevance of the Exocyst in Arabidopsis Exo70e2 Mutant for Cellular Homeostasis under Stress. Int. J. Mol. Sci. 2022, 24, 424. [Google Scholar] [CrossRef]
  51. Matsushima, R.; Kondo, M.; Nishimura, M.; Hara-Nishimura, I. A Novel ER-Derived Compartment, the ER Body, Selectively Accumulates a β-Glucosidase with an ER-Retention Signal in Arabidopsis. Plant J. 2003, 33, 493–502. [Google Scholar] [CrossRef]
  52. Faro, C.; Gal, S. Aspartic Proteinase Content of the Arabidopsis Genome. Curr. Protein Pept. Sci. 2005, 6, 493–500. [Google Scholar] [CrossRef]
  53. Chen, X.; Pfeil, J.E.; Gal, S. The Three Typical Aspartic Proteinase Genes of Arabidopsis Thaliana Are Differentially Expressed. Eur. J. Biochem. 2002, 269, 4675–4684. [Google Scholar] [CrossRef] [PubMed]
  54. Ito, Y.; Uemura, T.; Nakano, A. Formation and Maintenance of the Golgi Apparatus in Plant Cells, 1st ed.; Elsevier Inc.: Amsterdam, The Netherlands, 2014; Volume 310, ISBN 9780128001806. [Google Scholar]
  55. Laloux, T.; Matyjaszczyk, I.; Beaudelot, S.; Hachez, C.; Chaumont, F. Interaction Between the SNARE SYP121 and the Plasma Membrane Aquaporin PIP2;7 Involves Different Protein Domains. Front. Plant Sci. 2021, 11, 631643. [Google Scholar] [CrossRef] [PubMed]
  56. Bassham, D.C.; Blatt, M.R. SNAREs: Cogs and Coordinators in Signaling and Development. Plant Physiol. 2008, 147, 1504–1515. [Google Scholar] [CrossRef] [PubMed]
Ijpb 14 00075 g001
Figure 1. Developmental stages of the leb-2 GFP-h mutated line compared to wild type. (A) Schematization of the leb-2 GFP-h mutation in the PYK10/BGLU23 protein. (B) Arabidopsis thaliana plants size comparison before the appearance of the floral structures. White bars correspond to 2 cm. (C) Chronological progression, in days, of the main growth stages of A. thaliana mutated and wild-type lines.
Figure 1. Developmental stages of the leb-2 GFP-h mutated line compared to wild type. (A) Schematization of the leb-2 GFP-h mutation in the PYK10/BGLU23 protein. (B) Arabidopsis thaliana plants size comparison before the appearance of the floral structures. White bars correspond to 2 cm. (C) Chronological progression, in days, of the main growth stages of A. thaliana mutated and wild-type lines.
Ijpb 14 00075 g001
Ijpb 14 00075 g002
Figure 2. Ultrastructural and subcellular images from the cotyledonary leaves of leb-2 GFP-h mutated line. (A) Schematic representation of the workflow for transmission electron microscopy (TEM). (B) Electron microscopy micrographs of sections of Arabidopsis cotyledonary leaves of wild-type (a,b) and leb-2 GFP-h lines (c–f). Yellow arrows indicate detachment of the plasma membrane, pink arrow show a Golgi with normal morphology and red arrow points a round-shaped Golgi. Chl—chloroplast, CW—cell wall, ER—Endoplasmic Reticulum, G—Golgi, M—mitochondria, V—vacuole. Bars correspond to: (a,d)—0.5 µm; (b,e)—0.1 µm; (c)—1 µm; (f)—0.2 µm.
Figure 2. Ultrastructural and subcellular images from the cotyledonary leaves of leb-2 GFP-h mutated line. (A) Schematic representation of the workflow for transmission electron microscopy (TEM). (B) Electron microscopy micrographs of sections of Arabidopsis cotyledonary leaves of wild-type (a,b) and leb-2 GFP-h lines (c–f). Yellow arrows indicate detachment of the plasma membrane, pink arrow show a Golgi with normal morphology and red arrow points a round-shaped Golgi. Chl—chloroplast, CW—cell wall, ER—Endoplasmic Reticulum, G—Golgi, M—mitochondria, V—vacuole. Bars correspond to: (a,d)—0.5 µm; (b,e)—0.1 µm; (c)—1 µm; (f)—0.2 µm.
Ijpb 14 00075 g002
Ijpb 14 00075 g003
Figure 3. Subcellular localization of leb-2 GFP-h mutated line. (A) Schematic representation of the workflow for confocal laser scanning microscopy (CLSM). (B) Expression of GFP-HDEL in the epidermis of cotyledon leaves of Arabidopsis. (C) Expression of GFP-HDEL marker in the epidermis of cotyledon leaves of leb-2 GFP-h line seedlings in control conditions and with Brefeldin A (+BFA). White arrows indicate spindle-shaped compartments and blue arrows shows protein accumulation in round-shaped compartments.
Figure 3. Subcellular localization of leb-2 GFP-h mutated line. (A) Schematic representation of the workflow for confocal laser scanning microscopy (CLSM). (B) Expression of GFP-HDEL in the epidermis of cotyledon leaves of Arabidopsis. (C) Expression of GFP-HDEL marker in the epidermis of cotyledon leaves of leb-2 GFP-h line seedlings in control conditions and with Brefeldin A (+BFA). White arrows indicate spindle-shaped compartments and blue arrows shows protein accumulation in round-shaped compartments.
Ijpb 14 00075 g003
Ijpb 14 00075 g004
Figure 4. Subcellular localization of SP-PSI A/B-mCherry in cotyledon leaves of wild-type and leb-2 GFP-h seedlings. (A) Workflow of vacuum infiltration setting for transient transformation of Arabidopsis wild-type and leb-2 GFP-h seedlings. (B) Expression of PSI A/B-mCherry in wild-type cotyledon leaves. (C) Expression of PSI A-mCherry in leb-2 GFP-h cotyledon leaves. (D) Expression of PSI B-mCherry in leb-2 GFP-h cotyledon leaves.
Figure 4. Subcellular localization of SP-PSI A/B-mCherry in cotyledon leaves of wild-type and leb-2 GFP-h seedlings. (A) Workflow of vacuum infiltration setting for transient transformation of Arabidopsis wild-type and leb-2 GFP-h seedlings. (B) Expression of PSI A/B-mCherry in wild-type cotyledon leaves. (C) Expression of PSI A-mCherry in leb-2 GFP-h cotyledon leaves. (D) Expression of PSI B-mCherry in leb-2 GFP-h cotyledon leaves.
Ijpb 14 00075 g004
Ijpb 14 00075 g005
Figure 5. Arabidopsis thaliana aspartic proteinases’ expression in wild-type and leb-2 GFP-h. (A) Alignment of cardosins’ PSI A and B with Arabidopsis APs’ PSIs (AP1, AP2 and AP3). Blue indicates the percentage of similarity and the red box indicates the glycosylation site. The red box indicates the glycosylation motif in PSI B. (B) Relative normalized expression of Arabidopsis APs in wild-type plants. (C) Relative normalized expression of Arabidopsis APs in the leb-2 GFP-h mutant when compared to WT. Statistically experimental values are represented by * (p-value ≤ 0.05), ** (p-value ≤ 0.01); **** (p-value < 0.0001), which were calculated using one-way ANOVA.
Figure 5. Arabidopsis thaliana aspartic proteinases’ expression in wild-type and leb-2 GFP-h. (A) Alignment of cardosins’ PSI A and B with Arabidopsis APs’ PSIs (AP1, AP2 and AP3). Blue indicates the percentage of similarity and the red box indicates the glycosylation site. The red box indicates the glycosylation motif in PSI B. (B) Relative normalized expression of Arabidopsis APs in wild-type plants. (C) Relative normalized expression of Arabidopsis APs in the leb-2 GFP-h mutant when compared to WT. Statistically experimental values are represented by * (p-value ≤ 0.05), ** (p-value ≤ 0.01); **** (p-value < 0.0001), which were calculated using one-way ANOVA.
Ijpb 14 00075 g005
Ijpb 14 00075 g006
Figure 6. Expression analysis by qRT-PCR of endomembrane-related genes in leb-2 GFP-h plants when compared to WT plants. (A) Summary of the genes analyzed and their relative role in endomembrane trafficking. (B) Bar graph showing the relative normalized expression of endomembrane genes in the mutant line. Only for AtVAMP722 and AtVAMP723 is a significative alteration observed. Statistically experimental values are represented by the following: ** (p-value ≤ 0.01); **** (p-value < 0.0001), calculated using one-way ANOVA.
Figure 6. Expression analysis by qRT-PCR of endomembrane-related genes in leb-2 GFP-h plants when compared to WT plants. (A) Summary of the genes analyzed and their relative role in endomembrane trafficking. (B) Bar graph showing the relative normalized expression of endomembrane genes in the mutant line. Only for AtVAMP722 and AtVAMP723 is a significative alteration observed. Statistically experimental values are represented by the following: ** (p-value ≤ 0.01); **** (p-value < 0.0001), calculated using one-way ANOVA.
Ijpb 14 00075 g006
Ijpb 14 00075 g007
Figure 7. Cardosins’ PSIs routes observed in plants. PSI A is able to mediate an unconventional Golgi-bypass route to the LV, observed in Nicotiana tabacum leaves and Arabidopsis cotyledons (blue arrow). A route bypassing the Golgi to the PSV is predicted to exist in flowers and seeds (blue arrow, unconfirmed). The red arrows indicate putative routes mediated by PSI B.
Figure 7. Cardosins’ PSIs routes observed in plants. PSI A is able to mediate an unconventional Golgi-bypass route to the LV, observed in Nicotiana tabacum leaves and Arabidopsis cotyledons (blue arrow). A route bypassing the Golgi to the PSV is predicted to exist in flowers and seeds (blue arrow, unconfirmed). The red arrows indicate putative routes mediated by PSI B.
Ijpb 14 00075 g007
Table 1. Genes selected for qPCR analysis, and their respective role and localization.
Table 1. Genes selected for qPCR analysis, and their respective role and localization.
GenesIdentifierRole and LocalizationRef.
AtSAND-1AT2G28390Housekeeping gene.[39]
AtGAPDHAT1G13440Housekeeping gene.[39]
AtUBC9AT4G27960Housekeeping gene.[39]
AtSYP51AT1G16240.1Transport to the PSV, vesicle docking and fusion. Enables SNAP receptor activity, SNARE binding and protein binding. Interacts with VTI12.[40]
AtSYP121AT3G11820.1Syntaxin found in the plasma membrane. Capable of forming a complex with SYP51 and VTI11.[41,42]
AtSYP23AT4G17730.2Transmembrane domain-free cytosolic syntaxin. Role in transport vesicles docking or fusion with the prevacuolar membrane, enabling SNAP receptor activity and SNARE binding.[43]
AtVAMP723AT2G33110.1Found in the endoplasmic reticulum. Directs transport vesicles toward their intended membrane and/or fusing them there.[44]
AtSYP22AT5G46860.1Syntaxin-related protein necessary for vacuolar assembly. Localized in the vacuolar membranes, late endosome and trans-Golgi network (TGN) transport vesicles.[43]
AtVAMP722AT2G33120.2Directs transport vesicles toward their intended membrane and/or fusing them there. Response to biotic stress. Outlines a complex that includes SYP121.[45,46]
AtVAMP721AT1G04750Involved in TGN/early endosome-mediated secretory trafficking to the plasma membrane, contributing to cell plate formation. [44,47]
AtSYP61AT1G28490.1Vesicle trafficking protein. Along with SYP121, coordinates plasma membrane aquaporin PIP2;7 trafficking to modulate membrane water permeability. Complexes with VTI12.[41]
AtSYP52AT1G79590.2Localized to TGN/vacuole, participates in the route to the Lytic vacuole and complexes with VTI11.[40]
AtAP1AT1G11910Saposin-like aspartyl protease with a PSI domain located along the secretory pathway.[48]
AtAP2AT1G62290Saposin-like aspartyl protease with a PSI domain located in the vacuole and secretory vesicles.[48]
AtAP3AT4G04460Saposin-like aspartyl protease with a PSI domain secreted to the extracellular region.[48]
Table 2. Primers used in the qPCR assay.
Table 2. Primers used in the qPCR assay.
GenesPrimer ForwardPrimer Reverse
AtSAND-1AACTCTATGCAGCATTTGATCCACTTGATTGCATATCTTTATCGCCATC
AtGAPDHTTGGTGACAACAGGTCCAAGCAAAACTTGTCGCTCAATGCAATC
AtUBC9TCACAATTTCCAAGGTGCTGCTCATCTGGGTTTGGATCCGT
AtSYP51TGGCGTCTTCATCGGATTCATGGAGCTGAAGCACGACGCTGAGCA
AtSYP121TCCTCCGATCGAACCAGGACCTCTTCTCGCCGGTGACGGTGAA
AtSYP23GCAGCGTGCCCTTCTTGTGGTCCTTGGGCAGTTGCAGCGTA
AtVAMP723CCCGTGGTGTGATATGTGAGCCACAAACCGAGAGGATGAT
AtSYP22CGAGGAAATTCAATGGTGGTACGTGGAGACTCCGGTATTG
AtVAMP722CAATTTGTGGGGGATTCAACGATCTTGGGAAGCACAGAGC
AtSYP61TTGAAAAACGGAGGAGATGGTTCACTTGCATGACCTGCTC
AtSYP52ATGTGGTGGCAACTTGTGAACTTTGCCTCACAGACACGAA
AtAP1GGCATTGAGTCGGTGGTGGACATCTCACATGCAGAACACGCAGCA
AtAP2GGGGATTGAATCGGTGGTGGAACATGCAGGACAACCCGCGTCT
AtAP3TGCAAGGCCGTGGTGGATCAGCGCAGACTCCAATTTGTGAGCA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Cardoso, T.; Sampaio, M.; Neves, J.; Oliveira, S.; Moura, I.; Séneca, A.; Pissarra, J.; Pereira, S.; Pereira, C. Plant-Specific Insert (PSI)-Mediated Vacuolar Sorting Is Not Disrupted in Arabidopsis Mutant with Abnormal ER Morphology. Int. J. Plant Biol. 2023, 14, 1034-1050. https://0-doi-org.brum.beds.ac.uk/10.3390/ijpb14040075

AMA Style

Cardoso T, Sampaio M, Neves J, Oliveira S, Moura I, Séneca A, Pissarra J, Pereira S, Pereira C. Plant-Specific Insert (PSI)-Mediated Vacuolar Sorting Is Not Disrupted in Arabidopsis Mutant with Abnormal ER Morphology. International Journal of Plant Biology. 2023; 14(4):1034-1050. https://0-doi-org.brum.beds.ac.uk/10.3390/ijpb14040075

Chicago/Turabian Style

Cardoso, Tatiana, Miguel Sampaio, João Neves, Sofia Oliveira, Inês Moura, Ana Séneca, José Pissarra, Susana Pereira, and Cláudia Pereira. 2023. "Plant-Specific Insert (PSI)-Mediated Vacuolar Sorting Is Not Disrupted in Arabidopsis Mutant with Abnormal ER Morphology" International Journal of Plant Biology 14, no. 4: 1034-1050. https://0-doi-org.brum.beds.ac.uk/10.3390/ijpb14040075

Article Metrics

Back to TopTop