Start-up Strategies for Anaerobic Ammonia Oxidation (Anammox) in In-Situ Nitrogen Removal from Polluted Groundwater in Rare Earth Mining Areas
Abstract
:1. Introduction
2. Materials and Methods
2.1. The Start-Up Strategies
2.2. Reactor Operation
2.3. Morphological Observation
2.4. FISH Analysis
2.5. DNA Extraction, Amplification, and High-Throughput Sequencing
2.6. Other Analytical Procedures
3. Results and Discussion
3.1. Nitrogen Removal Performance
3.1.1. Nitrogen Removal Performance in Enrichment Period
3.1.2. Nitrogen Removal in the Recovery Period
3.2. La(III) Effects on Sludge’s Morphology
3.3. FISH Analysis
3.4. Microbial Community Analysis
3.4.1. Diversity Changes in the Microbial Community
3.4.2. Changes in Microbial Composition at Phylum Level
3.4.3. Evolution of Microbial Composition at Class Level
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Dutta, T.; Kim, K.-H.; Uchimiya, M.; Kwon, E.E.; Jeon, B.-H.; Deep, A.; Yun, S.-T. Global Demand for Rare Earth Resources and Strategies for Green Mining. Environ. Res. 2016, 150, 182–190. [Google Scholar] [CrossRef]
- Nimila, D.; Nadeera, B.I.; Nimila, D.; Ilankoon, I.M.S.K.; Sudath, R.; Ranjith, P.; Bandara, A.; Nalin, R.; Kithsiri, D. The Story of Rare Earth Elements (REEs): Occurrences, Global Distribution, Genesis, Geology, Mineralogy and Global Production. Ore. Geol. Rev. 2020, 122, 103521. [Google Scholar]
- Alonso, E.; Sherman, A.M.; Wallington, T.J.; Everson, M.P.; Field, F.R.; Roth, R.; Kirchain, R.E. Correction to Evaluating Rare Earth Element Availability: A Case with Revolutionary Demand from Clean Technologies. Environ. Sci. Technol. 2012, 46, 4684. [Google Scholar] [CrossRef]
- Qiuying, Z.; Futian, R.; Fadong, L.; Guoliang, C.; Guang, Y.; Jianqi, W.; Kun, D.; Shanbao, L.; Zhao, L. Ammonia Nitrogen Sources and Pollution along Soil Profiles in an In-Situ Leaching Rare Earth Ore. Environ. Pollut. 2020, 267, 115449. [Google Scholar]
- Cespi, D.; Esposito, I.; Cucciniello, R.; Anastas, P.T. Beyond the Beaker: Benign by Design Society. Curr. Res. Green Sustain. Chem. 2020, 3, 100028. [Google Scholar] [CrossRef]
- Mancheri, N.A.; Sprecher, B.; Bailey, G.; Ge, J.; Tukker, A. Effect of Chinese Policies on Rare Earth Supply Chain Resilience. Resour. Conserv. Recycl. 2019, 142, 101–112. [Google Scholar] [CrossRef]
- Packey, D.J.; Kingsnorth, D. The Impact of Unregulated Ionic Clay Rare Earth Mining in China. Resour. Policy 2016, 48, 112–116. [Google Scholar] [CrossRef]
- USGS (U.S. Geological Survey). Mineral Commodity Summaries Rare Earths. Available online: http://fbicba0205fe611c4836911b3a21202ff838snocu5xkofkxp6wcu.fiac.ncu.cwkeji.cn:8080/centers/nmic/mineral-commodity-summaries (accessed on 26 September 2020).
- Ministry of Industry and Information Technology of the People’s Republic of China; Ministry of Natural Resources of the People’s Republic of China. Notice of the Ministry of Industry and Information Technology, and the Ministry of Natural Resources of the People’s Republic of China on Issuing the Total Control Index for Rare Earth Mining, Smelting and Separation as well as the Total Control Index for Tungsten Mining in 2019. Available online: http://www.miit.gov.cn/n1146295/n1146592/n3917132/n4061854/c7512605/content.html (accessed on 18 November 2019).
- Qiuhua, X.; Lifeng, Y.; Dashan, W.; Xiao, H.; Yuanyuan, S.; Xuezhen, Z.; Xinmu, Z.; Yongxiu, L. Evaluating the Fractionation of Ion-Adsorption Rare Earths for in-Situ Leaching and Metallogenic Mechanism. J. Rare Earths 2018, 36, 1333–1341. [Google Scholar]
- Yang, X.J.; Lin, A.; Li, X.-L.; Wu, Y.; Zhou, W.; Chen, Z. China’s Ion-Adsorption Rare Earth Resources, Mining Consequences and Preservation. Environ. Dev. 2013, 8, 131–136. [Google Scholar] [CrossRef]
- Standardization Administration of the People’s Republic of China; General Administration of Quality Supervision, Inspection and Quarantine of the People’s Republic of China. Standard for Groundwater Quality. 2017, pp. 1–19. Available online: http://c.gb688.cn/bzgk/gb/showGb?type=online&hcno=F745E3023BD5B10B9FB5314E0FFB5523 (accessed on 1 April 2021).
- Ministry of Ecology and Environment of the People’s Republic of China; General A dministration of Quality Supervision, Inspection and Quarantine of the People’s Republic of China. Environmental Quality Standards for Surface Water. Available online: http://www.mee.gov.cn/ywgz/fgbz/bz/bzwb/shjbh/shjzlbz/200206/W020061027509896672057.pdf (accessed on 1 March 2021).
- Wu, D. Study on the Stability of Residual Matter in Southern Ion Rare Earth Mines. Master’s Thesis, China University of Geosciences, Wuhan, China, 2018. (In Chinese). [Google Scholar]
- Wenrui, N.; Rong, Z.; Zhengyan, H.; Jie, Z.; Ming, W.; Zhigao, X.; Ruan, C.; Huifang, Y. Research Progress on Leaching Technology and Theory of Weathered Crust Elution-Deposited Rare Earth Ore. Hydrometallurgy 2020, 193, 105295. [Google Scholar]
- Hao, X.; Wang, D.; Wang, P.; Wang, Y.; Zhou, D. Evaluation of Water Quality in Surface Water and Shallow Groundwater: A Case Study of a Rare Earth Mining Area in Southern Jiangxi Province, China. Environ. Monit. Assess. 2016, 188, 24. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.-S.; Guo, M.-N.; Liu, C.; Yuan, M.; Chen, X.-T.; Huot, H.; Zhao, C.-M.; Tang, Y.-T.; Morel, J.L.; Qiu, R.-L. Water, Sediment and Agricultural Soil Contamination from an Ion-Adsorption Rare Earth Mining Area. Chemosphere 2019, 216, 75–83. [Google Scholar] [CrossRef]
- Luo, J.; Huo, Y.; Shen, Y.; Hu, J.; Ji, H. Effects of Colloidal Particle Size on the Geochemical Characteristics of REE in the Water in Southern Jiangxi Province, China. Environ. Earth Sci. 2016, 75, 81. [Google Scholar] [CrossRef]
- Wenkang, L.; Bin, M.; Qingqing, W.; Yan, W.; Zengjian, S. Feasibility of Achieving Advanced Nitrogen Removal via Endogenous Denitratation/Anammox. Bioresour. Technol. 2021, 325, 124666. [Google Scholar]
- Wang, Y.; Li, B.; Ye, L.; Chen, X. Research Progress on Enhancing the Performance of Autotrophic Nitrogen Removal Systems Using Microbial Immobilization Technology. Sci. Total Environ. 2021, 774, 145136. [Google Scholar] [CrossRef]
- Swathi, D.; Manasa, R.L.; Sabumon, P. Chacko Development of an Anoxic Nitrification-Denitrification Process in a Granulated Nanoscale Oxyhydroxides of Fe Packed Bed Reactor for the Simultaneous Removal of NH4+-N and COD. Environ. Nanotechnol. Monit. Manag. 2021, 15, 100412. [Google Scholar]
- Huang, S.; Wu, D. Responses of Anammox Granular Sludge to Long-Term Rare Earth Element Feeding: Lanthanum as a Case. Sustainability 2020, 12, 7887. [Google Scholar] [CrossRef]
- Kartal, B.; Kuenen, J.G.; Van Loosdrecht, M.C.M. Sewage Treatment with Anammox. Science 2010, 328, 702–703. [Google Scholar] [CrossRef]
- Ma, B.; Wang, S.; Cao, S.; Miao, Y.; Jia, F.; Du, R.; Peng, Y. Biological Nitrogen Removal from Sewage via Anammox: Recent Advances. Bioresour. Technol. 2016, 200, 981–990. [Google Scholar] [CrossRef] [PubMed]
- Sherif, I.; Ahmed, E.; Mohamed, E.; Esraa, A.; Manabu, F.; Shou-Qing, N.; Ahmed, T. Response of Anammox Bacteria to Short-Term Exposure of 1,4-Dioxane: Bacterial Activity and Community Dynamics. Sep. Purif. Technol. 2021, 266, 118539. [Google Scholar]
- Susanne, L.; Gilbert, E.M.; Siegfried, E.; Vlaeminck, S.E.; Joss, A.; Horn, H.; van Loosdrecht, M.C. Full-Scale Partial Nitritation/Anammox Experiences–An Application Survey. Water Res. 2014, 55, 292–303. [Google Scholar]
- Strous, M.; Heijnen, J.J.; Kuenen, J.G.; Jetten, M.S.M. The Sequencing Batch Reactor as a Powerful Tool for the Study of Slowly Growing Anaerobic Ammonium-Oxidizing Microorganisms. Appl. Microbiol. Biotechnol. 1998, 50, 589–596. [Google Scholar] [CrossRef]
- Chen, Y.; Chen, H.; Zheng, X.; Mu, H. The Impacts of Silver Nanoparticles and Silver Ions on Wastewater Biological Phosphorous Removal and the Mechanisms. J. Hazard. Mater. 2012, 239–240, 88–94. [Google Scholar] [CrossRef]
- Zheng, Z.-Z.; Cheg, Y.F.; Bai, Y.H.; Xu, J.J.; Shi, Z.J.; Zang, Q.Q.; Jin, R.C. Enhanced Effects of Maghemite Nanoparticles on the Flocculent Sludge Wasted from a High-Rate Anammox Reactor: Performance, Microbial Community and Sludge Characteristics. Bioresour. Technol. 2018, 250, 265–272. [Google Scholar] [CrossRef]
- Xiaojing, Z.; Zhao, C.; Yue, Z.; Yongpeng, M.; Chuang, M.; Yu, L.; Yuhai, L.; Jinping, J. Impacts of the Heavy Metals Cu (II), Zn (II) and Fe (II) on an Anammox System Treating Synthetic Wastewater in Low Ammonia Nitrogen and Low Temperature: Fe (II) Makes a Difference. Sci. Total Environ. 2019, 648, 798–804. [Google Scholar]
- Zhang, Z.-Z.; Xu, J.-J.; Shi, Z.-J.; Cheng, Y.-F.; Ji, Z.-Q.; Deng, R.; Jin, R.-C. Short-Term Impacts of Cu, CuO, ZnO and Ag Nanoparticles (NPs) on Anammox Sludge: CuNPs Make a Difference. Bioresour. Technol. 2017, 235, 281–291. [Google Scholar] [CrossRef]
- Ding, Z.; Ventorino, V.; Panico, A.; Pepe, O.; van Hullebusch, E.D.; Pirozzi, F.; Bourven, I.; Guibaud, G.; Esposito, G. Enrichment of Anammox Biomass from Different Seeding Sludge: Process Strategy and Microbial Diversity. Water. Air. Soil Pollut. 2017, 228, 1–13. [Google Scholar] [CrossRef]
- Kocamemi, B.A.; Dityapak, D.; Semerci, N.; Keklik, E.; Akarsubası, A.; Kumru, M.; Kurt, H. Anammox Start-up Strategies: The Use of Local Mixed Activated Sludge Seed versus Anammox Seed. Water Sci. Technol. 2018, 78, 1901–1915. [Google Scholar] [CrossRef]
- Miao, Y.; Zhang, J.; Peng, Y.; Wang, S. An Improved Start-up Strategy for Mainstream Anammox Process through Inoculating Ordinary Nitrification Sludge and a Small Amount of Anammox Sludge. J. Hazard. Mater. 2020, 384, 121325. [Google Scholar] [CrossRef]
- Yang, Y.; Zhang, L.; Shao, H.; Zhang, S.; Gu, P.; Peng, Y. Enhanced Nutrients Removal from Municipal Wastewater through Biological Phosphorus Removal Followed by Partial Nitritation/Anammox. Front. Environ. Sci. Eng. 2017, 11, 8. [Google Scholar] [CrossRef]
- Zuo, F.; Sui, Q.; Zheng, R.; Ren, J.; Wei, Y. In Situ Startup of a Full-Scale Combined Partial Nitritation and Anammox Process Treating Swine Digestate by Regulation of Nitrite and Dissolved Oxygen. Bioresour. Technol. 2020, 315, 123837. [Google Scholar] [CrossRef]
- You, L. Study on pollution status and remediation technology in specific southern rare earth diggings. Master’s Thesis, Wuyi University, Jiangmen, China, 2018. (In Chinese). [Google Scholar]
- Suárez-Ojeda, M.E.; Montón, H.; Roldán, M.; Martín-Hernández, M.; Pérez, J.; Carrera, J. Characterization of a P-Nitrophenol-Degrading Mixed Culture with an Improved Methodology of Fluorescence in Situ Hybridization and Confocal Laser Scanning Microscopy. J. Chem. Technol. Biotechnol. 2011, 86, 1405–1412. [Google Scholar] [CrossRef]
- Schmid, M.; Twachtmann, U.; Klein, M.; Strous, M.; Juretschko, S.; Jetten, M.; Metzger, J.W.; Schleifer, K.-H.; Wagner, M. Molecular Evidence for Genus Level Diversity of Bacteria Capable of Catalyzing Anaerobic Ammonium Oxidation. Syst. Appl. Microbiol. 2000, 23, 93–106. [Google Scholar] [CrossRef]
- Schmid, M.C.; Maas, B.; Dapena, A.; van de Pas-Schoonen, K.; van de Vossenberg, J.; Kartal, B.; van Niftrik, L.; Schmidt, I.; Cirpus, I.; Kuenen, J.G.; et al. Biomarkers for In Situ Detection of Anaerobic Ammonium-Oxidizing (Anammox) Bacteria. Appl. Environ. Microbiol. 2005, 71, 1677–1684. [Google Scholar] [CrossRef] [Green Version]
- Wagner, M.; Rath, G.; Koops, H.-P.; Flood, J.; Amann, R. In Situ Analysis of Nitrifying Bacteria in Sewage Treatment Plants. Water Sci. Technol. 1996, 34, 237–244. [Google Scholar] [CrossRef]
- Mobarry, B.K.; Wagner, M.; Urbain, V.; Rittmann, B.E.; Stahl, D.A. Phylogenetic Probes for Analyzing Abundance and Spatial Organization of Nitrifying Bacteria. Appl. Environ. Microbiol. 1996, 62, 2156–2162. [Google Scholar] [CrossRef] [Green Version]
- Vlaeminck, S.E.; Terada, A.; Smets, B.F.; Clippeleir, H.D.; Schaubroeck, T.; Bolca, S.; Demeestere, L.; Mast, J.; Boon, N.; Carballa, M.; et al. Aggregate Size and Architecture Determine Microbial Activity Balance for One-Stage Partial Nitritation and Anammox. Appl. Env. Microbiol. 2010, 76, 10. [Google Scholar] [CrossRef] [Green Version]
- Wang, H.; Li, H.-X.; Fang, F.; Guo, J.; Chen, Y.-P.; Yan, P.; Yang, J.-X. Underlying Mechanisms of ANAMMOX Bacteria Adaptation to Salinity Stress. J. Ind. Microbiol. Biotechnol. 2019, 46, 573–585. [Google Scholar] [CrossRef]
- APHA; AWWA. AEF Standard Methods for the Examination of Water and Wastewater, 21st ed.; American Public Health Association: Washington, DC, USA, 2005. [Google Scholar]
- Tang, C.; Zheng, P.; Chen, J.; Hu, B. Performance of anammox bioreactors started up with different seeding sludge. China Environ. Sci. 2008, 28, 683–688. (In Chinese) [Google Scholar]
- Lv, G.; Li, T.; Xu, L.; Shen, Y.; Wu, P.; Zhang, T.; Thomas, S. Quick start-up performance of combined anammox reactor based on different inoculated sludge types. Environ.Sci. 2017, 38, 4324–4331. (In Chinese) [Google Scholar]
- Wang, T.; Zhang, H.; Gao, D.; Yang, F.; Zhang, G. Comparison between MBR and SBR on Anammox Start-up Process from the Conventional Activated Sludge. Bioresour. Technol. 2012, 122, 78–82. [Google Scholar] [CrossRef] [PubMed]
- Strous, M.; Fuerst, J.A.; Kramer, E.H.M.; Logemann, S.; Muyzer, G.; van de Pas-Schoonen, K.T.; Webb, R.; Kuenen, J.G.; Jetten, M.S.M. Missing Lithotroph Identified as New Planctomycete. Nature 1999, 400, 446. [Google Scholar] [CrossRef]
- Wang, C.; Zheng, P.; Tang, C.; Chen, T. Effects of intermittent starvation on preservation characteristic of ANAMMOX bacteria. Acta Sci. Circumstantiae. 2013, 33, 36–43. (In Chinese) [Google Scholar]
- Wang, Z.; Peng, S.; Yue, Z.; Wang, J. Effects of starvation on granulation and morphology of Anammox sludge. Chin. J. Environ. Eng. 2019, 13, 2570–2575. (in Chinese). [Google Scholar]
- Lansman, J.B. Blockade of Current through Single Calcium Channels by Trivalent Lanthanide Cations. Effect of Ionic Radius on the Rates of Ion Entry and Exit. J. Gen. Physiol. 1990, 95, 679–696. [Google Scholar] [CrossRef] [Green Version]
- Liu, P.; Xiao, H.; Li, X.; Zhang, C.; Liu, Y. Study on the Toxic Mechanism of La3+ to Escherichia Coli. Biol. Trace Elem. Res. 2006, 114, 293–299. [Google Scholar]
- Tang, Z.; Zhang, S.; Li, G.; Li, X.; Li, J. Effects of Ca2+ on the nitrogen removal efficiency of anaerobic ammonia oxidation sludge under low temperature stress. Environ. Pollut. Control. 2019, 41, 279–282. (In Chinese) [Google Scholar]
- Peng, J.; Zhang, Y.; Wang, Q.; Li, Z. Influence of Mg2+ on Anammox bacteria: Adaptability and activity recovery strategy. China Water Wastewater. 2019, 35, 23–28. (in Chinese). [Google Scholar]
- Wang, C.; Zheng, P.; Cai, J.; Chen, T. Preservation of ANAMMOX bacteria. China Environ. Sci. 2013, 33, 1474–1482. (In Chinese) [Google Scholar]
- Tang, C.; Zheng, P.; Wang, C.; Mahmood, Q. Suppression of Anaerobic Ammonium Oxidizers under High Organic Content in High-Rate Anammox UASB Reactor. Bioresour. Technol. 2010, 101, 1762–1768. [Google Scholar] [CrossRef]
- Li, G.-F.; Ma, W.-J.; Cheng, Y.-F.; Li, S.-T.; Zhao, J.-W.; Li, J.-P.; Liu, Q.; Fan, N.-S.; Huang, B.-C.; Jin, R.-C. A Spectra Metrology Insight into the Binding Characteristics of Cu2+ onto Anammox Extracellular Polymeric Substances. Chem. Eng. J. 2020, 393, 124800. [Google Scholar] [CrossRef]
- Zhang, Z.-Z.; Deng, R.; Cheng, Y.-F.; Zhou, Y.-H.; Buayi, X.; Zhang, X.; Wang, H.-Z.; Jin, R.-C. Behavior and Fate of Copper Ions in an Anammox Granular Sludge Reactor and Strategies for Remediation. J. Hazard. Mater. 2015, 300, 838–846. [Google Scholar] [CrossRef]
- Xiao, Y.; Liu, X.; Feng, Z.; Huang, X.; Huang, L.; Chen, Y.; Wu, W. Role of Minerals Properties on Leaching Process of Weathered Crust Elution-Deposited Rare Earth Ore. J. Rare Earths 2015, 33, 545–552. [Google Scholar] [CrossRef]
- Wang, T. Study on quick start-up of anammox process and characteristics of bacterial community. Master’s Thesis, Dalian University of Technology, Dalian, China, 2012. (In Chinese). [Google Scholar]
- Ma, X.; Wang, Y.; Zhou, S.; Yan, Y.; Lin, X.; Wu, M. Endogenous Metabolism of Anaerobic Ammonium Oxidizing Bacteria in Response to Short-Term Anaerobic and Anoxic Starvation Stress. Chem. Eng. J. 2017, 313, 1233–1241. [Google Scholar] [CrossRef]
- Phanwilai, S.; Wantawin, C.; Terada, A.; Noophan, P. (Lek); Munakata-Marr, J. Resuscitation of Starved Suspended- and Attached-Growth Anaerobic Ammonium Oxidizing Bacteria with and without Acetate. Water Sci. Technol. 2017, 75, 115–127. [Google Scholar] [CrossRef]
- Luong, N.N.; Audrey, S.C.; Kahlke, T.; Peter, J.R.; Galilee, U.S.; Md Abu Hasan, J.; Long, D. Nghiem Genome Sequencing as a New Window into the Microbial Community of Membrane Bioreactors–A Critical Review. Sci. Total Environ. 2020, 704, 135279. [Google Scholar]
- Hu, M.; Wang, X.; Wen, X.; Xia, Y. Microbial Community Structures in Different Wastewater Treatment Plants as Revealed by 454-Pyrosequencing Analysis. Bioresour. Technol. 2012, 117, 72–79. [Google Scholar] [CrossRef]
- Xiao, J.; Guo, L.; Wang, S.; Lu, Y. Comparative Impact of Cadmium on Two Phenanthrene-Degrading Bacteria Isolated from Cadmium and Phenanthrene Co-Contaminated Soil in China. J. Hazard. Mater. 2010, 174, 818–823. [Google Scholar] [CrossRef]
- Ye, L.; Shao, M.; Zhang, T.; Tong, A.H.Y.; Lok, S. Analysis of the Bacterial Community in a Laboratory-Scale Nitrification Reactor and a Wastewater Treatment Plant by 454-Pyrosequencing. Water Res. 2011, 45, 4390–4398. [Google Scholar] [CrossRef]
- McBride, M.J.; Zhu, Y. Gliding Motility and Por Secretion System Genes Are Widespread among Members of the Phylum Bacteroidetes. J. Bacteriol. 2013, 195, 270–278. [Google Scholar] [CrossRef] [Green Version]
- Bao, H.X.; Ma, X.P.; Wang, J.; Jing, K.; Shen, M.L.; Wang, A.J. Performance of Denitrifying Phosphorous Removal Process Employing Nitrite as Electron Acceptor and the Characterization of Dominant Functional Populations. Adv. Mater. Res. 2012, 455–456, 1019–1024. [Google Scholar] [CrossRef]
- Inoue, J.; Oshima, K.; Suda, W.; Sakamoto, M.; Iino, T.; Noda, S.; Hongoh, Y.; Hattori, M.; Ohkuma, M. Distribution and Evolution of Nitrogen Fixation Genes in the Phylum Bacteroidetes. Microbes Environ. 2015, 30, 44–50. [Google Scholar] [CrossRef] [Green Version]
- Hug, L.A.; Castelle, C.J.; Wrighton, K.C.; Thomas, B.C.; Sharon, I.; Frischkorn, K.R.; Williams, K.H.; Tringe, S.G.; Banfield, J.F. Community Genomic Analyses Constrain the Distribution of Metabolic Traits across the Chloroflexi Phylum and Indicate Roles in Sediment Carbon Cycling. Microbiome 2013, 1, 1–17. [Google Scholar] [CrossRef] [Green Version]
- Hao, S.; Dachao, Z.; Philip, A.; Longwen, X.; Wuhui, L.; Xiaoyu, D.; Cheng, L.; Zuwen, L.; Miao, S. Unraveling the Effects of Light Rare-Earth Element (Lanthanum (III)) on the Efficacy of Partial-Nitritation Process and Its Responsible Functional Genera. Chem. Eng. J. 2021, 408, 127311. [Google Scholar]
- Isanta, E.; Bezerra, T.; Fernandez, I.; Suarez-Ojeda, M.E.; Perez, J.; Carrera, J. Microbial Community Shifts on an Anammox Reactor after a Temperature Shock Using 454-Pyrosequencing Analysis. Bioresour. Technol. 2015, 181, 207–213. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tomaszewski, M.; Cema, G.; Ziembińska-Buczyńska, A. Influence of Temperature and PH on the Anammox Process: A Review and Meta-Analysis. Chemosphere 2017, 182, 203–214. [Google Scholar] [CrossRef]
Strategy | Reactor | Seed Sludge | Operating Period | La(III) Addition Period | La(III) Concentration in Reactor | Ammonium Consumption Appearance | Anammox Activity Inflexion |
---|---|---|---|---|---|---|---|
Control | R0 | Activated sludge | Days 1–108 | - | - | Day 26 | Day 86 |
In-situ | R1 | Activated sludge | Days 1–108 | Days 1–108 | 0.02 mg L−1 | Day 25 | Day 60 |
Semi in-situ | R2 | Activated sludge | Days 1–108 | Days 61–108 | 0.02 mg L−1 | Day 28 | Day 71 |
Semi in-situ | R3 | Activated sludge | Days 1–108 | Days 61–108 | 0.10 mg L−1 | Day 30 | Day 70 |
Ex-situ | R4 | Anammox flocs | Days 30–108 | Days 30–108 | 0.10 mg L−1 | Day 1 | Day 1 |
Probe | Specificity | Label | Color in Images | Sequence(5′-3′) |
---|---|---|---|---|
Amx820 | AnAOB | Cy5 | purple | AAAACCCCTCTACTTAGTGCCC |
NIT3 | NOB | FITC | green | CCTGTGCTCCATGCTCCG |
NSO190 | AOB | Cy3 | red | CGATCCCCTGCTTTTCTCC |
Sample ID | Reads | OUTs | Chao1 | Shannon | Simpson | Coverge |
---|---|---|---|---|---|---|
Seed1 | 25,513 | 554 | 593.91 | 6.903113 | 0.969402 | 0.9972 |
R0A | 31,415 | 550 | 616.23 | 5.744148 | 0.950788 | 0.9958 |
R0B | 30,986 | 452 | 512.73 | 5.42796 | 0.950321 | 0.9959 |
R1A | 31,214 | 519 | 597.47 | 5.725502 | 0.955701 | 0.9956 |
R1B | 32,783 | 520 | 559.44 | 5.252368 | 0.904126 | 0.9962 |
R2A | 32,278 | 528 | 574.37 | 5.431604 | 0.935977 | 0.9958 |
R2B | 32,850 | 544 | 591.52 | 5.372883 | 0.922735 | 0.9960 |
Seed2 | 31,559 | 309 | 347.61 | 4.615046 | 0.905782 | 0.9972 |
R4A | 32,186 | 333 | 353.62 | 4.945635 | 0.930457 | 0.9979 |
R4B | 31,487 | 369 | 407.44 | 4.62402 | 0.886857 | 0.9971 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huang, S.; Wu, D. Start-up Strategies for Anaerobic Ammonia Oxidation (Anammox) in In-Situ Nitrogen Removal from Polluted Groundwater in Rare Earth Mining Areas. Sustainability 2021, 13, 4591. https://0-doi-org.brum.beds.ac.uk/10.3390/su13084591
Huang S, Wu D. Start-up Strategies for Anaerobic Ammonia Oxidation (Anammox) in In-Situ Nitrogen Removal from Polluted Groundwater in Rare Earth Mining Areas. Sustainability. 2021; 13(8):4591. https://0-doi-org.brum.beds.ac.uk/10.3390/su13084591
Chicago/Turabian StyleHuang, Shuanglei, and Daishe Wu. 2021. "Start-up Strategies for Anaerobic Ammonia Oxidation (Anammox) in In-Situ Nitrogen Removal from Polluted Groundwater in Rare Earth Mining Areas" Sustainability 13, no. 8: 4591. https://0-doi-org.brum.beds.ac.uk/10.3390/su13084591