Impact of Gastrointestinal Bacillus anthracis Infection on Hepatic B Cells
Abstract
:1. Introduction
2. Results and Discussion
2.1. B. anthracis Sterne Infection Allows Dissemination of Gut-Associated Microbes within the Liver
2.2. Characterization of B Cell Subpopulations in the Liver of A/J Mice
2.3. Evaluation of Chemokine and Chemokine Receptors in the Liver during B. anthracis Sterne Infection
2.4. Sterne Infection Increases the Accumulation of Type 2 Innate Lymphoid Cells
3. Experimental Section
3.1. Mice and Ethics Statement
3.2. Bacillus anthracis Spore Preparation and Mouse Infections
3.3. Quantitative Real-Time-PCR
3.4. Isolation of Immune Cells for Flow Cytometry Analyses
3.5. Statistical Analyses
4. Conclusions
Supplementary Materials
Acknowledgments
Author Contributions
Conflicts of Interest
Appendix
Gene/Organism | Sequence (5ʹ to 3ʹ) | References |
---|---|---|
Bacteroides For | GAGAGGAAGGTCCCCCAC | [36] |
Bacteroides Rev | CGCTACTTGGCTGGTTCAG | |
Bifidobacterium For | CGGGTGAGTAATGCGTGACC | [9] |
Bifidobacterium Rev | TGATAGGACGCGACCCCA | |
Enterobacteriaceae For | GTGCCAGCMGCCGCGGTAA | [9] |
Enterobacteriaceae Rev | GCCTCAAGGGCACAACCTCCAAG | |
Bacillus anthracis For | ATCACCAGAGGCAAGACACCC | [37] |
Bacillus anthracis Rev | ACCAATATCAAAGAACGACGC | |
Cxcl13 For | CAGAATGAGGCTCAGCACAGC | [9] |
Cxcl13 Rev | CAGAATACCGTGGCCTGGAG | |
Cxcl11 For | GGCGTCAAAACATGTGACATCC | [38] |
Cxcl11 Rev | TGGCTGCATGTTCCAAGACAG | |
Cxcl10 For | TCCCTCTCGCAAGGAC | [9] |
Cxcl10 Rev | TTGGCTAAACGCTTTCAT | |
Cxcl12 For | GAGCCAACGTCAAGCATCTG | [9] |
Cxcl12 Rev | CGGGTCAATGCACACTTGTC | |
Cxcl16 For | ACCCTTGTCTCTTGCGTTCTTCCT | [39] |
Cxcl16 Rev | ATGTGATCCAAAGTACCCTGCGGT | |
Ccl25 For | CCAAGGTGCCTTTGAAGACT | [33] |
Ccl25 Rev | TCCTCCAGCTGGTGGTTACT | |
GAPDH For | GGTGAAGGTCGGTGTGAACG | [9] |
GAPDH Rev | CTCGCTCCTGGAAGATGGTG |
References
- Beatty, M.E.; Ashford, D.A.; Griffin, P.M.; Tauxe, R.V.; Sobel, J. Gastrointestinal anthrax: Review of the literature. Arch. Intern. Med. 2003, 163, 2527–2531. [Google Scholar] [CrossRef] [PubMed]
- Mikesell, P.; Ivins, B.E.; Ristroph, J.D.; Dreier, T.M. Evidence for plasmid-mediated toxin production in bacillus anthracis. Infect. Immun. 1983, 39, 371–376. [Google Scholar] [PubMed]
- Tonello, F.; Zornetta, I. Bacillus anthracis factors for phagosomal escape. Toxins 2012, 4, 536–553. [Google Scholar] [CrossRef] [PubMed]
- Lowe, D.E.; Glomski, I.J. Cellular and physiological effects of anthrax exotoxin and its relevance to disease. Front. Cell. Infect. Microbiol. 2012, 2, 76. [Google Scholar] [CrossRef] [PubMed]
- Owen, J.L.; Yang, T.; Mohamadzadeh, M. New insights into gastrointestinal anthrax infection. Trends Mol. Med. 2015, 21, 154–163. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Moayeri, M.; Leppla, S.H. Anthrax lethal and edema toxins in anthrax pathogenesis. Trends Microbiol. 2014, 22, 317–325. [Google Scholar] [CrossRef] [PubMed]
- Scanlon, S.T.; McKenzie, A.N.J. The messenger between worlds: The regulation of innate and adaptive type-2 immunity by innate lymphoid cells. Clin. Exp. Allergy 2015, 45, 9–20. [Google Scholar] [CrossRef] [PubMed]
- Beyer, W.; Turnbull, P.C.B. Anthrax in animals. Mol. Asp. Med. 2009, 30, 481–489. [Google Scholar] [CrossRef] [PubMed]
- Lightfoot, Y.L.; Yang, T.; Sahay, B.; Zadeh, M.; Cheng, S.X.; Wang, G.P.; Owen, J.L.; Mohamadzadeh, M. Colonic immune suppression, barrier dysfunction, and dysbiosis by gastrointestinal bacillus anthracis infection. PLoS One 2014, 9, e100532. [Google Scholar] [CrossRef] [PubMed]
- Sahay, B.; Owen, J.L.; Zadeh, M.; Yang, T.; Lightfoot, Y.L.; Abed, F.; Mohamadzadeh, M. Impaired colonic B-cell responses by gastrointestinal bacillus anthracis infection. J. Infect. Dis. 2014, 210, 1499–1507. [Google Scholar] [CrossRef] [PubMed]
- Welkos, S.L.; Keener, T.J.; Gibbs, P.H. Differences in susceptibility of inbred mice to bacillus anthracis. Infect. Immun. 1986, 51, 795–800. [Google Scholar] [PubMed]
- Hambleton, P.; Carman, J.A.; Melling, J. Anthrax: The disease in relation to vaccines. Vaccine 1984, 2, 125–132. [Google Scholar] [CrossRef]
- Crispe, I.N. The liver as a lymphoid organ. Annu. Rev. Immunol. 2009, 27, 147–163. [Google Scholar] [CrossRef] [PubMed]
- Schafer, C.; Parlesak, A.; Schutt, C.; Bode, J.C.; Bode, C. Concentrations of lipopolysaccharide-binding protein, bactericidal/permeability-increasing protein, soluble cd14 and plasma lipids in relation to endotoxaemia in patients with alcoholic liver disease. Alcohol. Alcohol. 2002, 37, 81–86. [Google Scholar] [CrossRef] [PubMed]
- Qi, S.; Sui, W.; Yang, M.; Chen, J.; Dai, Y. Cpg array analysis of histone h3 lysine 4 trimethylation by chromatin immunoprecipitation linked to microarrays analysis in peripheral blood mononuclear cells of iga nephropathy patients. Yonsei Med. J. 2012, 53, 377–385. [Google Scholar] [CrossRef] [PubMed]
- Balmer, M.L.; Slack, E.; de Gottardi, A.; Lawson, M.A.E.; Hapfelmeier, S.; Miele, L.; Grieco, A.; van Vlierberghe, H.; Fahrner, R.; Patuto, N.; et al. The liver may act as a firewall mediating mutualism between the host and its gut commensal microbiota. Sci. Transl Med. 2014, 6, 237ra66. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wiest, R.; Garcia-Tsao, G. Bacterial translocation (bt) in cirrhosis. Hepatology 2005, 41, 422–433. [Google Scholar] [CrossRef] [PubMed]
- Holt, A.P.; Stamataki, Z.; Adams, D.H. Attenuated liver fibrosis in the absence of B cells. Hepatology 2006, 43, 868–871. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Stolz, D.B.; Chalasani, G.; Thomson, A.W. Hepatic B cells are readily activated by toll-like receptor-4 ligation and secrete less interleukin-10 than lymphoid tissue b cells. Clin. Exp. Immunol. 2013, 173, 473–479. [Google Scholar] [CrossRef] [PubMed]
- Carsetti, R.; Rosado, M.M.; Wardmann, H. Peripheral development of b cells in mouse and man. Immunol. Rev. 2004, 197, 179–191. [Google Scholar] [CrossRef] [PubMed]
- Kaveri, S.V.; Silverman, G.J.; Bayry, J. Natural igm in immune equilibrium and harnessing their therapeutic potential. J. Immunol. 2012, 188, 939–945. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X. Regulatory functions of innate-like b cells. Cell. Mol. Immunol. 2013, 10, 113–121. [Google Scholar] [CrossRef] [PubMed]
- Feng, L.; Li, L.; Liu, Y.; Qiao, D.; Li, Q.; Fu, X.Y.; Wang, H.; Lao, S.H.; Wu, C.Y. B lymphocytes that migrate to tuberculous pleural fluid via the sdf-1/cxcr4 axis actively respond to antigens specific for mycobacterium tuberculosis. Eur. J. Immunol. 2011, 41, 3261–3269. [Google Scholar] [CrossRef] [PubMed]
- Park, M.K.; Amichay, D.; Love, P.; Wick, E.; Liao, F.; Grinberg, A.; Rabin, R.L.; Zhang, H.W.H.; Gebeyehu, S.; Wright, T.M.; et al. The cxc chemokine murine monokine induced by ifn-gamma (cxc chemokine ligand 9) is made by apcs, targets lymphocytes including activated b cells, and supports antibody responses to a bacterial pathogen in vivo. J. Immunol. 2002, 169, 1433–1443. [Google Scholar] [CrossRef] [PubMed]
- Patadia, M.; Dixon, J.; Conley, D.; Chandra, R.; Peters, A.; Suh, L.A.; Kato, A.; Carter, R.; Harris, K.; Grammer, L.; et al. Evaluation of the presence of b-cell attractant chemokines in chronic rhinosinusitis. Am. J. Rhinol. Allergy 2010, 24, 11–16. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Holmes, T.H.; Cheung, R.; Greenberg, H.B.; He, X.S. Expression of chemokine receptors on intrahepatic and peripheral lymphocytes in chronic hepatitis c infection: Its relationship to liver inflammation. J. Infect. Dis. 2004, 190, 989–997. [Google Scholar] [CrossRef] [PubMed]
- Kunkel, E.J.; Butcher, E.C. Plasma-cell homing. Nat. Rev. Immunol. 2003, 3, 822–829. [Google Scholar] [CrossRef] [PubMed]
- Widney, D.P.; Xia, Y.R.; Lusis, A.J.; Smith, J.B. The murine chemokine cxcl11 (ifn-inducible t cell alpha chemoattractant) is an ifn-gamma- and lipopolysaccharide-inducible glucocorticoid-attenuated response gene expressed in lung and other tissues during endotoxemia. J. Immunol. 2000, 164, 6322–6331. [Google Scholar] [CrossRef] [PubMed]
- Karin, N. The multiple faces of cxcl12 (SDF-1alpha) in the regulation of immunity during health and disease. J. Leukoc. Biol. 2010, 88, 463–473. [Google Scholar] [CrossRef] [PubMed]
- Klasen, C.; Ohl, K.; Sternkopf, M.; Shachar, I.; Schmitz, C.; Heussen, N.; Hobeika, E.; Levit-Zerdoun, E.; Tenbrock, K.; Reth, M.; et al. Mif promotes B cell chemotaxis through the receptors cxcr4 and cd74 and zap-70 signaling. J. Immunol. 2014, 192, 5273–5284. [Google Scholar] [CrossRef] [PubMed]
- Diefenbach, A. Innate lymphoid cells in the defense against infections. Eur. J. Microbiol. Immunol. 2013, 3, 143–151. [Google Scholar] [CrossRef] [PubMed]
- Griffith, J.W.; Sokol, C.L.; Luster, A.D. Chemokines and chemokine receptors: Positioning cells for host defense and immunity. Annu. Rev. Immunol. 2014, 32, 659–702. [Google Scholar] [CrossRef] [PubMed]
- Wurbel, M.A.; McIntire, M.G.; Dwyer, P.; Fiebiger, E. Ccl25/ccr9 interactions regulate large intestinal inflammation in a murine model of acute colitis. PLoS ONE 2011, 6, e16442. [Google Scholar] [CrossRef] [PubMed]
- Agrawal, A.; Lingappa, J.; Leppla, S.H.; Agrawal, S.; Jabbar, A.; Quinn, C.; Pulendran, B. Impairment of dendritic cells and adaptive immunity by anthrax lethal toxin. Nature 2003, 424, 329–334. [Google Scholar] [CrossRef] [PubMed]
- Fang, H.; Xu, L.; Chen, T.Y.; Cyr, J.M.; Frucht, D.M. Anthrax lethal toxin has direct and potent inhibitory effects on b cell proliferation and immunoglobulin production. J. Immunol. 2006, 176, 6155–6161. [Google Scholar] [CrossRef] [PubMed]
- Petnicki-Ocwieja, T.; Hrncir, T.; Liu, Y.-J.; Biswas, A.; Hudcovic, T.; Tlaskalova-Hogenova, H.; Kobayashi, K.S. Nod2 is required for the regulation of commensal microbiota in the intestine. Proc. Natl. Acad. Sci. USA 2009, 106, 15813–15818. [Google Scholar] [CrossRef] [PubMed]
- Makino, S.I.; Cheun, H.I.; Watarai, M.; Uchida, I.; Takeshi, K. Detection of anthrax spores from the air by real-time pcr. Lett. Appl. Microbiol. 2001, 33, 237–240. [Google Scholar] [CrossRef] [PubMed]
- Roebrock, K.; Sunderkotter, C.; Munck, N.A.; Wolf, M.; Nippe, N.; Barczyk, K.; Varga, G.; Vogl, T.; Roth, J.; Ehrchen, J. Epidermal expression of i-tac (cxcl11) instructs adaptive th2-type immunity. FASEB J.: Off. Publ. Fed. Am. Soc. Exp. Biol. 2014, 28, 1724–1734. [Google Scholar] [CrossRef] [PubMed]
- Chen, G.; Lin, S.-C.; Chen, J.; He, L.; Dong, F.; Xu, J.; Han, S.; Du, J.; Entman, M.L.; Wang, Y. Cxcl16 recruits bone marrow-derived fibroblast precursors in renal fibrosis. J. Am. Soc. Nephrol. 2011, 22, 1876–1886. [Google Scholar] [CrossRef] [PubMed]
© 2015 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Colliou, N.; Sahay, B.; Zadeh, M.; Owen, J.L.; Mohamadzadeh, M. Impact of Gastrointestinal Bacillus anthracis Infection on Hepatic B Cells. Toxins 2015, 7, 3805-3817. https://0-doi-org.brum.beds.ac.uk/10.3390/toxins7093805
Colliou N, Sahay B, Zadeh M, Owen JL, Mohamadzadeh M. Impact of Gastrointestinal Bacillus anthracis Infection on Hepatic B Cells. Toxins. 2015; 7(9):3805-3817. https://0-doi-org.brum.beds.ac.uk/10.3390/toxins7093805
Chicago/Turabian StyleColliou, Natacha, Bikash Sahay, Mojgan Zadeh, Jennifer L. Owen, and Mansour Mohamadzadeh. 2015. "Impact of Gastrointestinal Bacillus anthracis Infection on Hepatic B Cells" Toxins 7, no. 9: 3805-3817. https://0-doi-org.brum.beds.ac.uk/10.3390/toxins7093805