Elevating SOX2 Downregulates MYC through a SOX2:MYC Signaling Axis and Induces a Slowly Cycling Proliferative State in Human Tumor Cells
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Vector Preparation and Construction
2.3. RNA Isolation, cDNA Synthesis, and qPCR
2.4. mRNA Sequencing
2.5. Chromatin Immunoprecipitation and Library Preparation
2.6. Bioinformatics Analyses
2.7. Western Blotting
2.8. Cell Cycle Analysis
2.9. Translation Assay
2.10. Nuclear Run-On Assay
3. Results
3.1. Elevating SOX2 Downregulates MYC Target Gene Expression
3.2. SOX2 Elevation Decreases MYC Expression in Multiple Human Tumor Cell Types
3.3. Identifying MYC-Bound Genes in ONS76 Cells
3.4. Omomyc Induction Recapitulates the Growth Inhibitory Effects of Elevated SOX2
3.5. SOX2 and MYC Regulate Protein Translation-Associated Genes in ONS76 Cells
3.6. SOX2 Elevation Decreases Protein Translation
3.7. MYC Rescue in the Presence of Elevated SOX2 Induces Cell Death
3.8. SOX2 Elevation Transcriptionally Downregulates MYC
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wuebben, E.L.; Rizzino, A. The Dark Side of Sox2: Cancer—A comprehensive overview. Oncotarget 2017, 8, 44917–44943. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Avilion, A.A.; Nicolis, S.K.; Pevny, L.H.; Perez, L.; Vivian, N.; Lovell-Badge, R. Multipotent cell lineages in early mouse development depend on Sox2 function. Genes Dev. 2003, 17, 126–140. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Metz, E.P.; Rizzino, A. Sox2 dosage: A critical determinant in the functions of SOX2 in both normal and tumor cells. J. Cell. Physiol. 2019, 234, 19298–19306. [Google Scholar] [CrossRef] [PubMed]
- Chew, J.-L.; Loh, Y.-H.; Zhang, W.; Chen, X.; Tam, W.-L.; Yeap, L.-S.; Li, P.; Ang, Y.-S.; Lim, B.; Robson, P.; et al. Reciprocal transcriptional regulation of POU5F1 and SOX2 via the oct4/sox2 complex in embryonic stem cells. Mol. Cell. Biol. 2005, 25, 6031–6046. [Google Scholar] [CrossRef] [Green Version]
- Kopp, J.L.; Ormsbee, B.D.; Desler, M.; Rizzino, A. Small increases in the level of Sox2 trigger the differentiation of mouse embryonic stem cells. Stem Cells 2008, 26, 903–911. [Google Scholar] [CrossRef]
- Carey, B.W.; Markoulaki, S.; Hanna, J.H.; Faddah, D.A.; Buganim, Y.; Kim, J.; Ganz, K.; Steine, E.J.; Cassady, J.P.; Creyghton, M.P.; et al. Reprogramming factor stoichiometry influences the epigenetic state and biological properties of induced pluripotent stem cells. Cell Stem Cell 2011, 9, 588–598. [Google Scholar] [CrossRef] [Green Version]
- Papapetrou, E.P.; Tomishima, M.J.; Chambers, S.M.; Mica, Y.; Reed, E.; Menon, J.; Tabar, V.; Mo, Q.; Studer, L.; Sadelain, M. Stoichiometric and temporal requirements of Oct4, Sox2, klf4, and c-myc expression for efficient human IPSC induction and differentiation. Proc. Natl. Acad. Sci. USA 2009, 106, 12759–12764. [Google Scholar] [CrossRef] [Green Version]
- Yamaguchi, S.; Hirano, K.; Nagata, S.; Tada, T. Sox2 expression effects on direct reprogramming efficiency as determined by alternative somatic cell fate. Stem Cell Res. 2011, 6, 177–186. [Google Scholar] [CrossRef] [Green Version]
- Hagey, D.W.; Muhr, J. Sox2 acts in a dose-dependent fashion to regulate proliferation of cortical progenitors. Cell Rep. 2014, 9, 1908–1920. [Google Scholar] [CrossRef] [Green Version]
- Hagey, D.W.; Klum, S.; Kurtsdotter, I.; Zaouter, C.; Topcic, D.; Andersson, O.; Bergsland, M.; Muhr, J. Sox2 regulates common and specific stem cell features in the CNS and endoderm derived organs. PLoS Genet. 2018, 14, e1007224. [Google Scholar] [CrossRef] [Green Version]
- Vanner, R.J.; Remke, M.; Gallo, M.; Selvadurai, H.J.; Coutinho, F.; Lee, L.; Kushida, M.; Head, R.; Morrissy, S.; Zhu, X.; et al. Quiescent SOX2+ cells drive hierarchical growth and relapse in sonic hedgehog subgroup medulloblastoma. Cancer Cell 2014, 26, 33–47. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Malladi, S.; Macalinao, D.G.; Jin, X.; He, L.; Basnet, H.; Zou, Y.; de Stanchina, E.; Massagué, J. Metastatic latency and immune evasion through autocrine inhibition of Wnt. Cell 2016, 165, 45–60. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Takeda, K.; Mizushima, T.; Yokoyama, Y.; Hirose, H.; Wu, X.; Qian, Y.; Ikehata, K.; Miyoshi, N.; Takahashi, H.; Haraguchi, N.; et al. Sox2 is associated with cancer stem-like properties in colorectal cancer. Sci. Rep. 2018, 8, 17639. [Google Scholar] [CrossRef] [PubMed]
- Dhimolea, E.; de Matos Simoes, R.; Kansara, D.; Al’Khafaji, A.; Bouyssou, J.; Weng, X.; Sharma, S.; Raja, J.; Awate, P.; Shirasaki, R.; et al. An embryonic diapause-like adaptation with suppressed MYC activity enables tumor treatment persistence. Cancer Cell 2021, 39, 240–256.e11. [Google Scholar] [CrossRef] [PubMed]
- Rehman, S.K.; Haynes, J.; Collignon, E.; Brown, K.R.; Wang, Y.; Nixon, A.M.L.; Bruce, J.P.; Wintersinger, J.A.; Singh Mer, A.; Lo, E.B.L.; et al. Colorectal cancer cells enter a diapause-like DTP state to survive chemotherapy. Cell 2021, 184, 226–242.e21. [Google Scholar] [CrossRef] [PubMed]
- Bulut-Karslioglu, A.; Biechele, S.; Jin, H.; Macrae, T.A.; Hejna, M.; Gertsenstein, M.; Song, J.S.; Ramalho-Santos, M. Inhibition of mtor induces a paused pluripotent state. Nature 2016, 540, 119–123. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, W.M.; Cheng, R.R.; Niu, Z.R.; Chen, A.C.; Ma, M.Y.; Li, T.; Chiu, P.C.; Pang, R.T.; Lee, Y.L.; Ou, J.P.; et al. Let-7 derived from endometrial extracellular vesicles is an important inducer of embryonic diapause in mice. Sci. Adv. 2020, 6, eaaz7070. [Google Scholar] [CrossRef]
- Scognamiglio, R.; Cabezas-Wallscheid, N.; Thier, M.C.; Altamura, S.; Reyes, A.; Prendergast, Á.M.; Baumgärtner, D.; Carnevalli, L.S.; Atzberger, A.; Haas, S.; et al. Myc depletion induces a pluripotent dormant state mimicking diapause. Cell 2016, 164, 668–680. [Google Scholar] [CrossRef] [Green Version]
- Cox, J.L.; Wilder, P.J.; Desler, M.; Rizzino, A. Elevating SOX2 levels deleteriously affects the growth of medulloblastoma and glioblastoma cells. PLoS ONE 2012, 7, e44087. [Google Scholar] [CrossRef] [Green Version]
- Wuebben, E.L.; Wilder, P.J.; Cox, J.L.; Grunkemeyer, J.A.; Caffrey, T.; Hollingsworth, M.A.; Rizzino, A. Sox2 functions as a molecular rheostat to control the growth, tumorigenicity and drug responses of pancreatic ductal adenocarcinoma cells. Oncotarget 2016, 7, 34890–34906. [Google Scholar] [CrossRef] [Green Version]
- Metz, E.P.; Wilder, P.J.; Dong, J.; Datta, K.; Rizzino, A. Elevating sox2 in prostate tumor cells upregulates expression of neuroendocrine genes, but does not reduce the inhibitory effects of enzalutamide. J. Cell. Physiol. 2019, 235, 3731–3740. [Google Scholar] [CrossRef] [PubMed]
- Metz, E.P.; Wuebben, E.L.; Wilder, P.J.; Cox, J.L.; Datta, K.; Coulter, D.; Rizzino, A. Tumor quiescence: Elevating Sox2 in diverse tumor cell types downregulates a broad spectrum of the cell cycle machinery and inhibits tumor growth. BMC Cancer 2020, 20, 941. [Google Scholar] [CrossRef] [PubMed]
- Weissmiller, A.M.; Wang, J.; Lorey, S.L.; Howard, G.C.; Martinez, E.; Liu, Q.; Tansey, W.P. Inhibition of MYC by the SMARCB1 Tumor Suppressor. Nat. Commun. 2019, 10, 2014. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. Star: Ultrafast universal RNA-seq aligner. Bioinformatics 2012, 29, 15–21. [Google Scholar] [CrossRef]
- Kovaka, S.; Zimin, A.V.; Pertea, G.M.; Razaghi, R.; Salzberg, S.L.; Pertea, M. Transcriptome assembly from long-read RNA-seq alignments with Stringtie2. Genome Biol. 2019, 20, 278. [Google Scholar] [CrossRef] [Green Version]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with deseq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [Green Version]
- Liao, Y.; Wang, J.; Jaehnig, E.J.; Shi, Z.; Zhang, B. Webgestalt 2019: Gene set analysis toolkit with revamped UIs and apis. Nucleic Acids Res. 2019, 47, W199–W205. [Google Scholar] [CrossRef] [Green Version]
- Kuleshov, M.V.; Jones, M.R.; Rouillard, A.D.; Fernandez, N.F.; Duan, Q.; Wang, Z.; Koplev, S.; Jenkins, S.L.; Jagodnik, K.M.; Lachmann, A.; et al. ENRICHR: A comprehensive gene set enrichment analysis web server 2016 update. Nucleic Acids Res. 2016, 44, W90–W97. [Google Scholar] [CrossRef] [Green Version]
- Thomas, L.R.; Wang, Q.; Grieb, B.C.; Phan, J.; Foshage, A.M.; Sun, Q.; Olejniczak, E.T.; Clark, T.; Dey, S.; Lorey, S.; et al. Interaction with WDR5 promotes target gene recognition and tumorigenesis by Myc. Mol. Cell 2015, 58, 440–452. [Google Scholar] [CrossRef] [Green Version]
- Langmead, B.; Salzberg, S.L. Fast gapped-read alignment with bowtie 2. Nat. Methods 2012, 9, 357–359. [Google Scholar] [CrossRef] [Green Version]
- Feng, J.; Liu, T.; Qin, B.; Zhang, Y.; Liu, X.S. Identifying chip-seq enrichment using MACS. Nat. Protoc. 2012, 7, 1728–1740. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stark, R.; Brown, G. DiffBind: Differential Binding Analysis of ChIP-Seq Peak Data. Available online: https://bioconductor.org/packages/release/bioc/vignettes/DiffBind/inst/doc/DiffBind.pdf (accessed on 9 November 2021).
- Homer. Available online: http://homer.ucsd.edu/homer/ (accessed on 9 November 2021).
- Nowling, T.K.; Johnson, L.R.; Wiebe, M.S.; Rizzino, A. Identification of the transactivation domain of the transcription factor SOX-2 and an associated co-activator. J. Biol. Chem. 2000, 275, 3810–3818. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mallanna, S.K.; Ormsbee, B.D.; Iacovino, M.; Gilmore, J.M.; Cox, J.L.; Kyba, M.; Washburn, M.P.; Rizzino, A. Proteomic analysis of Sox2-associated proteins during early stages of mouse embryonic stem cell differentiation identifies sox21 as a novel regulator of Stem Cell Fate. Stem Cells 2010, 28, 1715–1727. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ormsbee Golden, B.D.; Wuebben, E.L.; Rizzino, A. Sox2 expression is regulated by a negative feedback loop in embryonic stem cells that involves Akt signaling and FOXO1. PLoS ONE 2013, 8, e76345. [Google Scholar] [CrossRef] [Green Version]
- Roberts, T.C.; Hart, J.R.; Kaikkonen, M.U.; Weinberg, M.S.; Vogt, P.K.; Morris, K.V. Quantification of nascent transcription by bromouridine immunocapture nuclear run-on RT-qPCR. Nat. Protoc. 2015, 10, 1198–1211. [Google Scholar] [CrossRef] [Green Version]
- Liberzon, A.; Birger, C.; Thorvaldsdóttir, H.; Ghandi, M.; Mesirov, J.P.; Tamayo, P. The Molecular Signatures Database Hallmark Gene Set Collection. Cell Syst. 2015, 1, 417–425. [Google Scholar] [CrossRef] [Green Version]
- Lachmann, A.; Xu, H.; Krishnan, J.; Berger, S.I.; Mazloom, A.R.; Ma’ayan, A. Chea: Transcription factor regulation inferred from integrating genome-wide chip-X experiments. Bioinformatics 2010, 26, 2438–2444. [Google Scholar] [CrossRef]
- Blackwood, E.M.; Eisenman, R.N. Max: A helix-loop-helix zipper protein that forms a sequence-specific DNA-binding complex with Myc. Science 1991, 251, 1211–1217. [Google Scholar] [CrossRef]
- Amati, B.; Brooks, M.W.; Levy, N.; Littlewood, T.D.; Evan, G.I.; Land, H. Oncogenic activity of the c-myc protein requires dimerization with Max. Cell 1993, 72, 233–245. [Google Scholar] [CrossRef]
- Dang, C.V. Myc on the path to cancer. Cell 2012, 149, 22–35. [Google Scholar] [CrossRef] [Green Version]
- Popay, T.M.; Wang, J.; Adams, C.M.; Codreanu, S.G.; Sherrod, S.; McClean, J.A.; Thomas, L.R.; Lorey, S.L.; Machida, Y.J.; Weissmiller, A.M.; et al. Myc regulates ribosome biogenesis and mitochondrial gene expression programs through interaction with host cell factor-1. eLife 2021, 10, e60191. [Google Scholar] [CrossRef] [PubMed]
- Thomas, L.R.; Adams, C.M.; Wang, J.; Weissmiller, A.M.; Creighton, J.; Lorey, S.L.; Liu, Q.; Fesik, S.W.; Eischen, C.M.; Tansey, W.P. Interaction of the oncoprotein transcription factor MYC with its chromatin cofactor WDR5 is essential for tumor maintenance. Proc. Natl. Acad. Sci. USA 2019, 116, 25260–25268. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Soucek, L.; Helmer-Citterich, M.; Sacco, A.; Jucker, R.; Cesareni, G.; Nasi, S. Design and properties of a MYC derivative that efficiently homodimerizes. Oncogene 1998, 17, 2463–2472. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Littlewood, T.D.; Hancock, D.C.; Danielian, P.S.; Parker, M.G.; Evan, G.I. A modified oestrogen receptor ligand-binding domain as an improved switch for the regulation of heterologous proteins. Nucleic Acids Res. 1995, 23, 1686–1690. [Google Scholar] [CrossRef] [Green Version]
- He, T.C.; Sparks, A.B.; Rago, C.; Hermeking, H.; Zawel, L.; da Costa, L.T.; Morin, P.J.; Vogelstein, B.; Kinzler, K.W. Identification of c-MYC as a target of the APC pathway. Science 1998, 281, 1509–1512. [Google Scholar] [CrossRef]
- Liu, Z.; Walters, B.J.; Owen, T.; Brimble, M.A.; Steigelman, K.A.; Zhang, L.; Mellado Lagarde, M.M.; Valentine, M.B.; Yu, Y.; Cox, B.C.; et al. Regulation of p27kip1 by Sox2 maintains quiescence of inner pillar cells in the murine auditory sensory epithelium. J. Neurosci. 2012, 32, 10530–10540. [Google Scholar] [CrossRef] [Green Version]
- Mu, P.; Zhang, Z.; Benelli, M.; Karthaus, W.R.; Hoover, E.; Chen, C.C.; Wongvipat, J.; Ku, S.Y.; Gao, D.; Cao, Z.; et al. SOX2 promotes lineage plasticity and antiandrogen resistance in TP53- and RB1-deficient prostate cancer. Science 2017, 355, 84–88. [Google Scholar] [CrossRef] [Green Version]
- Ku, S.Y.; Rosario, S.; Wang, Y.; Mu, P.; Seshadri, M.; Goodrich, Z.W.; Goodrich, M.M.; Labbé, D.P.; Gomez, E.C.; Wang, J.; et al. Rb1 and Trp53 cooperate to suppress cancer lineage plasticity, metastasis, and antiandrogen resistance. Science 2017, 355, 78–83. [Google Scholar] [CrossRef] [Green Version]
- Kregel, S.; Kiriluk, K.J.; Rosen, A.M.; Cai, Y.; Reyes, E.E.; Otto, K.B.; Tom, W.; Paner, G.P.; Szmulewitz, R.Z.; Vander Griend, D.J. Sox2 is an androgen receptor-repressed gene that promotes castration-resistant prostate cancer. PLoS ONE 2013, 8, e53701. [Google Scholar]
- Ray, S.; Chaturvedi, N.K.; Bhakat, K.K.; Rizzino, A.; Mahapatra, S. Subgroup-Specific Diagnostic, Prognostic, and Predictive Markers Influencing Pediatric Medulloblastoma Treatment. Diagnostics 2021, 12, 61. [Google Scholar] [CrossRef]
- Selvadurai, H.J.; Luis, E.; Desai, K.; Lan, X.; Vladoiu, M.C.; Whitley, O.; Galvin, C.; Vanner, R.J.; Lee, L.; Whetstone, H.; et al. Medullo-blastoma Arises from the Persistence of a Rare and Transient Sox2+ Granule Neuron Precursor. Cell Rep. 2020, 31, 10751. [Google Scholar] [CrossRef] [PubMed]
- Gene Expression Omnibus (GEO; GSE190936). Available online: https://0-www-ncbi-nlm-nih-gov.brum.beds.ac.uk/geo/query/acc.cgi?acc=GSE190936 (accessed on 8 December 2021).
- Gene Expression Omnibus (GEO; GSE186834). Available online: https://0-www-ncbi-nlm-nih-gov.brum.beds.ac.uk/geo/query/acc.cgi?acc=GSE186834 (accessed on 9 November 2021).
Name | Forward Primer Sequence 5′-3′ | Reverse Primer Sequence 5′-3′ |
---|---|---|
GAPDH | ACAGCGACACCCACTCCTCC | GAGGTCCACCACCCTGTTGC |
MYC-1 | GGCTCCTGGCAAAAGGTCA | CTGCGTAGTTGTGCTGATGT |
MYC-2 | GTCAAGAGGCGAACACACAAC | TTGGACGGACAGGATGTATGC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Metz, E.P.; Wilder, P.J.; Popay, T.M.; Wang, J.; Liu, Q.; Kalluchi, A.; Rowley, M.J.; Tansey, W.P.; Rizzino, A. Elevating SOX2 Downregulates MYC through a SOX2:MYC Signaling Axis and Induces a Slowly Cycling Proliferative State in Human Tumor Cells. Cancers 2022, 14, 1946. https://0-doi-org.brum.beds.ac.uk/10.3390/cancers14081946
Metz EP, Wilder PJ, Popay TM, Wang J, Liu Q, Kalluchi A, Rowley MJ, Tansey WP, Rizzino A. Elevating SOX2 Downregulates MYC through a SOX2:MYC Signaling Axis and Induces a Slowly Cycling Proliferative State in Human Tumor Cells. Cancers. 2022; 14(8):1946. https://0-doi-org.brum.beds.ac.uk/10.3390/cancers14081946
Chicago/Turabian StyleMetz, Ethan P., Phillip J. Wilder, Tessa M. Popay, Jing Wang, Qi Liu, Achyuth Kalluchi, M. Jordan Rowley, William P. Tansey, and Angie Rizzino. 2022. "Elevating SOX2 Downregulates MYC through a SOX2:MYC Signaling Axis and Induces a Slowly Cycling Proliferative State in Human Tumor Cells" Cancers 14, no. 8: 1946. https://0-doi-org.brum.beds.ac.uk/10.3390/cancers14081946