Arachidonic Acid Cascade and Eicosanoid Production Are Elevated While LTC4 Synthase Modulates the Lipidomics Profile in the Brain of the HIVgp120-Transgenic Mouse Model of NeuroHIV
Abstract
:1. Introduction
2. Materials and Methods
2.1. Mice
2.2. Quantitative Analysis of Eicosanoids in Mouse Brain Tissue via LCMS
2.3. qRT-PCR
2.4. Western Blot
2.5. Lipidomics
2.6. Statistical Analysis
3. Results
3.1. Quantitative Analysis of Mouse Brain Tissue via LC-MS/MS Shows an Increase in Eicosanoids in HIVgp120tg Mice, Particularly Products of the COX Pathway
3.2. Gene Expression Signatures of HIVgp120tg and LTC4S Knockout Mice Reveal Fundamental Sexual Dimorphism in Eicosanoid Pathway-Associated Genes
3.3. Western Blot Reveals Sexually Dimorphic Suppression of MAPK Signaling Pathway by Genetic Knockout of LTC4S
3.4. Shotgun Lipidomics of Both Cortical and Hippocampal Extracts of Female Mice Show Alterations in Lipid Populations Due to Both HIVgp120 Transgene and LTC4S Knockout
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- UN Joint Programme on HIV/AIDS (UNAIDS). UNAIDS Data 2020. Available online: https://www.unaids.org/en/resources/documents/2020/unaids-data (accessed on 17 May 2022).
- Centers for Disease Control and Prevention. HIV Surveillance Report. 2021. Available online: https://www.cdc.gov/hiv/library/reports/hiv-surveillance.html (accessed on 17 May 2022).
- Sacktor, N.; McDermott, M.P.; Marder, K.; Schifitto, G.; Selnes, O.A.; McArthur, J.C.; Stern, Y.; Albert, S.; Palumbo, D.; Kieburtz, K.; et al. HIV-associated cognitive impairment before and after the advent of combination therapy. J. Neurovirol. 2002, 8, 136–142. [Google Scholar] [CrossRef] [PubMed]
- Heaton, R.K.; Franklin, D.R.; Ellis, R.J.; McCutchan, J.A.; Letendre, S.L.; Leblanc, S.; Corkran, S.H.; Duarte, N.A.; Clifford, D.B.; Woods, S.P.; et al. HIV-associated neurocognitive disorders before and during the era of combination antiretroviral therapy: Differences in rates, nature, and predictors. J. Neurovirol. 2011, 17, 3–16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sacktor, N.; Saylor, D.; Nakigozi, G.; Nakasujja, N.; Robertson, K.; Grabowski, M.K.; Kisakye, A.; Batte, J.; Mayanja, R.; Anok, A.; et al. Effect of HIV Subtype and Antiretroviral Therapy on HIV-Associated Neurocognitive Disorder Stage in Rakai, Uganda. J. Acquir. Immune Defic. Syndr. 2019, 81, 216–223. [Google Scholar] [CrossRef] [PubMed]
- Cole, M.A.; Margolick, J.B.; Cox, C.; Li, X.; Selnes, O.A.; Martin, E.M.; Becker, J.T.; Aronow, H.A.; Cohen, B.; Sacktor, N.; et al. Longitudinally preserved psychomotor performance in long-term asymptomatic HIV-infected individuals. Neurology 2007, 69, 2213–2220. [Google Scholar] [CrossRef] [PubMed]
- Heaton, R.K.; Franklin, D.R., Jr.; Deutsch, R.; Letendre, S.; Ellis, R.J.; Casaletto, K.; Marquine, M.J.; Woods, S.P.; Vaida, F.; Atkinson, J.H.; et al. Neurocognitive change in the era of HIV combination antiretroviral therapy: The longitudinal CHARTER study. Clin. Infect. Dis. 2015, 60, 473–480. [Google Scholar] [CrossRef]
- Sacktor, N.; Skolasky, R.L.; Seaberg, E.; Munro, C.; Becker, J.T.; Martin, E.; Ragin, A.; Levine, A.; Miller, E. Prevalence of HIV-associated neurocognitive disorders in the Multicenter AIDS Cohort Study. Neurology 2016, 86, 334–340. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cole, J.H.; Underwood, J.; Caan, M.W.; De Francesco, D.; van Zoest, R.A.; Leech, R.; Wit, F.W.; Portegies, P.; Geurtsen, G.J.; Schmand, B.A.; et al. Increased brain-predicted aging in treated HIV disease. Neurology 2017, 88, 1349–1357. [Google Scholar] [CrossRef]
- Wendelken, L.A.; Valcour, V. Impact of HIV and aging on neuropsychological function. J. Neurovirol. 2012, 18, 256–263. [Google Scholar] [CrossRef] [Green Version]
- Valcour, V.G.; Shikuma, C.M.; Watters, M.R.; Sacktor, N.C. Cognitive impairment in older HIV-1-seropositive individuals: Prevalence and potential mechanisms. AIDS 2004, 18 (Suppl. S1), S79–S86. [Google Scholar] [CrossRef]
- Becker, J.T.; Lopez, O.L.; Dew, M.A.; Aizenstein, H.J. Prevalence of cognitive disorders differs as a function of age in HIV virus infection. AIDS 2004, 18 (Suppl. S1), S11–S18. [Google Scholar] [CrossRef]
- Wilkie, F.L.; Goodkin, K.; Khamis, I.; van Zuilen, M.H.; Lee, D.; Lecusay, R.; Concha, M.; Symes, S.; Suarez, P.; Eisdorfer, C. Cognitive functioning in younger and older HIV-1-infected adults. J. Acquir. Immune Defic. Syndr. 2003, 33 (Suppl. S2), S93–S105. [Google Scholar] [CrossRef] [PubMed]
- Seider, T.R.; Luo, X.; Gongvatana, A.; Devlin, K.N.; de la Monte, S.M.; Chasman, J.D.; Yan, P.; Tashima, K.T.; Navia, B.; Cohen, R.A. Verbal memory declines more rapidly with age in HIV infected versus uninfected adults. J. Clin. Exp. Neuropsychol. 2014, 36, 356–367. [Google Scholar] [CrossRef] [PubMed]
- Morgan, E.E.; Woods, S.P.; Smith, C.; Weber, E.; Scott, J.C.; Grant, I.; The HIV Neurobehavioral Research Program (HNRP) Group. Lower cognitive reserve among individuals with syndromic HIV-associated neurocognitive disorders (HAND). AIDS Behav. 2012, 16, 2279–2285. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Thames, A.D.; Kim, M.S.; Becker, B.W.; Foley, J.M.; Hines, L.J.; Singer, E.J.; Heaton, R.K.; Castellon, S.A.; Hinkin, C.H. Medication and finance management among HIV-infected adults: The impact of age and cognition. J. Clin. Exp. Neuropsychol. 2011, 33, 200–209. [Google Scholar] [CrossRef]
- Vance, D.E.; Fazeli, P.L.; Gakumo, C.A. The impact of neuropsychological performance on everyday functioning between older and younger adults with and without HIV. J. Assoc. Nurses AIDS Care 2013, 24, 112–125. [Google Scholar] [CrossRef] [Green Version]
- Adibhatla, R.M.; Hatcher, J.F. Role of Lipids in Brain Injury and Diseases. Future Lipidol. 2007, 2, 403–422. [Google Scholar] [CrossRef] [Green Version]
- Arshiya Shamim, T.M.; Ahsan, F.; Kumar, A.; Bagga, P. Lipids: An insight into the neurodegenerative disorders. Clin. Nutr. Exp. 2018, 20, 1–19. [Google Scholar] [CrossRef] [Green Version]
- Serhan, C.N.; Yacoubian, S.; Yang, R. Anti-inflammatory and proresolving lipid mediators. Annu. Rev. Pathol. 2008, 3, 279–312. [Google Scholar] [CrossRef] [Green Version]
- Wang, B.; Wu, L.; Chen, J.; Dong, L.; Chen, C.; Wen, Z.; Hu, J.; Fleming, I.; Wang, D.W. Metabolism pathways of arachidonic acids: Mechanisms and potential therapeutic targets. Signal. Transduct. Target. Ther. 2021, 6, 94. [Google Scholar] [CrossRef]
- Griffin, D.E.; Wesselingh, S.L.; McArthur, J.C. Elevated central nervous system prostaglandins in human immunodeficiency virus-associated dementia. Ann. Neurol. 1994, 35, 592–597. [Google Scholar] [CrossRef]
- Bertin, J.; Barat, C.; Methot, S.; Tremblay, M.J. Interactions between prostaglandins, leukotrienes and HIV-1: Possible implications for the central nervous system. Retrovirology 2012, 9, 4. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Genis, P.; Jett, M.; Bernton, E.W.; Boyle, T.; Gelbard, H.A.; Dzenko, K.; Keane, R.W.; Resnick, L.; Mizrachi, Y.; Volsky, D.J.; et al. Cytokines and arachidonic metabolites produced during human immunodeficiency virus (HIV)-infected macrophage-astroglia interactions: Implications for the neuropathogenesis of HIV disease. J. Exp. Med. 1992, 176, 1703–1718. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Alvarez, S.; Serramia, M.J.; Fresno, M.; Munoz-Fernandez, M. Human immunodeficiency virus type 1 envelope glycoprotein 120 induces cyclooxygenase-2 expression in neuroblastoma cells through a nuclear factor-kappaB and activating protein-1 mediated mechanism. J. NeuroChem. 2005, 94, 850–861. [Google Scholar] [CrossRef]
- Pereira, C.F.; Boven, L.A.; Middel, J.; Verhoef, J.; Nottet, H.S. Induction of cyclooxygenase-2 expression during HIV-1-infected monocyte-derived macrophage and human brain microvascular endothelial cell interactions. J. Leukoc. Biol. 2000, 68, 423–428. [Google Scholar] [PubMed]
- Corasaniti, M.T.; Rotiroti, D.; Nappi, G.; Bagetta, G. Neurobiological mediators of neuronal apoptosis in experimental neuroAIDS. Toxicol. Lett. 2003, 139, 199–206. [Google Scholar] [CrossRef]
- Bagetta, G.; Corasaniti, M.T.; Paoletti, A.M.; Berliocchi, L.; Nistico, R.; Giammarioli, A.M.; Malorni, W.; Finazzi-Agro, A. HIV-1 gp120-induced apoptosis in the rat neocortex involves enhanced expression of cyclo-oxygenase type 2 (COX-2). BioChem. Biophys. Res. Commun. 1998, 244, 819–824. [Google Scholar] [CrossRef]
- Maccarrone, M.; Bari, M.; Corasaniti, M.T.; Nistico, R.; Bagetta, G.; Finazzi-Agro, A. HIV-1 coat glycoprotein gp120 induces apoptosis in rat brain neocortex by deranging the arachidonate cascade in favor of prostanoids. J. Neurochem. 2000, 75, 196–203. [Google Scholar] [CrossRef] [Green Version]
- Samikkannu, T.; Agudelo, M.; Gandhi, N.; Reddy, P.V.; Saiyed, Z.M.; Nwankwo, D.; Nair, M.P. Human immunodeficiency virus type 1 clade B and C gp120 differentially induce neurotoxin arachidonic acid in human astrocytes: Implications for neuroAIDS. J. Neurovirol. 2011, 17, 230–238. [Google Scholar] [CrossRef] [Green Version]
- Wahl, L.M.; Corcoran, M.L.; Pyle, S.W.; Arthur, L.O.; Harel-Bellan, A.; Farrar, W.L. Human immunodeficiency virus glycoprotein (gp120) induction of monocyte arachidonic acid metabolites and interleukin 1. Proc. Natl. Acad. Sci. USA 1989, 86, 621–625. [Google Scholar] [CrossRef] [Green Version]
- Basselin, M.; Ramadan, E.; Igarashi, M.; Chang, L.; Chen, M.; Kraft, A.D.; Harry, G.J.; Rapoport, S.I. Imaging upregulated brain arachidonic acid metabolism in HIV-1 transgenic rats. J. Cereb. Blood Flow Metab. 2011, 31, 486–493. [Google Scholar] [CrossRef] [Green Version]
- Rao, J.S.; Kim, H.W.; Kellom, M.; Greenstein, D.; Chen, M.; Kraft, A.D.; Harry, G.J.; Rapoport, S.I.; Basselin, M. Increased neuroinflammatory and arachidonic acid cascade markers, and reduced synaptic proteins, in brain of HIV-1 transgenic rats. J. Neuroinflamm. 2011, 8, 101. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dreyer, E.B.; Lipton, S.A. The coat protein gp120 of HIV-1 inhibits astrocyte uptake of excitatory amino acids via macrophage arachidonic acid. Eur. J. Neurosci. 1995, 7, 2502–2507. [Google Scholar] [CrossRef] [PubMed]
- Froldi, M.; Castagna, A.; Parma, M.; Piona, A.; Tedeschi, A.; Miadonna, A.; Lorini, M.; Orazio, E.N.; Lazzarin, A. Mediator release in cerebrospinal fluid of human immunodeficiency virus-positive patients with central nervous system involvement. J. Neuroimmunol. 1992, 38, 155–161. [Google Scholar] [CrossRef]
- Cassol, E.; Misra, V.; Holman, A.; Kamat, A.; Morgello, S.; Gabuzda, D. Plasma metabolomics identifies lipid abnormalities linked to markers of inflammation, microbial translocation, and hepatic function in HIV patients receiving protease inhibitors. BMC Infect. Dis. 2013, 13, 203. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Albright, A.V.; Gonzalez-Scarano, F. Microarray analysis of activated mixed glial (microglia) and monocyte-derived macrophage gene expression. J. Neuroimmunol. 2004, 157, 27–38. [Google Scholar] [CrossRef]
- Maung, R.; Hoefer, M.M.; Sanchez, A.B.; Sejbuk, N.E.; Medders, K.E.; Desai, M.K.; Catalan, I.C.; Dowling, C.C.; de Rozieres, C.M.; Garden, G.A.; et al. CCR5 knockout prevents neuronal injury and behavioral impairment induced in a transgenic mouse model by a CXCR4-using HIV-1 glycoprotein 120. J. Immunol. 2014, 193, 1895–1910. [Google Scholar] [CrossRef]
- Toggas, S.M.; Masliah, E.; Rockenstein, E.M.; Rall, G.F.; Abraham, C.R.; Mucke, L. Central nervous system damage produced by expression of the HIV-1 coat protein gp120 in transgenic mice. Nature 1994, 367, 188–193. [Google Scholar] [CrossRef]
- Valentin, A.; Trivedi, H.; Lu, W.; Kostrikis, L.G.; Pavlakis, G.N. CXCR4 mediates entry and productive infection of syncytia-inducing (X4) HIV-1 strains in primary macrophages. Virology 2000, 269, 294–304. [Google Scholar] [CrossRef] [Green Version]
- Thaney, V.E.; Sanchez, A.B.; Fields, J.A.; Minassian, A.; Young, J.W.; Maung, R.; Kaul, M. Transgenic mice expressing HIV-1 envelope protein gp120 in the brain as an animal model in neuroAIDS research. J. Neurovirol. 2018, 24, 156–167. [Google Scholar] [CrossRef]
- Kanaoka, Y.; Maekawa, A.; Penrose, J.F.; Austen, K.F.; Lam, B.K. Attenuated zymosan-induced peritoneal vascular permeability and IgE-dependent passive cutaneous anaphylaxis in mice lacking leukotriene C4 synthase. J. Biol. Chem. 2001, 276, 22608–22613. [Google Scholar] [CrossRef] [Green Version]
- Kennedy, P.; Dorow, S.; Bickel, J.; Domanski, P.; Pisano, M.; Soulika, A. Immunoaffinity Mass Spectrometry for Leukotriene Analysis in Brain. Cayman Chemical. 2016. Available online: https://cdn2.caymanchem.com/cdn/cms/caymanchem/LiteratureCMS/800164.pdf (accessed on 17 May 2022).
- Singh, H.; Ojeda-Juarez, D.; Maung, R.; Shah, R.; Roberts, A.J.; Kaul, M. A pivotal role for Interferon-alpha receptor-1 in neuronal injury induced by HIV-1. J. Neuroinflamm. 2020, 17, 226. [Google Scholar] [CrossRef] [PubMed]
- Ojeda-Juarez, D.; Shah, R.; Fields, J.A.; Harahap-Carrillo, I.S.; Koury, J.; Maung, R.; Gelman, B.B.; Baaten, B.J.; Roberts, A.J.; Kaul, M. Lipocalin-2 mediates HIV-1 induced neuronal injury and behavioral deficits by overriding CCR5-dependent protection. Brain Behav. Immun. 2020, 89, 184–199. [Google Scholar] [CrossRef] [PubMed]
- Palavicini, J.P.; Wang, C.; Chen, L.; Hosang, K.; Wang, J.; Tomiyama, T.; Mori, H.; Han, X. Oligomeric amyloid-beta induces MAPK-mediated activation of brain cytosolic and calcium-independent phospholipase A2 in a spatial-specific manner. Acta Neuropathol. Commun. 2017, 5, 56. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cheng, H.; Guan, S.; Han, X. Abundance of triacylglycerols in ganglia and their depletion in diabetic mice: Implications for the role of altered triacylglycerols in diabetic neuropathy. J. Neurochem. 2006, 97, 1288–1300. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cheng, H.; Jiang, X.; Han, X. Alterations in lipid homeostasis of mouse dorsal root ganglia induced by apolipoprotein E deficiency: A shotgun lipidomics study. J. Neurochem. 2007, 101, 57–76. [Google Scholar] [CrossRef] [Green Version]
- Han, X.; Yang, K.; Gross, R.W. Microfluidics-based electrospray ionization enhances the intrasource separation of lipid classes and extends identification of individual molecular species through multi-dimensional mass spectrometry: Development of an automated high-throughput platform for shotgun lipidomics. Rapid Commun. Mass Spectrom. 2008, 22, 2115–2124. [Google Scholar]
- Yang, K.; Cheng, H.; Gross, R.W.; Han, X. Automated lipid identification and quantification by multidimensional mass spectrometry-based shotgun lipidomics. Anal. Chem. 2009, 81, 4356–4368. [Google Scholar] [CrossRef] [Green Version]
- Kaul, M.; Lipton, S.A. Chemokines and activated macrophages in HIV gp120-induced neuronal apoptosis. Proc. Natl. Acad. Sci. USA 1999, 96, 8212–8216. [Google Scholar] [CrossRef] [Green Version]
- Kaul, M.; Ma, Q.; Medders, K.E.; Desai, M.K.; Lipton, S.A. HIV-1 coreceptors CCR5 and CXCR4 both mediate neuronal cell death but CCR5 paradoxically can also contribute to protection. Cell Death Differ. 2007, 14, 296–305. [Google Scholar] [CrossRef] [Green Version]
- Medders, K.E.; Sejbuk, N.E.; Maung, R.; Desai, M.K.; Kaul, M. Activation of p38 MAPK is required in monocytic and neuronal cells for HIV glycoprotein 120-induced neurotoxicity. J. Immunol. 2010, 185, 4883–4895. [Google Scholar] [CrossRef] [Green Version]
- Saylor, D.; Dickens, A.M.; Sacktor, N.; Haughey, N.; Slusher, B.; Pletnikov, M.; Mankowski, J.L.; Brown, A.; Volsky, D.J.; McArthur, J.C. HIV-associated neurocognitive disorder—Pathogenesis and prospects for treatment. Nat. Rev. Neurol. 2016, 12, 309. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Norris, P.C.; Gosselin, D.; Reichart, D.; Glass, C.K.; Dennis, E.A. Phospholipase A2 regulates eicosanoid class switching during inflammasome activation. Proc. Natl. Acad. Sci. USA 2014, 111, 12746–12751. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Harris, S.G.; Padilla, J.; Koumas, L.; Ray, D.; Phipps, R.P. Prostaglandins as modulators of immunity. Trends Immunol. 2002, 23, 144–150. [Google Scholar] [CrossRef]
- Harizi, H.; Corcuff, J.B.; Gualde, N. Arachidonic-acid-derived eicosanoids: Roles in biology and immunopathology. Trends Mol. Med. 2008, 14, 461–469. [Google Scholar] [CrossRef]
- Dennis, E.A.; Norris, P.C. Eicosanoid storm in infection and inflammation. Nat. Rev. Immunol. 2015, 15, 511–523. [Google Scholar] [CrossRef] [Green Version]
- Aoki, T.; Narumiya, S. Prostaglandins and chronic inflammation. Trends Pharm. Sci. 2012, 33, 304–311. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chiurchiu, V.; Leuti, A.; Maccarrone, M. Bioactive Lipids and Chronic Inflammation: Managing the Fire within. Front. Immunol. 2018, 9, 38. [Google Scholar] [CrossRef] [Green Version]
- Akiyama, H.; Barger, S.; Barnum, S.; Bradt, B.; Bauer, J.; Cole, G.M.; Cooper, N.R.; Eikelenboom, P.; Emmerling, M.; Fiebich, B.L.; et al. Inflammation and Alzheimer’s disease. Neurobiol. Aging 2000, 21, 383–421. [Google Scholar] [CrossRef]
- Cunningham, C.; Skelly, D.T. Non-steroidal anti-inflammatory drugs and cognitive function: Are prostaglandins at the heart of cognitive impairment in dementia and delirium? J. Neuroimmune Pharm. 2012, 7, 60–73. [Google Scholar] [CrossRef] [Green Version]
- He, C.; Wu, Y.; Lai, Y.; Cai, Z.; Liu, Y.; Lai, L. Dynamic eicosanoid responses upon different inhibitor and combination treatments on the arachidonic acid metabolic network. Mol. Biosyst. 2012, 8, 1585–1594. [Google Scholar] [CrossRef]
- Rao, C.V.; Janakiram, N.B.; Mohammed, A. Lipoxygenase and Cyclooxygenase Pathways and Colorectal Cancer Prevention. Curr. Colorectal Cancer Rep. 2012, 8, 316–324. [Google Scholar] [CrossRef] [Green Version]
- Manju, S.L.; Ethiraj, K.R.; mElias, G. Safer anti-inflammatory therapy through dual COX-2/5-LOX inhibitors: A structure-based approach. Eur. J. Pharm. Sci. 2018, 121, 356–381. [Google Scholar] [CrossRef]
- Zhang, J.; Li, Z.; Fan, M.; Jin, W. Lipoxins in the Nervous System: Brighter Prospects for Neuroprotection. Front. Pharm. 2022, 13, 781889. [Google Scholar] [CrossRef] [PubMed]
- Serhan, C.N. Novel lipid mediators and resolution mechanisms in acute inflammation: To resolve or not? Am. J. Pathol. 2010, 177, 1576–1591. [Google Scholar] [CrossRef]
- Ben-Zvi, A.; Lacoste, B.; Kur, E.; Andreone, B.J.; Mayshar, Y.; Yan, H.; Gu, C. Mfsd2a is critical for the formation and function of the blood-brain barrier. Nature 2014, 509, 507–511. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nguyen, L.N.; Ma, D.; Shui, G.; Wong, P.; Cazenave-Gassiot, A.; Zhang, X.; Wenk, M.R.; Goh, E.L.; Silver, D.L. Mfsd2a is a transporter for the essential omega-3 fatty acid docosahexaenoic acid. Nature 2014, 509, 503–506. [Google Scholar] [CrossRef]
- Chan, J.P.; Wong, B.H.; Chiin, C.F.; Galam, D.L.A.; Foo, J.C.; Wong, L.C.; Ghosh, S.; Wenk, M.R.; Cazenave-Gassiot, A.; Silver, D.L. The lysolipid transporter Mfsd2a regulates lipogenesis in the developing brain. PLoS Biol. 2018, 16, e2006443. [Google Scholar] [CrossRef]
- Farooqui, A.A. Beneficial Effects of Fish Oil on Human Brain; Springer: London, UK, 2009; pp. 396p. [Google Scholar] [CrossRef]
- Ishihara, T.; Yoshida, M.; Arita, M. Omega-3 fatty acid-derived mediators that control inflammation and tissue homeostasis. Int. Immunol. 2019, 31, 559–567. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bazan, N.G. Neuroprotectin D1 (NPD1): A DHA-derived mediator that protects brain and retina against cell injury-induced oxidative stress. Brain Pathol. 2005, 15, 159–166. [Google Scholar] [CrossRef]
- Chamani, S.; Bianconi, V.; Tasbandi, A.; Pirro, M.; Barreto, G.E.; Jamialahmadi, T.; Sahebkar, A. Resolution of Inflammation in Neurodegenerative Diseases: The Role of Resolvins. Mediat. Inflamm. 2020, 2020, 3267172. [Google Scholar] [CrossRef]
- Lin, L.L.; Wartmann, M.; Lin, A.Y.; Knopf, J.L.; Seth, A.; Davis, R.J. cPLA2 is phosphorylated and activated by MAP kinase. Cell 1993, 72, 269–278. [Google Scholar] [CrossRef]
- Gijon, M.A.; Spencer, D.M.; Siddiqi, A.R.; Bonventre, J.V.; Leslie, C.C. Cytosolic phospholipase A2 is required for macrophage arachidonic acid release by agonists that Do and Do not mobilize calcium. Novel role of mitogen-activated protein kinase pathways in cytosolic phospholipase A2 regulation. J. Biol. Chem. 2000, 275, 20146–20156. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Han, X. Lipidomics: Comprehensive Mass Spectrometry of Lipids; Wiley: Hoboken, NJ, USA, 2016; pp. 1–459, (online resource). [Google Scholar]
- Klein, J. Membrane breakdown in acute and chronic neurodegeneration: Focus on choline-containing phospholipids. J. Neural. Transm. 2000, 107, 1027–1063. [Google Scholar] [CrossRef]
- Nitsch, R.M.; Blusztajn, J.K.; Pittas, A.G.; Slack, B.E.; Growdon, J.H.; Wurtman, R.J. Evidence for a membrane defect in Alzheimer disease brain. Proc. Natl. Acad. Sci. USA 1992, 89, 1671–1675. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, X.; Liu, W.; Zan, J.; Wu, C.; Tan, W. Untargeted lipidomics reveals progression of early Alzheimer’s disease in APP/PS1 transgenic mice. Sci. Rep. 2020, 10, 14509. [Google Scholar] [CrossRef]
- Tanguy, E.; Wang, Q.; Moine, H.; Vitale, N. Phosphatidic Acid: From Pleiotropic Functions to Neuronal Pathology. Front. Cell Neurosci. 2019, 13, 2. [Google Scholar] [CrossRef] [Green Version]
- Raben, D.M.; Barber, C.N. Phosphatidic acid and neurotransmission. Adv. Biol. Regul. 2017, 63, 15–21. [Google Scholar] [CrossRef] [Green Version]
- Han, X.; Holtzman, D.M.; McKeel, D.W., Jr.; Kelley, J.; Morris, J.C. Substantial sulfatide deficiency and ceramide elevation in very early Alzheimer’s disease: Potential role in disease pathogenesis. J. Neurochem. 2002, 82, 809–818. [Google Scholar] [CrossRef]
- Hsiao, J.H.; Fu, Y.; Hill, A.F.; Halliday, G.M.; Kim, W.S. Elevation in sphingomyelin synthase activity is associated with increases in amyloid-beta peptide generation. PLoS ONE 2013, 8, e74016. [Google Scholar] [CrossRef] [Green Version]
- He, X.; Huang, Y.; Li, B.; Gong, C.X.; Schuchman, E.H. Deregulation of sphingolipid metabolism in Alzheimer’s disease. Neurobiol. Aging 2010, 31, 398–408. [Google Scholar] [CrossRef] [Green Version]
- Alessenko, A.V.; Albi, E. Exploring Sphingolipid Implications in Neurodegeneration. Front. Neurol. 2020, 11, 437. [Google Scholar] [CrossRef] [PubMed]
- Albi, E.; Alessenko, A.V. Nuclear sphingomyelin in neurodegenerative diseases. Neural. Regen. Res. 2021, 16, 2028–2029. [Google Scholar] [CrossRef] [PubMed]
- Soreghan, B.; Thomas, S.N.; Yang, A.J. Aberrant sphingomyelin/ceramide metabolic-induced neuronal endosomal/lysosomal dysfunction: Potential pathological consequences in age-related neurodegeneration. Adv. Drug Deliv. Rev. 2003, 55, 1515–1524. [Google Scholar] [CrossRef]
- Castillo, R.I.; Rojo, L.E.; Henriquez-Henriquez, M.; Silva, H.; Maturana, A.; Villar, M.J.; Fuentes, M.; Gaspar, P.A. From Molecules to the Clinic: Linking Schizophrenia and Metabolic Syndrome through Sphingolipids Metabolism. Front. Neurosci. 2016, 10, 488. [Google Scholar] [CrossRef]
- Haughey, N.J.; Zhu, X.; Bandaru, V.V. A biological perspective of CSF lipids as surrogate markers for cognitive status in HIV. J. Neuroimmune Pharmacol. 2013, 8, 1136–1146. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Alaamery, M.; Albesher, N.; Aljawini, N.; Alsuwailm, M.; Massadeh, S.; Wheeler, M.A.; Chao, C.C.; Quintana, F.J. Role of sphingolipid metabolism in neurodegeneration. J. Neurochem. 2021, 158, 25–35. [Google Scholar] [CrossRef]
- Haughey, N.J.; Cutler, R.G.; Tamara, A.; McArthur, J.C.; Vargas, D.L.; Pardo, C.A.; Turchan, J.; Nath, A.; Mattson, M.P. Perturbation of sphingolipid metabolism and ceramide production in HIV-dementia. Ann. Neurol. 2004, 55, 257–267. [Google Scholar] [CrossRef]
- Mielke, M.M.; Bandaru, V.V.; McArthur, J.C.; Chu, M.; Haughey, N.J. Disturbance in cerebral spinal fluid sphingolipid content is associated with memory impairment in subjects infected with the human immunodeficiency virus. J. Neurovirol. 2010, 16, 445–456. [Google Scholar] [CrossRef]
- Bandaru, V.V.; Mielke, M.M.; Sacktor, N.; McArthur, J.C.; Grant, I.; Letendre, S.; Chang, L.; Wojna, V.; Pardo, C.; Calabresi, P.; et al. A lipid storage-like disorder contributes to cognitive decline in HIV-infected subjects. Neurology 2013, 81, 1492–1499. [Google Scholar] [CrossRef] [Green Version]
- Bandaru, V.V.; McArthur, J.C.; Sacktor, N.; Cutler, R.G.; Knapp, E.L.; Mattson, M.P.; Haughey, N.J. Associative and predictive biomarkers of dementia in HIV-1-infected patients. Neurology 2007, 68, 1481–1487. [Google Scholar] [CrossRef] [Green Version]
- Lauritzen, L.; Hansen, H.S.; Jorgensen, M.H.; Michaelsen, K.F. The essentiality of long chain n-3 fatty acids in relation to development and function of the brain and retina. Prog. Lipid Res. 2001, 40, 1–94. [Google Scholar] [CrossRef]
- Richard, C.; Calder, P.C. Docosahexaenoic Acid. Adv. Nutr. 2016, 7, 1139–1141. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Satouchi, K.; Sakaguchi, M.; Shirakawa, M.; Hirano, K.; Tanaka, T. Lysophosphatidylcholine from white muscle of bonito Euthynnus pelamis (Linnaeus): Involvement of phospholipase A1 activity for its production. Biochim. Biophys. Acta 1994, 1214, 303–308. [Google Scholar] [PubMed]
- Medina, I.; Aubourg, S.P.; Perez Martin, R. Composition of phospholipids of white muscle of six tuna species. Lipids 1995, 30, 1127–1135. [Google Scholar] [CrossRef]
- Granafei, S.; Losito, I.; Palmisano, F.; Cataldi, T.R. Identification of isobaric lyso-phosphatidylcholines in lipid extracts of gilthead sea bream (Sparus aurata) fillets by hydrophilic interaction liquid chromatography coupled to high-resolution Fourier-transform mass spectrometry. Anal. Bioanal. Chem. 2015, 407, 6391–6404. [Google Scholar] [CrossRef] [PubMed]
- Semba, R.D. Perspective: The Potential Role of Circulating Lysophosphatidylcholine in Neuroprotection against Alzheimer Disease. Adv. Nutr. 2020, 11, 760–772. [Google Scholar] [CrossRef]
- Bogie, J.F.J.; Haidar, M.; Kooij, G.; Hendriks, J.J.A. Fatty acid metabolism in the progression and resolution of CNS disorders. Adv. Drug Deliv. Rev. 2020, 159, 198–213. [Google Scholar] [CrossRef]
- Ghosh, A.; Chen, F.; Thakur, A.; Hong, H. Cysteinyl Leukotrienes and Their Receptors: Emerging Therapeutic Targets in Central Nervous System Disorders. CNS Neurosci. Ther. 2016, 22, 943–951. [Google Scholar] [CrossRef]
- Martel-Pelletier, J.; Lajeunesse, D.; Reboul, P.; Pelletier, J.P. Therapeutic role of dual inhibitors of 5-LOX and COX, selective and non-selective non-steroidal anti-inflammatory drugs. Ann. Rheum. Dis. 2003, 62, 501–509. [Google Scholar] [CrossRef]
- Yang, K.; Ma, W.; Liang, H.; Ouyang, Q.; Tang, C.; Lai, L. Dynamic simulations on the arachidonic acid metabolic network. PLoS Comput. Biol. 2007, 3, e55. [Google Scholar] [CrossRef] [Green Version]
- Pace, S.; Sautebin, L.; Werz, O. Sex-biased eicosanoid biology: Impact for sex differences in inflammation and consequences for pharmacotherapy. Biochem. Pharmacol. 2017, 145, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Rossi, A.; Roviezzo, F.; Sorrentino, R.; Riemma, M.A.; Cerqua, I.; Bilancia, R.; Spaziano, G.; Troisi, F.; Pace, S.; Pinto, A.; et al. Leukotriene-mediated sex dimorphism in murine asthma-like features during allergen sensitization. Pharmacol. Res. 2019, 139, 182–190. [Google Scholar] [CrossRef] [PubMed]
- Pace, S.; Rossi, A.; Krauth, V.; Dehm, F.; Troisi, F.; Bilancia, R.; Weinigel, C.; Rummler, S.; Werz, O.; Sautebin, L. Sex differences in prostaglandin biosynthesis in neutrophils during acute inflammation. Sci. Rep. 2017, 7, 3759. [Google Scholar] [CrossRef] [PubMed]
- Wei, J.; Hou, J.; Su, B.; Jiang, T.; Guo, C.; Wang, W.; Zhang, Y.; Chang, B.; Wu, H.; Zhang, T. The Prevalence of Frascati-Criteria-Based HIV-Associated Neurocognitive Disorder (HAND) in HIV-Infected Adults: A Systematic Review and Meta-Analysis. Front. Neurol. 2020, 11, 581346. [Google Scholar] [CrossRef]
- Maki, P.M.; Rubin, L.H.; Springer, G.; Seaberg, E.C.; Sacktor, N.; Miller, E.N.; Valcour, V.; Young, M.A.; Becker, J.T.; Martin, E.M.; et al. Differences in Cognitive Function Between Women and Men With HIV. J. Acquir. Immune Defic. Syndr. 2018, 79, 101–107. [Google Scholar] [CrossRef]
- Maki, P.M.; Martin-Thormeyer, E. HIV, cognition and women. Neuropsychol. Rev. 2009, 19, 204–214. [Google Scholar] [CrossRef] [Green Version]
- Failde-Garrido, J.M.; Alvarez, M.R.; Simon-Lopez, M.A. Neuropsychological impairment and gender differences in HIV-1 infection. Psychiatry Clin. Neurosci. 2008, 62, 494–502. [Google Scholar] [CrossRef]
- Rubin, L.H.; Springer, G.; Martin, E.M.; Seaberg, E.C.; Sacktor, N.C.; Levine, A.; Valcour, V.G.; Young, M.A.; Becker, J.T.; Maki, P.M. Elevated Depressive Symptoms Are a Stronger Predictor of Executive Dysfunction in HIV-Infected Women Than in Men. J. Acquir. Immune Defic. Syndr. 2019, 81, 274–283. [Google Scholar] [CrossRef]
Gene | Gen Bank | Primer Sequence (5′-3′) |
---|---|---|
mLtc4s | NM_008521.2 | Fwd: TCG TGG GAG TTC TGT TGC AA Rev: GAA AGC CCT TCG TGC AGA GA |
mCysltr1 | NM_021476.5 | Fwd: GGA AGG CTG ATT TCT CAT GG Rev: GGA ACT GAA AAT CTG ACG ACA TC |
mcPla2 | NM_008869.4 | Fwd: CTG CAA GGC CGA GTG ACA Rev: TTC GCC CAC TTC TCT GCA A |
mPtgs2 | NM_011198.4 | Fwd: GGC GCA GTT TAT GTT GTC TGT Rev: CAA GAC AGA TCA TAA GCG AGG A |
mTau | NM_001038609.3 | Fwd: TGA GGG ACT AGG GCA GCT AA Rev: CTG CCT TCC TCA CCT CTG TC |
mMfsd2a | NM_029662.2 | Fwd: TTG CTA TGC AGT TGG AGG GG Rev: CGC ACG CCT AGG ATC AGA AT |
mGAPDH | NM_001289726.1 | Fwd: AGGTCGGTGTGAACGGATTTG Rev: TGTAGACCATGTAGTTGAGGTCA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yuan, N.Y.; Maung, R.; Xu, Z.; Han, X.; Kaul, M. Arachidonic Acid Cascade and Eicosanoid Production Are Elevated While LTC4 Synthase Modulates the Lipidomics Profile in the Brain of the HIVgp120-Transgenic Mouse Model of NeuroHIV. Cells 2022, 11, 2123. https://0-doi-org.brum.beds.ac.uk/10.3390/cells11132123
Yuan NY, Maung R, Xu Z, Han X, Kaul M. Arachidonic Acid Cascade and Eicosanoid Production Are Elevated While LTC4 Synthase Modulates the Lipidomics Profile in the Brain of the HIVgp120-Transgenic Mouse Model of NeuroHIV. Cells. 2022; 11(13):2123. https://0-doi-org.brum.beds.ac.uk/10.3390/cells11132123
Chicago/Turabian StyleYuan, Nina Y., Ricky Maung, Ziying Xu, Xianlin Han, and Marcus Kaul. 2022. "Arachidonic Acid Cascade and Eicosanoid Production Are Elevated While LTC4 Synthase Modulates the Lipidomics Profile in the Brain of the HIVgp120-Transgenic Mouse Model of NeuroHIV" Cells 11, no. 13: 2123. https://0-doi-org.brum.beds.ac.uk/10.3390/cells11132123