Expanding the miRNA Repertoire in Atlantic Salmon; Discovery of IsomiRs and miRNAs Highly Expressed in Different Tissues and Developmental Stages
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Small RNA Extraction
2.3. Library Preparation and Small-RNA Sequencing
2.4. Pre-Processing and Quality Assesment of Small-RNA Sequence Reads
2.5. Identification of Atlantic Salmon miRNA Precursors, Their Mature miRNAs and miRNA Gene Locations
2.6. Annotation of Clustered miRNA Genes
2.7. Sequence Errors Arising in the Sequencing Pipeline and IsomiR Detection
2.8. Examinating the Biological Effect on Target Gene Specificity from IsomiR Variation
2.9. Identification of Tissue Enriched miRNAs
2.10. RT-qPCR Analysis of Tissue Enriched miRNAs
3. Results
3.1. Small RNA Sequencing and Identification of Atlantic Salmon miRNAs
3.1.1. Generation of RNA Libraries and Results from Small RNA Sequencing
3.1.2. Results from Discovery and Characterization of Atlantic Salmon miRNAs
3.2. Characterization of IsomiRs and Polymorphics miRNAs in Atlantic Salmon
3.2.1. Sequence Errors Arising in the Sequencing Pipeline
3.2.2. IsomiR Characterization
3.2.3. Polymorphic Mature miRNAs
3.3. Characterization of miRNA Expression Profiles in Different Tissues and Developmental Stages
3.3.1. Housekeeping miRNAs vs. miRNAs Predominantly Expressed in Particular Tissues
3.3.2. Expression Patterns of miRNAs at Development Specific Stages
4. Discussion
4.1. Small RNA Sequencing and Identification of Atlantic Salmon miRNAs
4.2. Characterization of IsomiRs and Polymorphics miRNAs in Atlantic Salmon
4.3. Characterization of miRNA Expression Profiles in Different Tissues and Developmental Stages
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Bartel, D.P. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell 2004, 116, 281–297. [Google Scholar] [CrossRef]
- Ha, M.; Kim, V.N. Regulation of microRNA biogenesis. Nat. Rev. Mol. Cell Biol. 2014, 15, 509–524. [Google Scholar] [CrossRef]
- Friedlander, M.R.; Chen, W.; Adamidi, C.; Maaskola, J.; Einspanier, R.; Knespel, S.; Rajewsky, N. Discovering microRNAs from deep sequencing data using miRDeep. Nat. Biotechnol. 2008, 26, 407–415. [Google Scholar] [CrossRef]
- Friedlander, M.R.; Mackowiak, S.D.; Li, N.; Chen, W.; Rajewsky, N. miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades. Nucleic Acids Res. 2012, 40, 37–52. [Google Scholar] [CrossRef]
- Bushati, N.; Cohen, S.M. microRNA functions. Annu. Rev. Cell Dev. Biol. 2007, 23, 175–205. [Google Scholar] [CrossRef]
- Lynam-Lennon, N.; Maher, S.G.; Reynolds, J.V. The roles of microRNA in cancer and apoptosis. Biol. Rev. 2009, 84, 55–71. [Google Scholar] [CrossRef]
- Forster, S.C.; Tate, M.D.; Hertzog, P.J. MicroRNA as Type I Interferon-Regulated Transcripts and Modulators of the Innate Immune Response. Front. Immunol. 2015, 6, 334. [Google Scholar] [CrossRef]
- Sonkoly, E.; Stahle, M.; Pivarcsi, A. MicroRNAs and immunity: Novel players in the regulation of normal immune function and inflammation. Semin. Cancer Biol. 2008, 18, 131–140. [Google Scholar] [CrossRef]
- Andreassen, R.; Worren, M.M.; Hoyheim, B. Discovery and characterization of miRNA genes in Atlantic salmon (Salmo salar) by use of a deep sequencing approach. BMC Genom. 2013, 14, 482. [Google Scholar] [CrossRef]
- Bekaert, M.; Lowe, N.R.; Bishop, S.C.; Bron, J.E.; Taggart, J.B.; Houston, R.D. Sequencing and characterisation of an extensive Atlantic salmon (Salmo salar L.) microRNA repertoire. PLoS ONE 2013, 8, e70136. [Google Scholar] [CrossRef]
- Andreassen, R.; Woldemariam, N.T.; Egeland, I.O.; Agafonov, O.; Sindre, H.; Hoyheim, B. Identification of differentially expressed Atlantic salmon miRNAs responding to salmonid alphavirus (SAV) infection. BMC Genom. 2017, 18, 349. [Google Scholar] [CrossRef]
- Johansen, I.; Andreassen, R. Validation of miRNA genes suitable as reference genes in qPCR analyses of miRNA gene expression in Atlantic salmon (Salmo salar). BMC Res. Notes 2014, 8, 945. [Google Scholar] [CrossRef]
- Valenzuela-Munoz, V.; Novoa, B.; Figueras, A.; Gallardo-Escarate, C. Modulation of Atlantic salmon miRNome response to sea louse infestation. Dev. Comp. Immunol. 2017, 76, 380–391. [Google Scholar] [CrossRef]
- Skaftnesmo, K.O.; Edvardsen, R.B.; Furmanek, T.; Crespo, D.; Andersson, E.; Kleppe, L.; Taranger, G.L.; Bogerd, J.; Schulz, R.W.; Wargelius, A. Integrative testis transcriptome analysis reveals differentially expressed miRNAs and their mRNA targets during early puberty in Atlantic salmon. BMC Genom. 2017, 18, 801. [Google Scholar] [CrossRef]
- Ebhardt, H.A.; Tsang, H.H.; Dai, D.C.; Liu, Y.; Bostan, B.; Fahlman, R.P. Meta-analysis of small RNA-sequencing errors reveals ubiquitous post-transcriptional RNA modifications. Nucleic Acids Res. 2009, 37, 2461–2470. [Google Scholar] [CrossRef]
- Lee, L.W.; Zhang, S.; Etheridge, A.; Ma, L.; Martin, D.; Galas, D.; Wang, K. Complexity of the microRNA repertoire revealed by next-generation sequencing. RNA 2010, 16, 2170–2180. [Google Scholar] [CrossRef] [Green Version]
- Guo, L.; Chen, F. A challenge for miRNA: Multiple isomiRs in miRNAomics. Gene 2014, 544, 1–7. [Google Scholar] [CrossRef]
- Cloonan, N.; Wani, S.; Xu, Q.; Gu, J.; Lea, K.; Heater, S.; Barbacioru, C.; Steptoe, A.L.; Martin, H.C.; Nourbakhsh, E.; et al. MicroRNAs and their isomiRs function cooperatively to target common biological pathways. Genome Biol. 2011, 12, R126. [Google Scholar] [CrossRef] [Green Version]
- Neilsen, C.T.; Goodall, G.J.; Bracken, C.P. IsomiRs-the overlooked repertoire in the dynamic microRNAome. Trends. Genet. 2012, 28, 544–549. [Google Scholar] [CrossRef]
- Lin, W.; Piskol, R.; Tan, M.H.; Li, J.B. Comment on “Widespread RNA and DNA sequence differences in the human transcriptome”. Science 2012, 335, 1302, author reply 1302. [Google Scholar] [CrossRef]
- Robasky, K.; Lewis, N.E.; Church, G.M. The role of replicates for error mitigation in next-generation sequencing. Nat. Rev. Genet. 2014, 15, 56–62. [Google Scholar] [CrossRef]
- Lien, S.; Koop, B.F.; Sandve, S.R.; Miller, J.R.; Kent, M.P.; Nome, T.; Hvidsten, T.R.; Leong, J.S.; Minkley, D.R.; Zimin, A.; et al. The Atlantic salmon genome provides insights into rediploidization. Nature 2016, 533, 200–205. [Google Scholar] [CrossRef] [Green Version]
- Robledo, D.; Taggart, J.B.; Ireland, J.H.; McAndrew, B.J.; Starkey, W.G.; Haley, C.S.; Hamilton, A.; Guy, D.R.; Mota-Velasco, J.C.; Gheyas, A.A.; et al. Gene expression comparison of resistant and susceptible Atlantic salmon fry challenged with Infectious Pancreatic Necrosis virus reveals a marked contrast in immune response. BMC Genom. 2016, 17, 279. [Google Scholar] [CrossRef]
- Andrews, S.; Krueger, F.; Seconds-Pichon, A.; Biggins, F.; Wingett, S. FastQC: A Quality Control Tool for High Throughput Sequence Data; Babraham Institute: Cambridge, UK, 2012. [Google Scholar]
- Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet. J. 2011, 17, 10–12. [Google Scholar] [CrossRef]
- Kozomara, A.; Griffiths-Jones, S. miRBase: Annotating high confidence microRNAs using deep sequencing data. Nucleic Acids Res. 2014, 42, D68–D73. [Google Scholar] [CrossRef]
- Ambros, V.; Bartel, B.; Bartel, D.P.; Burge, C.B.; Carrington, J.C.; Chen, X.; Dreyfuss, G.; Eddy, S.R.; Griffiths-Jones, S.; Marshall, M.; et al. A Uniform System for microRNA Annotation. RNA 2003, 9, 277–279. [Google Scholar] [CrossRef]
- Griffiths-Jones, S.; Grocock, R.J.; van Dongen, S.; Bateman, A.; Enright, A.J. miRBase: MicroRNA sequences, targets and gene nomenclature. Nucleic Acids Res. 2006, 34, D140–D144. [Google Scholar] [CrossRef]
- Kalvari, I.; Argasinska, J.; Quinones-Olvera, N.; Nawrocki, E.P.; Rivas, E.; Eddy, S.R.; Bateman, A.; Finn, R.D.; Petrov, A.I. Rfam 13.0: Shifting to a genome-centric resource for non-coding RNA families. Nucleic Acids Res. 2018, 46, D335–D342. [Google Scholar] [CrossRef]
- Mituyama, T.; Yamada, K.; Hattori, E.; Okida, H.; Ono, Y.; Terai, G.; Yoshizawa, A.; Komori, T.; Asai, K. The Functional RNA Database 3.0: Databases to support mining and annotation of functional RNAs. Nucleic Acids Res. 2009, 37, D89–D92. [Google Scholar] [CrossRef]
- Sanger, F.; Air, G.M.; Barrell, B.G.; Brown, N.L.; Coulson, A.R.; Fiddes, J.C.; Hutchison Iii, C.A.; Slocombe, P.M.; Smith, M. Nucleotide sequence of bacteriophage φX174 DNA. Nature 1977, 265, 687. [Google Scholar] [CrossRef]
- Manley, L.J.; Ma, D.; Levine, S.S. Monitoring Error Rates In Illumina Sequencing. J. Biomol. Tech. 2016, 27, 125–128. [Google Scholar] [CrossRef]
- Urgese, G.; Paciello, G.; Acquaviva, A.; Ficarra, E. isomiR-SEA: An RNA-Seq analysis tool for miRNAs/isomiRs expression level profiling and miRNA-mRNA interaction sites evaluation. BMC Bioinform. 2016, 17, 148. [Google Scholar] [CrossRef]
- Schmittgen, T.D.; Lee, E.J.; Jiang, J.; Sarkar, A.; Yang, L.; Elton, T.S.; Chen, C. Real-time PCR quantification of precursor and mature microRNA. Methods 2008, 44, 31–38. [Google Scholar] [CrossRef] [Green Version]
- Rehmsmeier, M.; Steffen, P.; Hochsmann, M.; Giegerich, R. Fast and effective prediction of microRNA/target duplexes. RNA 2004, 10, 1507–1517. [Google Scholar] [CrossRef] [Green Version]
- Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 2013, 29, 15–21. [Google Scholar] [CrossRef]
- Stokowy, T.; Eszlinger, M.; Swierniak, M.; Fujarewicz, K.; Jarzab, B.; Paschke, R.; Krohn, K. Analysis options for high-throughput sequencing in miRNA expression profiling. BMC Res. Notes 2014, 7, 144. [Google Scholar] [CrossRef]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
- Andreassen, R.; Rangnes, F.; Sivertsen, M.; Chiang, M.; Tran, M.; Worren, M.M. Discovery of miRNAs and their corresponding miRNA genes in Atlantic Cod (Gadus morhua): Use of stable miRNAs as reference genes reveals subgroups of miRNAs that are highly expressed in particular organs. PLoS ONE 2016, 11, e0153324. [Google Scholar] [CrossRef]
- Chen, P.Y.; Manninga, H.; Slanchev, K.; Chien, M.; Russo, J.J.; Ju, J.; Sheridan, R.; John, B.; Marks, D.S.; Gaidatzis, D.; et al. The developmental miRNA profiles of zebrafish as determined by small RNA cloning. Genes Dev. 2005, 19, 1288–1293. [Google Scholar] [CrossRef] [Green Version]
- Li, S.C.; Chan, W.C.; Ho, M.R.; Tsai, K.W.; Hu, L.Y.; Lai, C.H.; Hsu, C.N.; Hwang, P.P.; Lin, W.C. Discovery and characterization of medaka miRNA genes by next generation sequencing platform. BMC Genom. 2010, 11 (Suppl. S4), S8. [Google Scholar] [CrossRef] [Green Version]
- Baskerville, S.; Bartel, D.P. Microarray profiling of microRNAs reveals frequent coexpression with neighboring miRNAs and host genes. RNA 2005, 11, 241–247. [Google Scholar] [CrossRef]
- Giraldez, A.J.; Cinalli, R.M.; Glasner, M.E.; Enright, A.J.; Thomson, J.M.; Baskerville, S.; Hammond, S.M.; Bartel, D.P.; Schier, A.F. MicroRNAs regulate brain morphogenesis in zebrafish. Science 2005, 308, 833–838. [Google Scholar] [CrossRef]
- Sokol, N.S. The role of microRNAs in muscle development. Curr. Top. Dev. Biol. 2012, 99, 59–78. [Google Scholar] [CrossRef]
- Kozomara, A.; Griffiths-Jones, S. miRBase: Integrating microRNA annotation and deep-sequencing data. Nucleic Acids Res. 2011, 39, D152–D157. [Google Scholar] [CrossRef]
- Berthelot, C.; Brunet, F.; Chalopin, D.; Juanchich, A.; Bernard, M.; Noël, B.; Bento, P.; Da Silva, C.; Labadie, K.; Alberti, A.; et al. The rainbow trout genome provides novel insights into evolution after whole-genome duplication in vertebrates. Nat. Commun. 2014, 5, 3657. [Google Scholar] [CrossRef]
- Song, J.B.; Song, J.; Mo, B.X.; Chen, X.M. Uridylation and adenylation of RNAs. Sci. China Life Sci. 2015, 58, 1057–1066. [Google Scholar] [CrossRef] [Green Version]
- Wyman, S.K.; Knouf, E.C.; Parkin, R.K.; Fritz, B.R.; Lin, D.W.; Dennis, L.M.; Krouse, M.A.; Webster, P.J.; Tewari, M. Post-transcriptional generation of miRNA variants by multiple nucleotidyl transferases contributes to miRNA transcriptome complexity. Genome Res. 2011, 21, 1450–1461. [Google Scholar] [CrossRef] [Green Version]
- Giraldez, A.J.; Mishima, Y.; Rihel, J.; Grocock, R.J.; Van Dongen, S.; Inoue, K.; Enright, A.J.; Schier, A.F. Zebrafish MiR-430 promotes deadenylation and clearance of maternal mRNAs. Science 2006, 312, 75–79. [Google Scholar] [CrossRef]
- Giusti, J.; Pinhal, D.; Moxon, S.; Campos, C.L.; Münsterberg, A.; Martins, C. MicroRNA-10 modulates Hox genes expression during Nile tilapia embryonic development. Mech. Dev. 2016, 140, 12–18. [Google Scholar] [CrossRef]
- Mennigen, J.A.; Martyniuk, C.J.; Seiliez, I.; Panserat, S.; Skiba-Cassy, S. Metabolic consequences of microRNA-122 inhibition in rainbow trout, Oncorhynchus mykiss. BMC Genom. 2014, 15, 70. [Google Scholar] [CrossRef]
- Mennigen, J.A.; Plagnes-Juan, E.; Figueredo-Silva, C.A.; Seiliez, I.; Panserat, S.; Skiba-Cassy, S. Acute endocrine and nutritional co-regulation of the hepatic omy-miRNA-122b and the lipogenic gene fas in rainbow trout, Oncorhynchus mykiss. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2014, 169, 16–24. [Google Scholar] [CrossRef] [PubMed]
- Radhakrishnan, B.; Alwin Prem Anand, A. Role of miRNA-9 in Brain Development. J. Exp. Neurosci. 2016, 10, 101–120. [Google Scholar] [CrossRef] [PubMed]
- Ludwig, N.; Leidinger, P.; Becker, K.; Backes, C.; Fehlmann, T.; Pallasch, C.; Rheinheimer, S.; Meder, B.; Stahler, C.; Meese, E.; et al. Distribution of miRNA expression across human tissues. Nucleic Acids Res. 2016, 44, 3865–3877. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Luo, G.Z.; Hafner, M.; Shi, Z.; Brown, M.; Feng, G.H.; Tuschl, T.; Wang, X.J.; Li, X. Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression. BMC Genom. 2012, 13, 727. [Google Scholar] [CrossRef] [PubMed]
- Fernandez-Valverde, S.L.; Taft, R.J.; Mattick, J.S. Dynamic isomiR regulation in Drosophila development. RNA 2010, 16, 1881–1888. [Google Scholar] [CrossRef] [Green Version]
- Schamberger, A.; Orban, T.I. 3’ IsomiR species and DNA contamination influence reliable quantification of microRNAs by stem-loop quantitative PCR. PLoS ONE 2014, 9, e106315. [Google Scholar] [CrossRef] [PubMed]
- Bizuayehu, T.T.; Babiak, I. MicroRNA in teleost fish. Genome Biol. Evol. 2014, 6, 1911–1937. [Google Scholar] [CrossRef]
- Lagos-Quintana, M.; Rauhut, R.; Yalcin, A.; Meyer, J.; Lendeckel, W.; Tuschl, T. Identification of tissue-specific microRNAs from mouse. Curr. Biol. 2002, 12, 735–739. [Google Scholar] [CrossRef]
- Herkenhoff, M.E.; Oliveira, A.C.; Nachtigall, P.G.; Costa, J.M.; Campos, V.F.; Hilsdorf, A.W.S.; Pinhal, D. Fishing into the MicroRNA transcriptome. Front. Genet. 2018, 9, 88. [Google Scholar] [CrossRef] [PubMed]
- Juanchich, A.; Bardou, P.; Rue, O.; Gabillard, J.C.; Gaspin, C.; Bobe, J.; Guiguen, Y. Characterization of an extensive rainbow trout miRNA transcriptome by next generation sequencing. BMC Genom. 2016, 17, 164. [Google Scholar] [CrossRef]
- Trattner, S.; Vestergren, A.S. Tissue distribution of selected microRNA in Atlantic salmon. Eur. J. Lipid Sci. Tech. 2013, 115, 1348–1356. [Google Scholar] [CrossRef]
- Xia, J.H.; He, X.P.; Bai, Z.Y.; Yue, G.H. Identification and characterization of 63 MicroRNAs in the Asian seabass Lates calcarifer. PLoS ONE 2011, 6, e17537. [Google Scholar] [CrossRef] [PubMed]
- Mitchelson, K.R.; Qin, W.Y. Roles of the canonical myomiRs miR-1, -133 and -206 in cell development and disease. World J. Biol. Chem. 2015, 6, 162–208. [Google Scholar] [CrossRef] [PubMed]
- Wu, G.; Huang, Z.P.; Wang, D.Z. MicroRNAs in cardiac regeneration and cardiovascular disease. Sci. China Life Sci. 2013, 56, 907–913. [Google Scholar] [CrossRef] [PubMed]
- Alberti, C.; Cochella, L. A framework for understanding the roles of miRNAs in animal development. Development 2017, 144, 2548–2559. [Google Scholar] [CrossRef] [Green Version]
- Rosa, A.; Brivanlou, A.H. MicroRNAs in early vertebrate development. Cell Cycle 2009, 8, 3513–3520. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Takacs, C.M.; Giraldez, A.J. miR-430 regulates oriented cell division during neural tube development in zebrafish. Dev. Biol. 2016, 409, 442–450. [Google Scholar] [CrossRef] [Green Version]
- Wienholds, E.; Kloosterman, W.P.; Miska, E.; Alvarez-Saavedra, E.; Berezikov, E.; de Bruijn, E.; Horvitz, H.R.; Kauppinen, S.; Plasterk, R.H. MicroRNA expression in zebrafish embryonic development. Science 2005, 309, 310–311. [Google Scholar] [CrossRef]
- Tehler, D.; Hoyland-Kroghsbo, N.M.; Lund, A.H. The miR-10 microRNA precursor family. RNA Biol. 2011, 8, 728–734. [Google Scholar] [CrossRef] [Green Version]
miRNA ID 1 | Mature-5p (5´-3´) 2 | Mature-3p (5´-3´) 2 | Precursor Sequence (5´-3´) |
---|---|---|---|
ssa-mir-novel-1 | UCAGUGAUGUGUACGCCAAAGGU | UCGGCAUACACAUCACUGACA | UCAGUGAUGUGUACGCCAAAGGUGUAAAGCUUCAAGUUCCUCGGCAUACACAUCACUGACA |
ssa-mir-novel-2 | AGUUUCCCGGACACAGAUUAAGCC | UUUUGUCUGUCUGGGAAACCGG | AGUUUCCCGGACACAGAUUAAGCCUAGUCAUAAUUAUUAUGUUUUGUCUGUCUGGGAAACCGG |
ssa-mir-novel-3 | UGACGAUACCUUUGGAACAAGA | UUGUACCAAUAGUAAAGUCUGA | UGACGAUACCUUUGGAACAAGAGGUGAAUUACGUCUUAUGCUCUUGUACCAAUAGUAAAGUCUGA |
ssa-mir-novel-4 | CGGAUCGCUGCGUUCACCAUU | AUGGUGAAUGCAACGAUAAGGC | CGGAUCGCUGCGUUCACCAUUAUAUUUAACUUCAACAGAAUGGUGAAUGCAACGAUAAGGC |
ssa-mir-novel-5 | UACGGUAUGUACUGUAGGCUAC | UAGGCUACGGUAUGUACUGAAG | UACGGUAUGUACUGUAGGCUACGGUAUGUUAUGUACUGUAGGCUACGGUAUGUACUGAAG |
ssa-mir-novel-6 | UGAGCCUUGUCCUGGACUAAGA | UCAGUCCAUGACUAGGCUUAAC | UGAGCCUUGUCCUGGACUAAGAAGUACUUCCAAUGGCUAUUUUCAGUCCAUGACUAGGCUUAAC |
ssa-mir-novel-7 | UUGCUGGUGACACUGUCUGUGA | AAGGCACACUUCACCAGUAUGG | UUGCUGGUGACACUGUCUGUGAUUUAUUUAGAAUUCAAGGCACACUUCACCAGUAUGG |
ssa-mir-novel-8 | AGACACCUGACACAGCCCCCAUU | UGGGUCUGUGUCUAUUGUCUCU | AGACACCUGACACAGCCCCCAUUCUAUCUCAUAAAAGUGGGUCUGUGUCUAUUGUCUCU |
ssa-mir-novel-9 | UAGGCGUGUCACUGCGUGUCACA | UGCGCACGGGGCCACGCUCUGC | UAGGCGUGUCACUGCGUGUCACAGUCACUGCUUGCGCACGGGGCCACGCUCUGC |
ssa-mir-novel-10 | AGGUCUGUUUGUGCUGUCUUCC | GUGACUGCACAAACGGAUCUGG | AGGUCUGUUUGUGCUGUCUUCCAUGGCUUUGGUGACUGCACAAACGGAUCUGG |
ssa-mir-novel-11 | AUUGUUCAGGGCAUUCAUUUCU | UAAGUGAACCCUUGAGACAAUU | AUUGUUCAGGGCAUUCAUUUCUUGUGAACCAAUCAAUAAGUGAACCCUUGAGACAAUU |
ssa-mir-novel-12 | UUCGCCCCUGAGGACACACGGU | CCGAAUCCACAGAAGUGAUGC | UUCGCCCCUGAGGACACACGGUGUUUUCUUUUAAUAGCACCGAAUCCACAGAAGUGAUGC |
ssa-mir-novel-13 | CCUUGACCACGUAACCUGACCA | UUAGGUCAGAUGUGGUCAGGAGA | CCUUGACCACGUAACCUGACCAUAGUUUUCUUGGUUAGGUCAGAUGUGGUCAGGAGA |
ssa-mir-novel-14 | GGGAAUAUACAUGACUGUGAUU | UCACAGUCGUGUAUAUUCCCUC | GGGAAUAUACAUGACUGUGAUUAUGAUUGAAGAGAAUAAUCACAGUCGUGUAUAUUCCCUC |
ssa-mir-novel-15 | CAGAGCUCUGCUAUCUGCUGUCU | AAGGAGAAAACAGAGCUCUGCU | CAGAGCUCUGCUAUCUGCUGUCUGUAUCUUGUUAAAGGGGAAGGAGAAAACAGAGCUCUGCU |
ssa-mir-novel-16 | UUGCUGUUGACACUGUCUGUG | UCAAGGCACACUUAACCAGCAUGG | UUGCUGUUGACACUGUCUGUGAUUUAUUUAAGGCACACUUCAAGGCACACUUAACCAGCAUGG |
ssa-mir-novel-17 | GCGUCUCAGAGGUCAAACACAGU | UGUGUUAGGCCUCCGAGUCUGA | GCGUCUCAGAGGUCAAACACAGUAAGUCAUAUUAAGCUGUGUUAGGCCUCCGAGUCUGA |
miRNA | Reference Sequence 1 | Variant Sequence 2 |
---|---|---|
ssa-miR-16a-1-3p | CCAGTATTGTTCGTGCTGCTGA | CCAGTATTGCTCGTGCTGCTGA |
ssa-miR-100a-2-3p | ACAAGCTTGTGTCTATAGGTATG | ACAAGCTCGTGTCTATAGGTATG |
ssa-miR-2188-3p | GCTGTGTGAGGTCAGACCTATC | GCTGTGTGAGGTCGGACCTATC |
ssa-miR-29b-1-5p | ACTGATTTCTTCTGGTGTTTAGA | ACTGATTTCCTCTGGTGTTTAGA |
ssa-let-7a-2-3p | CTATACAACTTACTGTCTTTCC | CTATACAACATACTGTCTTTCC |
miRNA | Tissue 1 | ΔΔCT 2 | Enrichment 3 |
---|---|---|---|
ssa-miR-9a-5p 4 | B | −11.13 | 2241 |
ssa-miR-9b-3p | B | −10.21 | 1184 |
ssa-miR-96-5p | B | −5.18 | 36 |
ssa-miR-129-5p | B | −3.56 | 12 |
ssa-miR-132-5p | B | −7.46 | 176 |
ssa-miR-135c-5p | B | −7.05 | 133 |
ssa-miR-153a-3p | B | −10.08 | 1082 |
ssa-miR-212ab-3p | B | −7.29 | 156 |
ssa-miR-219a-3p | B | −7.66 | 202 |
ssa-miR-723-5p | B | −6.83 | 114 |
ssa-miR-734a-3p | B | −4.68 | 26 |
ssa-miR-122-5p4 | L | −12.3 | 5043 |
ssa-miR-8163-3p | L | −8.6 | 388 |
ssa-miR-192a-5p 4 | L | −7.96 | 249 |
ssa-miR-499a-5p 4 | H | −9.7 | 832 |
ssa-miR-736-3p | H | −14.7 | 26616 |
ssa-miR-192a-5p 4 | I | −11.9 | 3822 |
ssa-miR-459-5p | I | −12.9 | 7643 |
ssa-miR-194b-5p | I | −10.8 | 1783 |
ssa-miR-140-3p | G | −3.7 | 13 |
Gills | Muscle | Intestine | Brain | Heart | Kidney | Liver |
---|---|---|---|---|---|---|
ssa-miR-140-3p | ssa-miR-133-1/2-3p | ssa-miR-192a-5p | ssa-miR-128-3p | ssa-miR-133-1/2-3p | ssa-miR-192a-5p | ssa-miR-122-5p |
ssa-miR-203a/b-3p | ssa-miR-26d-5p | ssa-miR-194a/b-5p | ssa-miR-129-5p | ssa-miR-499a/b-5p | ssa-miR-192a-5p | |
ssa-miR-459-5p | ssa-miR-132-5p | ssa-miR-736-3p | ssa-miR-8163-3p | |||
ssa-miR-135c-5p | ||||||
ssa-miR-153a/b-3p | ||||||
ssa-miR-182-5p | ||||||
ssa-miR-183-5p | ||||||
ssa-miR-212ab-3p | ||||||
ssa-miR-219a-3p | ||||||
ssa-miR-723-5p | ||||||
ssa-miR-734a-3p | ||||||
ssa-miR-92b-3p | ||||||
ssa-miR-96-5p | ||||||
ssa-miR-9a-5p | ||||||
ssa-miR-9b-3p |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Woldemariam, N.T.; Agafonov, O.; Høyheim, B.; Houston, R.D.; Taggart, J.B.; Andreassen, R. Expanding the miRNA Repertoire in Atlantic Salmon; Discovery of IsomiRs and miRNAs Highly Expressed in Different Tissues and Developmental Stages. Cells 2019, 8, 42. https://0-doi-org.brum.beds.ac.uk/10.3390/cells8010042
Woldemariam NT, Agafonov O, Høyheim B, Houston RD, Taggart JB, Andreassen R. Expanding the miRNA Repertoire in Atlantic Salmon; Discovery of IsomiRs and miRNAs Highly Expressed in Different Tissues and Developmental Stages. Cells. 2019; 8(1):42. https://0-doi-org.brum.beds.ac.uk/10.3390/cells8010042
Chicago/Turabian StyleWoldemariam, Nardos Tesfaye, Oleg Agafonov, Bjørn Høyheim, Ross D. Houston, John B. Taggart, and Rune Andreassen. 2019. "Expanding the miRNA Repertoire in Atlantic Salmon; Discovery of IsomiRs and miRNAs Highly Expressed in Different Tissues and Developmental Stages" Cells 8, no. 1: 42. https://0-doi-org.brum.beds.ac.uk/10.3390/cells8010042