(–)-Catechin-7-O-β-d-Apiofuranoside Inhibits Hepatic Stellate Cell Activation by Suppressing the STAT3 Signaling Pathway
Abstract
:1. Introduction
2. Materials and Methods
2.1. General Experimental Procedures
2.2. Plant Materials
2.3. Extract and Isolation
2.4. Cell Lines and Culture
2.5. Animal Experiment
2.6. Liver Histology and Blood Analysis
2.7. Hydroxyproline Measurement
2.8. Cell Viability Assay
2.9. Comparative Quantitative Real-Time PCR (qPCR)
2.10. Western Blot Analysis
2.11. Preparation of Nuclear Extracts
2.12. Immunocytochemistry
2.13. Statistical Analysis
3. Results
3.1. EtOH Extract of U. davidiana var. japonica and Its EtOAc-Soluble Fraction Suppress Collagen Synthesis in Activated HSCs
3.2. Chemical Investigation of the EtOAc Fraction Led to the Isolation of Four Catechins
3.3. C7A Inhibits the Fibrotic Effects in HSC Activation
3.4. C7A Suppresses Fibrotic Response Through Regulating the STAT3 Signaling Pathway
3.5. C7A Attenuated TAA-Induced Chronic Liver Fibrosis
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Hui, A.Y.; Friedman, S.L. Molecular basis of hepatic fibrosis. Expert Rev. Mol. Med. 2003, 5, 1–23. [Google Scholar] [CrossRef]
- Geerts, A. History, heterogeneity, developmental biology, and functions of quiescent hepatic stellate cells. Semin. Liver Dis. 2001, 21, 311–335. [Google Scholar] [CrossRef] [PubMed]
- Bataller, R.; Brenner, D.A. Liver fibrosis. J. Clin. Investig. 2005, 115, 209–218. [Google Scholar] [CrossRef] [PubMed]
- Friedman, S.L. Mechanisms of hepatic fibrogenesis. Gastroenterology 2008, 134, 1655–1669. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Friedman, S.L. Hepatic stellate cells: Protean, multifunctional, and enigmatic cells of the liver. Physiol. Rev. 2008, 88, 125–172. [Google Scholar] [CrossRef]
- Rojkind, M.; Giambrone, M.A.; Biempica, L. Collagen types in normal and cirrhotic liver. Gastroenterology 1979, 76, 710–719. [Google Scholar]
- Bataller, R.; Brenner, D.A. Hepatic stellate cells as a target for the treatment of liver fibrosis. Semin. Liver Dis. 2001, 21, 437–451. [Google Scholar] [CrossRef]
- Li, D.; Friedman, S.L. Liver fibrogenesis and the role of hepatic stellate cells: New insights and prospects for therapy. J. Gastroenterol. Hepatol. 1999, 14, 618–633. [Google Scholar] [CrossRef]
- Schuppan, D.; Popov, Y. Hepatic fibrosis: From bench to bedside. J. Gastroenterol. Hepatol. 2002, 17, S300–S305. [Google Scholar] [CrossRef]
- Parola, M.; Marra, F. Adipokines and redox signaling: Impact on fatty liver disease. Antioxid. Redox Signal. 2011, 5, 461–483. [Google Scholar] [CrossRef] [Green Version]
- Su, T.H.; Shiau, C.W.; Jao, P.; Liu, C.H.; Liu, C.J.; Tai, W.T.; Jeng, Y.M.; Yang, H.C.; Tseng, T.C.; Huang, H.P.; et al. Sorafenib and its derivative SC-1 exhibit antifibrotic effects through signal transducer and activator of transcription 3 inhibition. Proc. Natl. Acad. Sci. USA 2015, 112, 7243–7248. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, H.; Lafdil, F.; Kong, X.; Gao, B. Signal transducer and activator of transcription 3 in liver diseases: A novel therapeutic target. Int. J. Biol. Sci. 2011, 7, 536–550. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jiang, J.X.; Mikami, K.; Venugopal, S.; Li, Y.; Torok, N.J. Apoptotic body engulfment by hepatic stellate cells promotes their survival by the JAK/STAT and Akt/NF-ĸB-dependent pathways. J. Hepatol. 2009, 51, 139–148. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nunez Lopez, O.N.; Bohanon, F.J.; Wang, X.; Ye, N.; Corsello, T.; Rojas-Khalil, Y.; Chen, H.; Chen, H.; Zhou, J.; Radhakrishnan, R.S. STAT3 inhibition suppresses hepatic stellate cell fibrogenesis: HJC0123, a potential therapeutic agent for liver fibrosis. RSC Adv. 2016, 6, 100652–100663. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, Z.; Li, J.; Xiao, W.; Long, J.; Zhang, H. The STAT3 inhibitor S31-201 suppresses fibrogenesis and angiogenesis in liver fibrosis. Lab. Investig. 2018, 98, 1600–1613. [Google Scholar] [CrossRef]
- Gressner, A.M.; Weiskirchen, R.; Breitkopf, K.; Dooley, S. Roles of TGF-β in hepatic fibrosis. Front Biosci. 2002, 7, d793–d807. [Google Scholar] [CrossRef]
- Tang, L.Y.; Heller, M.; Meng, Z.; Yu, L.R.; Tang, Y.; Zhou, M.; Zhang, Y.E. Transforming growth factor-β (TGF-β) directly activates the JAK1-STAT3 axis to induce hepatic fibrosis in coordination with the SMAD pathway. J. Biol. Chem. 2017, 292, 4302–4312. [Google Scholar] [CrossRef] [Green Version]
- So, H.M.; Eom, H.J.; Lee, D.; Kim, S.; Kang, K.S.; Lee, I.K.; Baek, K.H.; Park, J.Y.; Kim, K.H. Bioactivity evaluations of betulin identified from the bark of Betula platyphylla var. japonica for cancer therapy. Arch. Pharmacal Res. 2018, 41, 815–822. [Google Scholar] [CrossRef]
- Yu, J.S.; Roh, H.S.; Baek, K.H.; Lee, S.; Kim, S.; So, H.M.; Moon, E.; Pang, C.; Jang, T.S.; Kim, K.H. Bioactivity-guided isolation of ginsenosides from Korean Red Ginseng with cytotoxic activity against human lung adenocarcinoma cells. J. Ginseng Res. 2018, 42, 562–570. [Google Scholar] [CrossRef]
- Baek, S.C.; Choi, E.; Eom, H.J.; Jo, M.S.; Kim, S.; So, H.M.; Kim, S.H.; Kang, K.S.; Kim, K.H. LC/MS-based analysis of bioactive compounds from the bark of Betula platyphylla var. japonica and their effects on regulation of adipocyte and osteoblast differentiation. Nat. Prod. Sci. 2018, 24, 235–240. [Google Scholar]
- Lee, S.; Lee, S.; Roh, H.S.; Song, S.S.; Ryoo, R.; Pang, C.; Baek, K.H.; Kim, K.H. Cytotoxic constituents from the sclerotia of Poria cocos against human lung adenocarcinoma cells by inducing mitochondrial apoptosis. Cells 2018, 7, 116. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, S.R.; Song, J.H.; Song, J.H.; Ko, H.J.; Baek, J.Y.; Trinh, T.A.; Beemelmanns, C.; Yamabe, N.; Kim, K.H. Chemical identification of isoflavonoids from a termite-associated Streptomyces sp. RB1 and their neuroprotective effects in murine hippocampal HT22 cell line. Int. J. Mol. Sci. 2018, 19, 2640. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hong, N.D.; Rho, Y.S.; Kim, N.J.; Kim, J.S. A study on efficacy of Ulmi cortex. Korean J. Pharmacogn. 1990, 21, 217–222. [Google Scholar]
- Lee, S.J. Korean Folk Medicine; Monographs Series No. 3; Seoul National University Press: Seoul, Korea, 1996. [Google Scholar]
- Lee, M.K.; Kim, Y.C. Five novel neuroprotective triterpene esters of Ulmus davidiana var. japonica. J. Nat. Prod. 2001, 64, 328–331. [Google Scholar] [CrossRef] [PubMed]
- Son, B.W.; Park, J.H.; Zee, O.P. Catechin glycoside from Ulmus davidiana. Arch. Pharmacal Res. 1989, 21, 219–222. [Google Scholar] [CrossRef]
- Choi, S.Y.; Lee, S.; Choi, W.H.; Lee, Y.; Jo, Y.O. Ha TY. Isolation and anti-inflammatory activity of Bakuchiol from Ulmus davidiana var. japonica. J. Med. Food 2010, 13, 1019–1023. [Google Scholar] [CrossRef] [PubMed]
- Jung, M.J.; Heo, S.I.; Wang, M.H. Free radical scavenging and total phenolic contents from methanolic extracts of Ulmus davidiana. Food Chem. 2008, 108, 482–487. [Google Scholar] [CrossRef]
- Kim, Y.C.; Lee, M.K.; Sung, S.H.; Kim, S.H. Sesquiterpenes from Ulmus davidiana var. japonica with the inhibitory effects on lipopolysaccharide-induced nitric oxide production. Fitoterapia 2007, 78, 196–199. [Google Scholar]
- Kim, C.S.; Lee, J.M.; Choi, C.O.; Park, S.B.; Eom, T.J. Chemical analysis and isolation of antibacterial compound from Ulmus species (II): Isolation and chemical structure of antibacterial compound. J. Korean Wood Sci. Technol. 2003, 31, 16–21. [Google Scholar]
- Kim, J.P.; Kim, W.G.; Koshino, H.; Jung, J.; Yoo, I.D. Sesquiterpene O-naphthaquinones from the root bark of Ulmus davidiana. Phytochemistry 1996, 43, 425–430. [Google Scholar] [CrossRef]
- Lee, M.K.; Sung, S.H.; Lee, H.S.; Cho, J.H.; Kim, Y.C. Lignan and neolignan glycosides from Ulmus davidiana var. japonica. Arch. Pharmacal Res. 2001, 24, 198–201. [Google Scholar] [CrossRef] [PubMed]
- Zheng, M.S.; Lee, Y.K.; Li, Y.; Hwangbo, K.; Lee, C.S.; Kim, J.R.; Lee, S.K.S.; Chang, H.W.; Son, J.K. Inhibition of DNA topoisomerases I and II and cytotoxicity of compounds from Ulmus davidiana var. japonica. Arch. Pharmacal Res. 2010, 33, 1307–1315. [Google Scholar] [CrossRef] [PubMed]
- Na, M.K.; An, R.B.; Lee, S.M.; Min, B.S.; Kim, Y.H.; Bae, K.H.; Kang, S.S. Antioxidant compounds from the stem bark of Sorbus commixta. Nat. Prod. Sci. 2002, 8, 26–29. [Google Scholar]
- Nahrstedt, A.; Proksch, P.; Conn, E.E. Dhurrin, (–)-Catechin, flavonol glycosides and flavones from Chamaebatia foliolosa. Phytochemistry 1987, 26, 1546–1547. [Google Scholar] [CrossRef]
- Kohler, N.; Wray, V.; Winterhalter, P. Preparative isolation of procyanidins from grap seed extracts by high-speed counter-current chromatography. J. Chromatogr. A 2008, 1177, 114–125. [Google Scholar] [CrossRef]
- Tarascou, I.; Barathieu, K.; Andr, Y.; Pianet, I.; Dufourc, E.J.; Fouquet, E. An improved synthesis of procyanidin dimers: Regio- and stereocontrol of the interflavan bond. Eur. J. Org. Chem. 2006, 23, 5367–5377. [Google Scholar] [CrossRef]
- Otsuka, H.; Hirata, E.; Shizato, T.; Takeda, Y. Isolation of lignan glucosides and neolignan sulfate from the leaves of Glochidion zeylanicum (Gaertn) A. Juss. Chem. Pharm. Bull. 2000, 48, 1084–1086. [Google Scholar] [CrossRef] [Green Version]
- Zhang, F.; Wang, Z.; Fan, Y.; Xu, Q.; Ji, W.; Tian, R.; Niu, R. Elevated STAT3 signaling-mediated upregulation of MMP-2/9 confers enhanced invasion ability in multidrug-resistant breast cancer cells. Int. J. Mol. Sci. 2015, 16, 24772–24790. [Google Scholar] [CrossRef]
- Bugno, M.; Graeve, L.; Gatsios, P.; Koj, A.; Heimrich, P.C.; Travls, J.; Kordula, T. Identification of the interleukin-6/oncostation M response element in the rat tissue inhibitor of metalloproteinases-1 (TIMP-1) promoter. Nucleic Acids Res. 1995, 23, 5041–5047. [Google Scholar] [CrossRef] [Green Version]
- Benyon, R.C.; Iredale, J.P.; Goddard, S.; Winwood, P.J.; Arthur, M.J. Expression of tissue inhibitor of metalloproteinases 1 and 2 is increased in fibrotic human liver. Gastroenterology 1996, 110, 821–831. [Google Scholar] [CrossRef]
- Iredale, J.P. Tissue inhibitors of metalloproteinases in liver fibrosis. Int. J. Biochem. Cell Biol. 1997, 29, 43–54. [Google Scholar] [CrossRef]
- Herbst, H.; Wege, T.; Milani, S.; Pellegrini, G.; Orzechowski, H.D.; Bechstein, W.O.; Neuhaus, P.; Gressner, A.M.; Schuppan, D. Tissue inhibitor of metalloproteinase-1 and -2 RNA expression in rat and human liver fibrosis. Am. J. Pathol. 1997, 150, 1647–1659. [Google Scholar] [PubMed]
- Vempati, P.; Karagiannis, E.D.; Popel, A.S. A biochemical model of matrix metalloproteinase 9 activation and inhibition. J. Biol. Chem. 2007, 282, 37585–37596. [Google Scholar] [CrossRef] [Green Version]
- Strongin, A.Y.; Collier, I.; Bannikov, G.; Marmer, B.L.; Grant, G.A.; Goldberg, G.I. Mechanism of cell surface activation of 72-kDa type IV collagenase. Isolation of the activated form of the membrane metalloprotease. J. Biol. Chem. 1995, 270, 5331–5338. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Arriazu, E.; Ruiz de Galarreta, M.; Cubero, F.J.; Varela-Rey, M.; Perez de Obanos, M.P.; Leung, T.M.; Lopategi, A.; Benedicto, A.; Abraham-Enachescu, I.; Nieto, N. Extracellular matrix and liver disease. Antioxid. Redox Signal. 2014, 21, 1078–1097. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tsuchida, T.; Friedman, S.L. Mechanisms of hepatic stellate cell activation. Nat. Rev. Gastroenterol. Hepatol. 2017, 14, 397–411. [Google Scholar] [CrossRef] [PubMed]
- Higashi, T.; Friedman, S.L.; Hoshida, Y. Hepatic stellate cells as key target in liver fibrosis. Adv. Drug Deliv. Rev. 2017, 121, 27–42. [Google Scholar] [CrossRef]
- Jung, M.J.; Heo, S.I.; Wang, M.H. HPLC analysis and antioxidant activity of Ulmus davidiana and some flavonoids. Food Chem. 2010, 120, 313–318. [Google Scholar] [CrossRef]
- Hammerich, L.; Tacke, F. Interleukins in chronic liver disease: Lessons learned from experimental mouse models. Clin. Exp. Gastroenterol. 2014, 7, 297–306. [Google Scholar]
- Moreira, R.K. Hepatic stellate cells and liver fibrosis. Arch. Pathol. Lab. Med. 2007, 131, 1728–1734. [Google Scholar]
- Li, X.; Benjamin, I.S.; Alexander, B. Reproducible production of thioacetamide-induced macronodular cirrhosis in the rat with no mortality. J. Hepatol. 2002, 36, 488–493. [Google Scholar] [CrossRef]
- Wallace, M.C.; Hamesch, K.; Lonova, M.; Kim, Y.; Weiskirchen, R.; Strnad, P.; Friedman, S.L. Standard operating procedures in experimental liver research: Thioacetamide model in mice and rats. Lab. Anim. 2015, 49, 21–29. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, Y.; Kiu, H.; Meyer, C.; Li, J.; Nadalin, S.; Koenigsrainer, A.; Weng, H.; Dooley, S.; ten Dijke, P. TGF-β mediated connective tissue growth factor (CTGF) expression in hepatic stellate cells requires Stat3 signaling activation. J. Biol. Chem. 2013, 288, 30708–30719. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xu, M.Y.; Hu, J.J.; Shen, J.; Wang, M.L.; Zhang, Q.Q.; Qu, Y.; Lu, L.G. Stat3 signaling activation crosslinking of TGF-β1 in hepatic stellate cell exacerbates liver injury and fibrosis. Biochimica et Biophysica Acta BBA Mol. Basis Dis. 2014, 1842, 2237–2245. [Google Scholar] [CrossRef] [Green Version]
- Itoh, Y.; Saitoh, M.; Miyazawa, K. Smad3-STAT3 crosstalk in pathophysiological contexts. Acta Biochimica et Biophysica Sinica 2018, 50, 82–90. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; van Boxel-Dezaire, A.H.; Cheon, H.; Yang, J.; Stark, G.R. STAT3 activation in response to IL-6 is prolonged by the binding of IL-6 receptor to EGF receptor. Proc. Natl. Acad. Sci. USA 2013, 110, 16975–16980. [Google Scholar] [CrossRef] [Green Version]
- Mori, T.; Miyamoto, T.; Yoshida, H.; Asakawa, M.; Kawasumi, M.; Kobayashi, T.; Morioka, H.; Chiba, K.; Toyama, Y.; Yoshimura, A. IL-1β and TNF-α initiated IL-6-STAT3 pathway is critical in mediating inflammatory cytokines and RANKL expression in inflammatory arthritis. Int. Immunol. 2011, 23, 701–712. [Google Scholar] [CrossRef] [Green Version]
- Guo, Y.; Zang, Y.; Lv, L.; Cai, F.; Qian, T.; Zhang, G.; Feng, Q. IL-8 promotes proliferation and inhibition of apoptosis via STAT3/AKT/NF-ĸB pathway in prostate cancer. Mol. Med. Rep. 2017, 16, 9035–9042. [Google Scholar] [CrossRef] [Green Version]
- Yang, C.; Zeisberg, M.; Mosterman, B.; Sudhakar, A.; Sudhakar, A.; Yerramalla, U.; Holthaus, K.; Xu, L.; Eng, F.; Afdhal, N.; et al. Liver fibrosis: Insights into migration of hepatic stellate cells in response to extracellular matrix and growth factors. Gastroenterology 2003, 124, 147–159. [Google Scholar] [CrossRef]
- Latronico, T.; Mascia, C.; Pati, I.; Zuccala, P.; Mengoni, F.; Marocco, R.; Tieghi, T.; Belvisi, V.; Lichtner, M.; Vullo, V.; et al. Liver fibrosis in HCV monoinfected and HIV/HCV coinfected patients: Dysregulation of matrix metalloproteinases (MMPs) and their tissue inhibitors TIMPs and effect of HCV protease inhibitors. Int. J. Mol. Sci. 2016, 17, 455. [Google Scholar] [CrossRef] [Green Version]
Gene | Species | Forward | Reverse |
---|---|---|---|
α-SMA | Human | CTGGCATCGTGCTGGACTCT | GATCTCGGCCAGCCAGATC |
CTGF | Human | GGCTTACCGACTGGAAGAC | AGGAGGCGTTGTCATTGG |
Fibronectin | Human | CAGTGGGAGACCTCGAGAAG | TCCCTCGGAACATCAGAAAC |
MMP-9 | Human | TTTGACAGCGACAAGAAGTGG | GGGCGAGGACCATAGAGG |
MMP-2 | Human | GAGAACCAAAGTCTGAAGAG | GGAGTGAGAATGCTGATTAG |
Col 1A1 | Human | GGCAACAGCCGCTTCACCTAC | GCGGGAGGACTTGGTGGTTTT |
TIMP-1 | Human | TTGACTTCTGGTGTCCCCAC | GCTTCTGGCATCCTGTTGTT |
TIMP-2 | Human | ACAGGCGTTTTGCAATGCA | GGGTTGCCATAAATGTCGTTTC |
α-SMA | Mouse | GTTCAGTGGTGCCTCTGTCA | ACTGGGACGACATGGAAAAG |
Col 1A1 | Mouse | TTCGGACTAGACATTGG | GGGTTGTTCGTCTGTTTC |
Col 3A1 | Mouse | ACGTAGATGAATTGGGATGCAG | GGGTTGGGGCAGTCTAGTG |
CTGF | Mouse | TGACCCCTGCGACCCACA | TACACCGACCCACCGAAGACACAG |
Saline + Saline | C7A + Saline | Saline + TAA | C7A + TAA | |
---|---|---|---|---|
Initial body weight (g) | 24.13 ± 0.93 | 24.21 ± 1.26 | 24.41 ± 0.96 | 24.70 ± 1.46 |
Final body weight (g) | 29.61 ± 2.93 | 27.91 ± 3.50 | 25.78 ± 1.16 | 26.25 ± 1.44 |
Liver weight (g) | 1.33 ± 0.26 | 1.23 ± 0.20 | 1.26 ± 0.30 | 1.07 ± 0.09 |
Liver weight/body weight (×100) | 4.51 ± 0.52 | 4.39 ± 0.29 | 4.89 ± 1.11 | 4.08 ± 0.24 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Park, Y.J.; Kim, D.M.; Jeong, M.H.; Yu, J.S.; So, H.M.; Bang, I.J.; Kim, H.R.; Kwon, S.-H.; Kim, K.H.; Chung, K.H. (–)-Catechin-7-O-β-d-Apiofuranoside Inhibits Hepatic Stellate Cell Activation by Suppressing the STAT3 Signaling Pathway. Cells 2020, 9, 30. https://0-doi-org.brum.beds.ac.uk/10.3390/cells9010030
Park YJ, Kim DM, Jeong MH, Yu JS, So HM, Bang IJ, Kim HR, Kwon S-H, Kim KH, Chung KH. (–)-Catechin-7-O-β-d-Apiofuranoside Inhibits Hepatic Stellate Cell Activation by Suppressing the STAT3 Signaling Pathway. Cells. 2020; 9(1):30. https://0-doi-org.brum.beds.ac.uk/10.3390/cells9010030
Chicago/Turabian StylePark, Yong Joo, Dong Min Kim, Mi Ho Jeong, Jae Sik Yu, Hae Min So, In Jae Bang, Ha Ryong Kim, Seung-Hwan Kwon, Ki Hyun Kim, and Kyu Hyuck Chung. 2020. "(–)-Catechin-7-O-β-d-Apiofuranoside Inhibits Hepatic Stellate Cell Activation by Suppressing the STAT3 Signaling Pathway" Cells 9, no. 1: 30. https://0-doi-org.brum.beds.ac.uk/10.3390/cells9010030