Induction of Systemic Resistance against Sheath Blight in Rice by Different Pseudomonas Isolates
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plants and Pathogen
2.2. Inoculum Preparation of PGPB Isolates
2.3. Characterization of PGPB Isolates
2.4. The Impact of PGPBs on Rice Seed Germination and Seedling Vigor
2.5. The Impact of PGPBs on Rice Growth under Greenhouse Conditions
2.6. Assessment of Defense-Related Enzymes
2.7. RNA Isolation and qRT-PCR Analysis
2.8. Field Experiment
2.9. Statistical Analysis
3. Results
3.1. Characterization of PGPB Isolates
3.2. PGPB Effect on Seed Germination and Seedling Vigor
3.3. PGPB Effect on Rice Growth under Greenhouse Conditions
3.4. PGPB Effect on Sheath Blight Infection
3.5. Defense Enzymes Stimulation by PGPB Isolates in Rice against R. solani
3.6. Transcription of NPR1 and PAL Genes in PGPB-Treated Rice Plants
3.7. Effect of PGPB Treatments on Plant Growth and Resistance against R. solani under Field Conditions
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Molina, J.; Sikora, M.; Garud, N.; Flowers, J.M.; Rubinstein, S.; Reynolds, A.; Huang, P.; Jackson, S.; Schaal, B.A.; Bustamante, C.D.; et al. Molecular evidence for a single evolutionary origin of domesticated rice. Proc. Natl. Acad. Sci. USA 2011, 108, 8351–8356. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ou, S.H. Rice Diseases, 2nd ed.; Commonwealth Mycological Institute, Kew.: London, UK, 1985. [Google Scholar]
- Vidhyasekaran, P.; Ponmalar, T.; Samiyappan, R.; Velazhahan, R.; Vimala, R.; Ramanathan, A.; Paranitharan, V.; Muthukrishnan, S. Host specific toxin production by Rhizoctonia solani, the rice sheath blight pathogen. Phytopathology 1997, 87, 1258–1263. [Google Scholar] [CrossRef] [Green Version]
- Nandakumar, R.; Babu, S.; Viswanathan, R.; Raguchander, T.; Samiyappan, R. Induction of systemic resistance in rice against sheath blight disease by Pseudomonas fluorescens. Soil Biol. Biochem. 2001, 33, 603–612. [Google Scholar] [CrossRef]
- Chen, L.; Dodd, I.C.; Theobald, J.C.; Belimov, A.A.; Davies, W.J. The rhizobacterium Variovorax paradoxus 5C-2, containing ACC deaminase, promotes growth and development of Arabidopsis thaliana via an ethylene-dependent pathway. J. Exp. Bot. 2013, 64, 1565–1573. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Panhwar, Q.A.; Naher, U.A.; Jusop, S.; Othman, R.; Latif, M.A.; Ismail, M.R. Biochemical and molecular characterization of potential phosphate-solubilizing bacteria in acid sulfate soils and their beneficial effects on rice growth. PLoS ONE 2014, 9, e97241. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ahirwar, N. PGPR current and future prospects for development of sustainable agriculture. J. Microbiol. Biotechnol. 2015, 7, 96–102. [Google Scholar]
- Gomez, L.C.C.; Schiliro, E.; Valverde, C.A.; Mercado, B.J. The biocontrol endophytic bacterium Pseudomonas fluorescens PICF7 induces systemic defense responses in aerial tissues upon colonization of olive roots. Front. Microbiol. 2014, 5, 427. [Google Scholar] [CrossRef] [PubMed]
- Elsharkawy, M.M.; Elsawy, M.M.; Ismail, I.A. Mechanism of resistance to Cucumber mosaic virus elicited by inoculation with Bacillus subtilis subsp. subtilis. Pest. Manag. Sci. 2021, 78, 86–94. [Google Scholar] [CrossRef]
- Ji, S.H.; Gururani, M.A.; Chun, S.C. Isolation and characterization of plant growth promoting endophytic diazotrophic bacteria from Korean rice cultivars. Microbiol. Res. 2014, 169, 83–98. [Google Scholar] [CrossRef]
- Bostock, R.M. Signal crosstalk and induced resistance. straddling the line between cost and benefit. Annu. Rev. Phytopathol. 2005, 43, 545–580. [Google Scholar] [CrossRef]
- Yoshida, K.; Kaothien, P.; Matsui, T.; Kawaoka, A.; Shinmyo, A. Molecular biology and application of plant peroxidase genes. Appl. Microbiol. Biotechnol. 2003, 60, 665–670. [Google Scholar] [CrossRef]
- Maksimov, I.V.; Valeev, A.S.; Cherepanova, E.A.; Burkhanova, G.F. Effect of chito oligosaccharides with different degrees of acetylation on the activity of wheat pathogen-inducible anionic peroxidase. Appl. Biochem. Microbiol. 2014, 50, 82–87. [Google Scholar] [CrossRef]
- Choodamani, M.S.; Hariprasad, P.; Sateesh, M.K.; Umesha, S. Involvement of catalase in bacterial blight disease development of rice caused by Xanthomonas oryzae pv. oryzae. Int. J. Pest. Manag. 2009, 55, 121–127. [Google Scholar] [CrossRef]
- Sofo, A.; Scopa, A.; Nuzzaci, M.; Vitti, A. Ascorbate peroxidase and catalase activities and their genetic regulation in plants subjected to drought and salinity stresses. Int. J. Mol. Sci. 2015, 16, 13561–13578. [Google Scholar] [CrossRef] [Green Version]
- Hameed, A.; Iqbal, N. Chemo-priming with mannose, mannitol and H2O2 mitigate drought stress in wheat. Cereal Res. Commun. 2014, 42, 450–462. [Google Scholar] [CrossRef] [Green Version]
- Jockusch, H. The role of host genes, temperature and polyphenol oxidase in the necrotization of TMV infected tobacco tissue. J. Phytopathol. 1966, 55, 185–192. [Google Scholar] [CrossRef]
- Hemm, M.R.; Rider, S.D.; Ogas, J.; Murry, D.J.; Chapple, C. Light induces phenyl propanoid metabolism in Arabidopsis roots. Plant. J. 2004, 38, 765–778. [Google Scholar] [CrossRef]
- Tahsili, J.; Sharifi, M.; Safaie, N.; Esmaeilzadeh, B.S.; Behmanesh, M. Induction of lignans and phenolic compounds in cell culture of Linum album by culture filtrate of Fusarium graminearum. J. Plant Interact. 2014, 9, 412–417. [Google Scholar] [CrossRef]
- Choong-Min, R.; Murphy, J.F.; Reddy, M.S.; Kloepper, J.W. A two-strain mixture of rhizobacteria elicits induction of systemic resistance against Pseudomonas syringae and Cucumber mosaic virus coupled to promotion of plant growth on Arabidopsis thaliana. World J. Microbiol. Biotechnol. 2007, 17, 280–286. [Google Scholar]
- Schwyn, B.; Neilands, J. Universal chemical assay for the detection and determination of siderophores. Anal. Biochem. 1987, 160, 47–56. [Google Scholar] [CrossRef]
- Tariq, M.; Hameed, S.; Malik, K.A.; Hafeez, F.Y. Plant root associated bacteria for zinc mobilization in rice. Pak. J. Bot. 2007, 39, 245–253. [Google Scholar]
- Marten, P.; Smalla, K.; Berg, G. Genotypic and phenotypic differentiation of an antifungal biocontrol strain belonging to Bacillus subtilis. J. Appl. Microbiol. 2000, 89, 463–471. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Patten, C.L.; Glick, B.R. Role of Pseudomonas putida indole acetic acid in development of the host plant root system. Appl. Environ. Microbiol. 2002, 68, 3795–3801. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tien, T.M.; Gaskins, M.H.; Hubbell, D.H. Plant growth substances produced by Azospirillum brasilense and their effect on the growth of pearl millet (Pennisetum americanum L.). Appl. Environ. Microbiol. 1979, 37, 1016–1024. [Google Scholar] [CrossRef] [Green Version]
- ISTA. International rules for seed testing. Proc. Int. Seed Test Assoc. 1966, 31, 1–152. [Google Scholar]
- Baki, A.A.; Anderson, J.D. Vigor determination in soybean seed by multiple criteria. Crop. Sci. 1973, 13, 630–633. [Google Scholar] [CrossRef]
- Sriram, S.; Raguchander, T.; Vidhyasekaran, P.; Muthukrishnan, S.; Samiyappan, R. Genetic relatedness with special reference to virulence among the isolates of Rhizoctonia solani causing sheath blight in rice. J. Plant Dis. Prot. 1997, 104, 260–271. [Google Scholar]
- Hammerschmidt, R.; Nuckles, E.M.; Kuc, J. Association of enhanced peroxidase activity with induced systemic resistance of cucumber to Colletotrichum lagenarium. Physiol. Plant Pathol. 1982, 20, 73–82. [Google Scholar] [CrossRef]
- Mayer, A.M.; Harel, E.; Shaul, R.B. Assay of catechol oxidase, a critical comparison methods. Phytochemistry 1965, 5, 783–789. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−CT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Glick, B.R. The enhancement of plant growth by free living bacteria. Can. J. Microbiol. 1994, 41, 109–117. [Google Scholar] [CrossRef]
- Niranjan-Raj, S.; Deepak, S.A.; Basavaraju, P.; Shetty, H.S.; Reddy, M.S.; Kloepper, J.W. Comparative performance of formulations of plant growth promoting rhizobacteria in growth promotion and suppression of downy mildew in pearl millet. Crop. Prot. 2003, 22, 579–588. [Google Scholar]
- Naureen, Z.; Price, A.H.; Hafeez, F.Y.; Roberts, M.R. Identification of rice blast disease suppressing bacterial strains from the rhizosphere of rice grown in Pakistan. Crop. Prot. 2009, 28, 1052–1060. [Google Scholar] [CrossRef] [Green Version]
- Nascimento, F.X.; Rossi, M.J.; Soares, C.R.F.S.; MacConkey, B.J.; Glick, B.R. New insights into 1-aminocyclopropane-1-carboxylate (ACC) deaminase phylogeny, evolution and ecological significance. PLoS ONE 2014, 9, e99168. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ramette, A.; Frapolli, M.; Defago, G.; Moenne, L.Y. Phylogeny of HCN synthase encoding hcnBC genes in biocontrol fluorescent pseudomonas and its relationship with host plant species and HCN synthesis ability. Mol. Plant Microbe Interact. 2003, 16, 525–535. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gustavo, S.M. Mechanisms of biocontrol and plant growth promoting activity in soil bacterial species of Bacillus and Pseudomonas: A review. Biocontrol. Sci. Technol. 2012, 22, 8558–8572. [Google Scholar]
- Liang, J.; Tao, X.R.; Hao, Z.N.; Wang, L.P.; Zhang, X. Induction of resistance in cucumber against seedling damping-off by plant growth-promoting rhizobacteria (PGPR) Bacillus megaterium strain L8. Afr. J. Biotechnol. 2011, 10, 6920–6927. [Google Scholar]
- Daayf, F.; Bel-Rhlid, R.; Belanger, R.R. Methyl ester of p-coumaric acid: A phytoalexin-like compound from long English cucumber leaves. J. Chem. Ecol. 1997, 23, 1517–1526. [Google Scholar] [CrossRef]
- Ramamoorthy, V.; Raguchander, T.; Samiyappan, R. Enhancing resistance of tomato and hot pepper to phythium diseases by seed treatment with fluorescent Pseudomonas. Eur. J. Plant Pathol. 2002, 108, 429–441. [Google Scholar] [CrossRef]
- Elsharkawy, M.M.; El-Khateeb, N.M. Antifungal activity and resistance induction against Sclerotium cepivorum by plant growth-promoting fungi in onion plants. Egypt. J. Biol. Pest Control. 2019, 29, 68. [Google Scholar] [CrossRef]
- Chen, C.; Belanger, R.R.; Benhamou, N.; Paulitz, T.C. Defense enzymes induced in cucumber roots by treatment with Plant Growth Promoting Rhizobacteria (PGPR) and Pythium aphanidermatum. Physiol. Mol. Plant Pathol. 2000, 56, 13–23. [Google Scholar] [CrossRef]
- Radjacommare, R. Pseudomonas fluorescens Mediated Systemic Resistance in Rice Sheath Blight Disease and Leaf Folder Insect. Ph.D. Thesis, Tamil Nadu Agriculture University, Coimbatore, India, 2000; p. 122. [Google Scholar]
- Saikia, R.; Yadav, M.; Varghese, S.; Singh, B.P.; Gogoi, D.K.; Kumar, R.; Arora, D.K. Role of riboflavin in induced resistance against Fusarium wilt and charcoal rot diseases of chickpea. Plant Pathol. J. 2006, 24, 339–347. [Google Scholar] [CrossRef] [Green Version]
- Singh, U.B.; Malviya, D.; Singh, S.; Pradhan, J.K.; Singh, B.P.; Roy, M.; Imram, M.; Pathak, N.; Baisyal, B.M.; Rai, J.P.; et al. Bio-protective microbial agents from rhizosphere eco-systems trigger plant defense responses provide protection against sheath blight disease in rice (Oryza sativa L.). Microbiol. Res. 2016, 192, 300–312. [Google Scholar] [CrossRef] [PubMed]
- Backer, R.; Naidoo, S.; van den Berg, N. The nonexpressor of pathogenesis-related genes 1 (NPR1) and related family: Mechanistic insights in plant disease resistance. Front. Plant Sci. 2019, 10, 102. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nic-Matos, G.; Narváez, M.; Peraza-Echeverría, S.; Sáenz, L.; Oropeza, C. Molecular cloning of two novel NPR1 homologue genes in coconut palm and analysis of their expression in response to the plant defense hormone salicylic acid. Genes Genom. 2017, 39, 1007–1019. [Google Scholar] [CrossRef]
- Kishimoto, K.; Nishizawa, Y.; Tabei, Y.; Hibi, T.; Nakajima, M.; Akutsu, K. Detailed analysis of rice chitinase gene expression in transgenic cucumber plants showing different levels of disease resistance to gray mold (Botrytis cinerea). Plant Sci. 2002, 162, 655–662. [Google Scholar] [CrossRef]
- Schiliro, E.; Ferrara, M.; Nigro, F.; Mercado-Blanco, J. Genetic responses induced in olive roots upon colonization by the biocontrol endophytic bacterium Pseudomonas fluorescens PICF7. PLoS ONE 2012, 7, e48646. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene Name | Forward Primer Sequence (5′→3′) | Reverse Primer Sequence (5′→3′) | Gene Bank ID |
---|---|---|---|
Actin | CAGCCACACTGTCCCCATCTA | AGCAAGGTCGAGACGAAGGA | AK058421 |
NPR1 | AGAAGTCATTGCCTCCAG | ACATCGTCAGAGTCAAGG | Os01t0194300 |
PAL | GGTGTTCTGCGAGGTGATGA | AGGGTGGTGCTTCAGCTTGT | AK068993 |
Plant-Growth-Promoting Bacteria (PGPBs) | Siderophores Produced (mg L−1) | Starch Hydrolysis | IAA Production (mg L−1) |
---|---|---|---|
P. putida | 0.4 | +++ | 1.82 |
P. aeruginosa | 0.4 | +++ | 1.79 |
P. brassicacearum | 0.3 | +++ | 0.89 |
P. resinovorans | 0.3 | ++ | 0.82 |
Bacillus sp. | 0.1 | ++ | - |
Plant-Growth-Promoting Bacteria (PGPBs) | Germination (%) | Vigor Index |
---|---|---|
P. putida | 89 a | 1756.4 a |
P. aeruginosa | 87 b | 1759.9 a |
P. brassicacearum | 84 c | 1544.8 b |
P. resinovorans | 83 c | 1496.1 c |
Control | 74 d | 911.6 d |
Plant-Growth-Promoting Bacteria (PGPBs) | Plant Height (cm) | Fresh Weight (g/Seedling) | Dry Weight (g/Seedling) | Disease Index |
---|---|---|---|---|
P. putida | 69.8 a | 1.13 a | 0.12 a | 37.1 d |
P. aeruginosa | 66.2 b | 0.92 b | 0.10 b | 39.9 c |
P. brassicacearum | 61.6 c | 0.73 c | 0.08 c | 49.1 b |
P. resinovorans | 62.2 c | 0.71 c | 0.08 c | 50.4 b |
Carbendazim | 54.8 d | 0.50 d | 0.06 d | 31.8 e |
Control | 55.3 d | 0.47 d | 0.06 d | 68.3 a |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Elsharkawy, M.M.; Sakran, R.M.; Ahmad, A.A.; Behiry, S.I.; Abdelkhalek, A.; Hassan, M.M.; Khedr, A.A. Induction of Systemic Resistance against Sheath Blight in Rice by Different Pseudomonas Isolates. Life 2022, 12, 349. https://0-doi-org.brum.beds.ac.uk/10.3390/life12030349
Elsharkawy MM, Sakran RM, Ahmad AA, Behiry SI, Abdelkhalek A, Hassan MM, Khedr AA. Induction of Systemic Resistance against Sheath Blight in Rice by Different Pseudomonas Isolates. Life. 2022; 12(3):349. https://0-doi-org.brum.beds.ac.uk/10.3390/life12030349
Chicago/Turabian StyleElsharkawy, Mohsen Mohamed, Raghda M. Sakran, Abdelmonim Ali Ahmad, Said I. Behiry, Ahmed Abdelkhalek, Mohamed M. Hassan, and Amr Ahmed Khedr. 2022. "Induction of Systemic Resistance against Sheath Blight in Rice by Different Pseudomonas Isolates" Life 12, no. 3: 349. https://0-doi-org.brum.beds.ac.uk/10.3390/life12030349