The Fastest and Most Reliable Identification of True Hybrids in the Genus Pisum L.
Abstract
:1. Introduction
2. Materials and Methods
2.1. Parents and Crosses
2.2. Xenia Effects
2.3. SSR-Based Genotyping for Hybrid Confirmation
2.4. Statistical Analyses
3. Results
3.1. Xenia in Intraspecific Crosses
3.2. Xenia in Interspecific Crosses
3.3. True Hybrids by SSRs
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Smýkal, P.; Coyne, C.J.; Ambrose, M.J.; Maxted, N.; Schaefer, H.; Blair, M.W.; Berger, J.; Greene, S.L.; Nelson, M.N.; Besharat, N.; et al. Legume Crops Phylogeny and Genetic Diversity for Science and Breeding. Crit. Rev. Plant Sci. 2015, 34, 43–104. [Google Scholar] [CrossRef]
- Warkentin, T.D.; Smỳkal, P.; Coyne, C.J.; Weeden, N.; Domoney, C.; Bing, D.-J.; Leonforte, A.; Xuxiao, Z.; Dixit, G.P.; Boros, L. Pea. In Grain Legum; Springer: New York, NY, USA, 2015; pp. 37–83. [Google Scholar]
- FAOSTAT. Food and Agriculture Organization. Available online: https://www.fao.org/faostat/en/#data/QCL (accessed on 1 April 2023).
- Ladizinsky, G.; Abbo, S. The Search for Wild Relatives of Cool Season Legumes; Springer: Cham, Switzerland, 2015. [Google Scholar]
- Smitchger, J.; Weeden, N. Quantitative Trait Loci Controlling Lodging Resistance and Other Important Agronomic Traits in Dry Field Peas. Crop Sci. 2019, 59, 1442–1456. [Google Scholar] [CrossRef]
- Smỳkal, P. Pea (Pisum sativum L.) in Biology Prior and after Mendel’s Discovery. Czech J. Genet. Plant Breed. 2014, 50, 52–64. [Google Scholar] [CrossRef]
- Hellens, R.P.; Moreau, C.; Lin-Wang, K.; Schwinn, K.E.; Thomson, S.J.; Fiers, M.W.; Frew, T.J.; Murray, S.R.; Hofer, J.M.; Jacobs, J.M. Identification of Mendel’s White Flower Character. PLoS ONE 2010, 5, e13230. [Google Scholar] [CrossRef]
- Ellis, T.N.; Hofer, J.M.; Timmerman-Vaughan, G.M.; Coyne, C.J.; Hellens, R.P. Mendel, 150 Years On. Trends Plant Sci. 2011, 16, 590–596. [Google Scholar] [CrossRef] [PubMed]
- Schwarzbach, E.; Smỳkal, P.; Dostál, O.; Jarkovská, M.; Valova, S.; Gregor, J. Mendel-Genetics Founding Father. Czech J. Genet. Plant Breed. 2014, 50, 43–51. [Google Scholar] [CrossRef]
- Smỳkal, P.; Varshney, R.K.; Singh, V.K.; Coyne, C.J.; Domoney, C.; Kejnovskỳ, E.; Warkentin, T. From Mendel’s Discovery on Pea to Today’s Plant Genetics and Breeding: Commemorating the 150th Anniversary of the Reading of Mendel’s Discovery. Theor. Appl. Genet. 2016, 129, 2267–2280. [Google Scholar] [CrossRef] [PubMed]
- Focke, W.O. Die Pflanzen-Mischlinge; Ein Beitrag zur Biologie der Gewächse. Gebrüder Borntrager: Berlin, Germany, 1881. [Google Scholar]
- Sun, X.; Shantharaj, D.; Kang, X.; Ni, M. Transcriptional and Hormonal Signaling Control of Arabidopsis Seed Development. Curr. Opin. Plant Biol. 2010, 13, 611–620. [Google Scholar] [CrossRef]
- Liu, Y. Darwin’s Pangenesis and Certain Anomalous Phenomena. Adv. Genet. 2018, 102, 93–120. [Google Scholar] [PubMed]
- Jafari, M.; Shiran, B.; Rabiei, G.; Ravash, R.; Sayed Tabatabaei, B.E.; Martínez-Gómez, P. Identification and Verification of Seed Development Related MiRNAs in Kernel Almond by Small RNA Sequencing and QPCR. PLoS ONE 2021, 16, e0260492. [Google Scholar] [CrossRef]
- Denney, J.O. Xenia Includes Metaxenia. HortScience 1992, 27, 722–728. [Google Scholar] [CrossRef]
- Piotto, F.A.; Batagin-Piotto, K.D.; de Almeida, M.; Oliveira, G.C.X. Interspecific Xenia and Metaxenia in Seeds and Fruits of Tomato. Sci. Agric. 2013, 70, 102–107. [Google Scholar] [CrossRef]
- Nixon, R.W. The Direct Effect of Pollen on the Fruit of the Date Palm; US Government Printing Office: Washington, DC, USA, 1928. [Google Scholar]
- Weingartner, U.; Kaeser, O.; Long, M.; Stamp, P. Combining Cytoplasmic Male Sterility and Xenia Increases Grain Yield of Maize Hybrids. Crop Sci. 2002, 42, 1848–1856. [Google Scholar] [CrossRef]
- Solanki, R.K.; Singh, S.; Kumar, J. Molecular Marker Assisted Testing of Hybridity of F1 Plants in Lentil. J. Food Legum. 2010, 23, 21–24. [Google Scholar]
- Kalia, R.K.; Rai, M.K.; Kalia, S.; Singh, R.; Dhawan, A.K. Microsatellite Markers: An Overview of the Recent Progress in Plants. Euphytica 2011, 177, 309–334. [Google Scholar] [CrossRef]
- Caballo, C.; Castro, P.; Gil, J.; Izquierdo, I.; Millan, T.; Rubio, J. STMS (Sequence Tagged Microsatellite Site) Molecular Markers as a Valuable Tool to Confirm Controlled Crosses in Chickpea (Cicer arietinum L.) Breeding Programs. Euphytica 2018, 214, 231. [Google Scholar] [CrossRef]
- Davis, P.H. Flora of Turkey and the East Aegean Islands; University Press: Edinburgh, UK, 1970; Volume 3. [Google Scholar]
- Smartt, J. Grain Legumes: Evolution and Genetic Resources; Cambridge University Press: Cambridge, UK, 1990. [Google Scholar]
- Maxted, N.; Ambrose, M. Peas (Pisum L.). In Plant Genetic Resources of Legumes in the Mediterranean; Springer: Dordrecht, The Netherlands, 2001; pp. 181–190. [Google Scholar]
- Lock, J.M.; Maxted, N. Tribe Fabeae; Legumes of the world: 505; Cambridge University Press: Cambridge, UK, 2005; Volume 510. [Google Scholar]
- Schaefer, H.; Hechenleitner, P.; Santos-Guerra, A.; de Sequeira, M.M.; Pennington, R.T.; Kenicer, G.; Carine, M.A. Systematics, Biogeography, and Character Evolution of the Legume Tribe Fabeae with Special Focus on the Middle-Atlantic Island Lineages. BMC Evol. Biol. 2012, 12, 250. [Google Scholar] [CrossRef]
- Bogdanova, V.S.; Berdnikov, V.A. Observation of the Phenomenon Resembling Hybrid Dysgenesis in a Wild Pea Subspecies Pisum sativum ssp. elatius. Pisum Genet. 2001, 33, 5–8. [Google Scholar]
- Bogdanova, V.S. Inheritance of Organelle DNA Markers in a Pea Cross Associated with Nuclear-Cytoplasmic Incompatibility. Theor. Appl. Genet. 2007, 114, 333–339. [Google Scholar] [CrossRef]
- Bogdanova, V.S.; Kosterin, O.E. A Chloroplast DNA Marker Frequently Found in Wild Peas. Pisum Genet. 2005, 37, 40–41. [Google Scholar]
- Bogdanova, V.S.; Kosterin, O.E. Hybridization Barrier between Pisum fulvum Sibth. et Smith and P. sativum L. Is Partly Due to Nuclear-Chloroplast Incompatibility. Pisum Genet. 2007, 39, 8–9. [Google Scholar]
- Kosterin, O.E.; Bogdanova, V.S. Reciprocal Compatibility within the Genus Pisum L. as Studied in F1 Hybrids: 1. Crosses Involving P. sativum L. subsp. sativum. Genet. Resour. Crop Evol. 2015, 62, 691–709. [Google Scholar] [CrossRef]
- Lefort, F.; Lally, M.; Thompson, D.; Douglas, G.C. Morphological Traits, Microsatellite Fingerprinting and Genetic Relatedness of a Stand of Elite Oaks (Q. robur L.) at Tullynally, Ireland. Silvae Genet. 1998, 47, 257–261. [Google Scholar]
- Loridon, K.; McPhee, K.; Morin, J.; Dubreuil, P.; Pilet-Nayel, M.-L.; Aubert, G.; Rameau, C.; Baranger, A.; Coyne, C.; Lejeune-Henaut, I. Microsatellite Marker Polymorphism and Mapping in Pea (Pisum sativum L.). Theor. Appl. Genet. 2005, 111, 1022–1031. [Google Scholar] [CrossRef]
- Correns, C.F.J.E.G. Mendel’s Regel Uber Das Verhalten Der Nachkommenschaft Der Rassenbastarde. Ber. Dtsch Bot. Ges 1900, 18, 158–167. [Google Scholar]
- Rheinberger, H.-J. Mendelian Inheritance in Germany between 1900 and 1910. The Case of Carl Correns (1864–1933). Comptes Rendus Académie Sci.-Sér. III-Sci. Vie 2000, 323, 1089–1096. [Google Scholar] [CrossRef]
- Swingle, W.T. Metaxenia in the Date Palm: Possibly a Hormone Action by the Embryo or Endosperm. J. Hered. 1928, 19, 257–268. [Google Scholar] [CrossRef]
- Freytag, G.F. Metaxenia Effects on Pod Size Development in the Common Bean. J. Hered. 1979, 70, 444–446. [Google Scholar] [CrossRef]
- Gupton, C.L. Evidence of Xenia in Blueberry. In Proceedings of the VI International Symposium on Vaccinium Culture 446, Orono, ME, USA, 12 August 1996; pp. 119–124. [Google Scholar]
- Olfati, J.A.; Sheykhtaher, Z.; Qamgosar, R.; Khasmakhi-Sabet, A.; Peyvast, G.H.; Samizadeh, H.; Rabiee, B. Xenia and Metaxenia on Cucumber Fruit and Seed Characteristics. Int. J. Veg. Sci. 2010, 16, 243–252. [Google Scholar] [CrossRef]
- Weingartner, U.; Camp, K.-H.; Stamp, P. Impact of Male Sterility and Xenia on Grain Quality Traits of Maize. Eur. J. Agron. 2004, 21, 239–247. [Google Scholar] [CrossRef]
- Duc, G.; Moessner, A.; Moussy, F.; Mousset-Déclas, C. A Xenia Effect on Number and Volume of Cotyledon Cells and on Seed Weight in Faba Bean (Vicia faba L.). Euphytica 2001, 117, 169–174. [Google Scholar] [CrossRef]
- Asthana, A.N.; Singh, C.B. Seed and Siliqua Character Association and Xenia in Brassica Campestris and B. Chinensis; Indian Society of Genetics & Plant Breeding: New Delhi, India, 1973. [Google Scholar]
- Grochowski, L.; Kaczmarek, J.; Kadłubiec, W.; Bujak, H. Genetic Variability of Rye-Xenic-Hybrid Traits. Acta Soc. Bot. Pol. 1996, 65, 329–333. [Google Scholar] [CrossRef]
- Metzger, R.J.; Sebesta, E. Registration of Three Blue-Seeded Wheat Genetic Stocks Exhibiting Xenia. Crop Sci. 2004, 44, 2281–2283. [Google Scholar] [CrossRef]
- Rai, K.N.; Govindaraj, M.; Pfeiffer, W.H.; Rao, A.S. Seed Set and Xenia Effects on Grain Iron and Zinc Density in Pearl Millet. Crop Sci. 2015, 55, 821–827. [Google Scholar] [CrossRef]
- Lajos, D. Evaluation of the applicability of hayman model of diallel analysis with crosses of 2 small grained inbred lines by selecting for small grain and xenia for grain-size. Novenytermeles 1986, 35, 377–382. [Google Scholar]
- Seka, D.; Cross, H.Z. Xenia and Maternal Effects on Maize Kernel Development. Crop Sci. 1995, 35, 80–85. [Google Scholar] [CrossRef]
- Seka, D.; Cross, H.Z.; McClean, P.E. Maize Kernel Development in Vitro: Sucrose Concentration, Xenia, and Maternal Effects. Crop Sci. 1995, 35, 74–79. [Google Scholar] [CrossRef]
- Bulant, C.; Gallais, A. Xenia Effects in Maize with Normal Endosperm: I. Importance and Stability. Crop Sci. 1998, 38, 1517–1525. [Google Scholar] [CrossRef]
- Bulant, C.; Gallais, A.; Matthys-Rochon, E.; Prioul, J.L. Xenia Effects in Maize with Normal Endosperm: II. Kernel Growth and Enzyme Activities during Grain Filling. Crop Sci. 2000, 40, 182–189. [Google Scholar] [CrossRef]
- Liu, Y.-E.; Liu, P.; Dong, S.-T.; Zhang, J.-W. Hormonal Changes Caused by the Xenia Effect during Grain Filling of Normal Corn and High-Oil Corn Crosses. Crop Sci. 2010, 50, 215–221. [Google Scholar] [CrossRef]
- Bozinovic, S.; Prodanovic, S.; Vancetovic, J.; Nikolic, A.; Ristic, D.; Kostadinovic, M.; Ignjatovic, D. Individual and Combined (Plus-Hybrid) Effect of Cytoplasmic Male Sterility and Xenia on Maize Grain Yield. Chil. J. Agric. Res. 2015, 75, 160–167. [Google Scholar] [CrossRef]
- Kahriman, F.; Şerment, M.; Haşlak, M.; Kang, M.S. Pollen Effect (Xenia) for Evaluating Breeding Materials in Maize. Genetika 2017, 49, 217–234. [Google Scholar] [CrossRef]
- von Gärtner, C.F. Versuche und Beobachtungen Über Die Bastarderzeugung Im Pflanzenreich; KF Hering: Stuttgart, Germany, 1849. [Google Scholar]
- Rognon, R.; Nuce de Lamothe, M.D. Xenia and Combining Ability in the Coconut; Oleagineux: Paris, France, 1976. [Google Scholar]
- Heijerman-Peppelman, G.; Bucarciuc, V.; Kemp, H.; Pasat, O. “Xenia”, a New Pear Cultivar from Moldova, First Results in The Netherlands. In Proceedings of the XII EUCARPIA Symposium on Fruit Breeding and Genetics 814, Zaragoza, Spain, 16 September 2007; pp. 305–308. [Google Scholar]
- Sabir, A. Xenia and Metaxenia in Grapes: Differences in Berry and Seed Characteristics of Maternal Grape Cv.‘Narince’(Vitis vinifera L.) as Influenced by Different Pollen Sources. Plant Biol. 2015, 17, 567–573. [Google Scholar] [CrossRef] [PubMed]
- Bernáth, J.; Németh, É.; Petheõ, F.; Friedt, W. Alkaloid Accumulation in Capsules of the Selfed and Cross-Pollinated Poppy. Plant Breed. 2003, 122, 263–267. [Google Scholar] [CrossRef]
- Tsuda, M.; Konagaya, K.; Okuzaki, A.; Kaneko, Y.; Tabei, Y. Occurrence of Metaxenia and False Hybrids in Brassica juncea L. Cv. Kikarashina × B. napus. Breed. Sci. 2011, 61, 358–365. [Google Scholar] [CrossRef] [PubMed]
- Miller, S.; Alspach, P.; Scalzo, J.; Meekings, J. Pollination of ‘Hortblue Petite’ Blueberry: Evidence of Metaxenia in a New Ornamental Home-Garden Cultivar. HortScience 2011, 46, 1468–1471. [Google Scholar] [CrossRef]
- Lukić, M.; Marić, S.; Milosević, N.; Mitrović, O. Effect of Metaxenia on Pomological Traits of’Topaz’apple Cultivar. In Proceedings of the III Balkan Symposium on Fruit Growing 1139, Belgrade, Serbia, 16–18 September 2015; pp. 329–334. [Google Scholar]
- Militaru, M.; Butac, M.; Sumedrea, D.; Chiţu, E. Effect of Metaxenia on the Fruit Quality of Scab Resistant Apple Varieties. Agric. Agric. Sci. Procedia 2015, 6, 151–156. [Google Scholar] [CrossRef]
- Fattahi, R.; Mohammadzedeh, M.; Khadivi-Khub, A. Influence of Different Pollen Sources on Nut and Kernel Characteristics of Hazelnut. Sci. Hortic. 2014, 173, 15–19. [Google Scholar] [CrossRef]
- Rezazadeh, R.; Hassanzadeh, H.; Hosseini, Y.; Karami, Y.; Williams, R.R. Influence of Pollen Source on Fruit Production of Date Palm (Phoenix dactylifera L.) Cv. Barhi in Humid Coastal Regions of Southern Iran. Sci. Hortic. 2013, 160, 182–188. [Google Scholar] [CrossRef]
- Maryam Jaskani, M.J.; Naqvi, S.A. Date Palm Pollen Storage and Viability. Date Palm Biotechnol. Protoc. 2017, 2, 3–14. [Google Scholar]
- Tucker, Z.; Chavez, D.J.; Chaparro, J.X. Effect of the Seedlessness (Fs) Gene in Fruit Quality Traits in Mandarin Segregating Populations. J. Am. Pomol. Soc. 2017, 71, 29–33. [Google Scholar]
- Davies, D.R. Studies of Seed Development in Pisum sativum: I. Seed Size in Reciprocal Crosses. Planta 1975, 124, 297–302. [Google Scholar] [CrossRef] [PubMed]
- Allen, R.S.; Li, J.; Stahle, M.I.; Dubroué, A.; Gubler, F.; Millar, A.A. Genetic Analysis Reveals Functional Redundancy and the Major Target Genes of the Arabidopsis MiR159 Family. Proc. Natl. Acad. Sci. USA 2007, 104, 16371–16376. [Google Scholar] [CrossRef]
- Zhang, Y.-C.; Yu, Y.; Wang, C.-Y.; Li, Z.-Y.; Liu, Q.; Xu, J.; Liao, J.-Y.; Wang, X.-J.; Qu, L.-H.; Chen, F. Overexpression of MicroRNA OsmiR397 Improves Rice Yield by Increasing Grain Size and Promoting Panicle Branching. Nat. Biotechnol. 2013, 31, 848. [Google Scholar] [CrossRef]
- UN. Probabilistic Population Projections Database, United Nations—Population; UN: New York, NY, USA, 2019. [Google Scholar]
- Sari, H.; Sari, D.; Eker, T.; Toker, C. De Novo Super-Early Progeny in Interspecific Crosses Pisum sativum L. × P. fulvum Sibth. et Sm. Sci. Rep. 2021, 11, 19706. [Google Scholar] [CrossRef] [PubMed]
- Esen, A.; Sari, H.; Erler, F.; Adak, A.; Sari, D.; Eker, T.; Canci, H.; Ikten, C.; Kahraman, A.; Toker, C. Screening and Selection of Accessions in the Genus Pisum L. for Resistance to Pulse Beetle (Callosobruchus chinensis L.). Euphytica 2019, 215, 82. [Google Scholar] [CrossRef]
- Chrigui, N.; Sari, D.; Sari, H.; Eker, T.; Cengiz, M.F.; Ikten, C.; Toker, C. Introgression of Resistance to Leafminer (Liriomyza cicerina Rondani) from Cicer reticulatum Ladiz. to C. arietinum L. and Relationships between Potential Biochemical Selection Criteria. Agronomy 2020, 11, 57. [Google Scholar] [CrossRef]
- Bimurzayev, N.; Sari, H.; Kurunc, A.; Doganay, K.H.; Asmamaw, M. Effects of Different Salt Sources and Salinity Levels on Emergence and Seedling Growth of Faba Bean Genotypes. Sci. Rep. 2021, 11, 18198. [Google Scholar] [CrossRef]
- Eker, T.; Sari, H.; Sari, D.; Canci, H.; Arslan, M.; Aydinoglu, B.; Ozay, H.; Toker, C. Advantage of Multiple Pods and Compound Leaf in Kabuli Chickpea under Heat Stress Conditions. Agronomy 2022, 12, 557. [Google Scholar] [CrossRef]
- Watson, A.; Ghosh, S.; Williams, M.J.; Cuddy, W.S.; Simmonds, J.; Rey, M.-D.; Asyraf Md Hatta, M.; Hinchliffe, A.; Steed, A.; Reynolds, D.; et al. Speed Breeding Is a Powerful Tool to Accelerate Crop Research and Breeding. Nat. Plants 2018, 4, 23–29. [Google Scholar] [CrossRef]
- Ghosh, S.; Watson, A.; Gonzalez-Navarro, O.E.; Ramirez-Gonzalez, R.H.; Yanes, L.; Mendoza-Suárez, M.; Simmonds, J.; Wells, R.; Rayner, T.; Green, P.; et al. Speed Breeding in Growth Chambers and Glasshouses for Crop Breeding and Model Plant Research. Nat. Protoc. 2018, 13, 2944–2963. [Google Scholar] [CrossRef] [PubMed]
- ter Steeg, E.M.S.; Struik, P.C.; Visser, R.G.F.; Lindhout, P. Crucial Factors for the Feasibility of Commercial Hybrid Breeding in Food Crops. Nat. Plants 2022, 8, 463–473. [Google Scholar] [CrossRef] [PubMed]
- Sari, H.; Eker, T.; Tosun, H.S.; Mutlu, N.; Celik, I.; Toker, C. Mapping QTLs for Super-Earliness and Agro-Morphological Traits in RILs Population Derived from Interspecific Crosses between Pisum sativum × P. fulvum. Curr. Issues Mol. Biol. 2023, 45, 663–676. [Google Scholar] [CrossRef]
- Alzate-Marin, A.L.; Baía, G.S.; Martins Filho, S.; de Paula Júnior, T.J.; Sediyama, C.S.; de Barros, E.G.; Moreira, M.A. Use of RAPD-PCR to Identify True Hybrid Plants from Crosses between Closely Related Progenitors. Braz. J. Genet. 1996, 19, 621–623. [Google Scholar] [CrossRef]
- Kosterin, O.E.; Bogdanova, V.S.; Galieva, E.R. Reciprocal Compatibility within the Genus Pisum L. as Studied in F1 Hybrids: 2. Crosses Involving P. fulvum Sibth. et Smith. Genet. Resour. Crop Evol. 2019, 66, 383–399. [Google Scholar] [CrossRef]
- Ochatt, S.J.; Benabdelmouna, A.; Marget, P.; Aubert, G.; Moussy, F.; Pontécaille, C.; Jacas, L. Overcoming Hybridization Barriers between Pea and Some of Its Wild Relatives. Euphytica 2004, 137, 353–359. [Google Scholar] [CrossRef]
- de Morais, S.R.P.; Vieira, A.F.; da Silva Almeida, L.C.; Rodrigues, L.A.; Melo, P.G.S.; de Faria, L.C.; Melo, L.C.; Pereira, H.S.; de Souza, T.L.P.O. Application of Microsatellite Markers to Confirm Controlled Crosses and Assess Genetic Identity in Common Bean. Crop Breed. Appl. Biotechnol. 2016, 16, 234–239. [Google Scholar] [CrossRef]
- Byrne, O.M.; Hardie, D.C.; Khan, T.N.; Speijers, J.; Yan, G. Genetic Analysis of Pod and Seed Resistance to Pea Weevil in a Pisum sativum × P. fulvum Interspecific Cross. Aust. J. Agric. Res. 2008, 59, 854–862. [Google Scholar] [CrossRef]
- Gangurde, S.S.; Khan, A.W.; Janila, P.; Variath, M.T.; Manohar, S.S.; Singam, P.; Chitikineni, A.; Varshney, R.K.; Pandey, M.K. Whole-Genome Sequencing Based Discovery of Candidate Genes and Diagnostic Markers for Seed Weight in Groundnut. Plant Genome 2022, e20265. [Google Scholar] [CrossRef]
- Parmar, S.; Deshmukh, D.B.; Kumar, R.; Manohar, S.S.; Joshi, P.; Sharma, V.; Chaudhari, S.; Variath, M.T.; Gangurde, S.S.; Bohar, R. Single Seed-Based High-Throughput Genotyping and Rapid Generation Advancement for Accelerated Groundnut Genetics and Breeding Research. Agronomy 2021, 11, 1226. [Google Scholar] [CrossRef]
Crosses | Species | Parents and Hybrids | Seed Color | Shape of Seed Coat |
---|---|---|---|---|
Intraspecific | P. sativum subsp. sativum var. sativum | ACP 20 (♀) | Green | Wrinkled |
P. sativum subsp. sativum var. arvense | ACP 101 (♂) | Dun | Smooth | |
Hybrid | Green | Smooth | ||
P. sativum subsp. sativum var. sativum | ACP 20 (♀) | Green | Wrinkled | |
P. sativum subsp. sativum var. arvense | ACP 01 (♂) | Brown-dun | Smooth | |
Hybrid | Green | Smooth | ||
P. sativum subsp. sativum var. sativum | ACP 11 (♀) | Green | Smooth | |
P. sativum subsp. sativum var. arvense | ACP 101 (♂) | Dun | Smooth | |
Hybrid | Cream | Smooth | ||
Interspecific | P. sativum subsp. sativum var. arvense | ACP 101 (♀) | Dun | Smooth |
P. sativum subsp. elatius | AWP 440 (♂) | Dun-black spotted | Smooth | |
Hybrid | Dun-black spotted | Smooth | ||
P. sativum subsp. sativum var. arvense | ACP 13 (♀) | Brown-dun | Smooth | |
P. fulvum | AWP 600 (♂) | Black | Smooth | |
Hybrid | Dark brown | Smooth | ||
P. sativum subsp. sativum var. sativum | ACP 20 (♀) | Green | Wrinkled | |
P. fulvum | AWP 600 (♂) | Black | Smooth | |
Hybrid | Black | Smooth | ||
P. sativum subsp. elatius | AWP 442 (♀) | Dark green-black spotted | Smooth | |
P. fulvum | AWP 601 (♂) | Brown | Smooth | |
Hybrid | Green | Smooth |
PRIMERS | FORWARD (5′-3′) | REVERSE (3′-5′) |
---|---|---|
D21 | TATTCTCCTCCAAAATTTCCTT | GTCAAAATTAGCCAAATTCCTC |
AA205 | TACGCAATCATAGAGTTTGGAA | AATCAAGTCAATGAAACAAGCA |
AC58 | TCCGCAATTTGGTAACACTG | CGTCCATTTCTTTTATGCTGAG |
AD59 | TTGGAGAATGTCTTCTCTTTAG | GTATATTTTCACTCAGAGGCAC |
Crosses | Species | Parents and Hybrids | SSRs | |||
---|---|---|---|---|---|---|
D21 | AA205 | AC58 | AD59 | |||
Intraspecific | P. sativum subsp. sativum var. sativum | ACP 20 (♀) | 218/292 | 253 | 219/222 | 339 |
P. sativum subsp. sativum var. arvense | ACP 101 (♂) | 296 | 249 | 228 | 339 | |
Hybrid | 218/296 | 249/253 | 219/228 | 339/339 | ||
P. sativum subsp. sativum var. sativum | ACP 20 (♀) | 218/292 | 253 | 219/222 | 339 | |
P. sativum subsp. sativum var. arvense | ACP 01 (♂) | 296 | 253 | 228 | NA | |
Hybrid | 218/296 | 253/253 | 219/228 | 339 | ||
Interspecific | P. sativum subsp. sativum var. arvense | ACP 101 (♀) | 296 | 249 | 228 | 339 |
P. sativum subsp. elatius | AWP 440 (♂) | 260 | 258 | 213 | 339 | |
Hybrid | 260/296 | 249/258 | 213/228 | 339/339 | ||
P. sativum subsp. sativum var. sativum | ACP 20 (♀) | 218/292 | 253 | 219/222 | 339 | |
P. fulvum | AWP 600 (♂) | 296 | 224 | 213/228 | 335/339 | |
Hybrid | 218/296 | NA/224 | 222/213 | 339/339 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sari, H.; Eker, T.; Sari, D.; Aksoy, M.; Bakır, M.; Dogdu, V.; Toker, C.; Canci, H. The Fastest and Most Reliable Identification of True Hybrids in the Genus Pisum L. Life 2023, 13, 2222. https://0-doi-org.brum.beds.ac.uk/10.3390/life13112222
Sari H, Eker T, Sari D, Aksoy M, Bakır M, Dogdu V, Toker C, Canci H. The Fastest and Most Reliable Identification of True Hybrids in the Genus Pisum L. Life. 2023; 13(11):2222. https://0-doi-org.brum.beds.ac.uk/10.3390/life13112222
Chicago/Turabian StyleSari, Hatice, Tuba Eker, Duygu Sari, Munevver Aksoy, Melike Bakır, Veysel Dogdu, Cengiz Toker, and Huseyin Canci. 2023. "The Fastest and Most Reliable Identification of True Hybrids in the Genus Pisum L." Life 13, no. 11: 2222. https://0-doi-org.brum.beds.ac.uk/10.3390/life13112222