The Role of Grifola frondosa Polysaccharide in Preventing Skeletal Muscle Atrophy in Type 2 Diabetes Mellitus
Abstract
:1. Introduction
2. Materials and Methods
2.1. Preparation of GFP
2.2. Animals
2.3. Body Weight, Blood Glucose Level, and Glucose Tolerance Test
2.4. Enzyme-Linked Immunosorbent Assay (ELISA)
2.5. Real-Time Quantitative PCR (RT-qPCR)
2.6. Histopathological Analysis (HE)
2.7. Immunohistochemistry (IHC)
2.8. Western Blotting (WB)
2.9. Molecular Docking (MD)
2.10. Statistical Analysis Method
3. Results
3.1. GFP Prevented Hyperglycemia, Insulin Resistance, and Weight Loss in T2DM Rats
3.2. GFP Enhanced Intestinal Barrier Function in T2DM Rats
3.3. GFP Alleviated Intestinal Mucosal Barrier Injury and Inflammation in T2DM Rats
3.4. GFP Ameliorated the Inflammation in Skeletal Muscle in T2DM Rats
3.5. GFP Prevented Skeletal Muscle Atrophy in T2DM Rats
3.6. GFP Inhibited Inflammation and Prevented Skeletal Muscle Atrophy in T2DM Rats
3.7. Molecular Docking of Monosaccharides Constituting GFP with Markers of Inflammation and Atrophy in Skeletal Muscle
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- DeFronzo, R.A.; Ferrannini, E.; Groop, L.; Henry, R.R.; Herman, W.H.; Holst, J.J.; Hu, F.B.; Kahn, C.R.; Raz, I.; Shulman, G.I.; et al. Type 2 diabetes mellitus. Nat. Rev. Dis. Primers 2015, 1, 15019. [Google Scholar] [CrossRef] [PubMed]
- Bailey, C.J. Potential new treatments for type 2 diabetes. Trends Pharmacol. Sci. 2000, 21, 259–265. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Zhang, J.; Cheng, Y.; Zhu, M.; Xiao, Z.; Ruan, G.; Wei, Y. Gut microbiota: A new target for T2DM prevention and treatment. Front. Endocrinol. 2022, 13, 958218. [Google Scholar] [CrossRef] [PubMed]
- Saeedi, P.; Petersohn, I.; Salpea, P.; Malanda, B.; Karuranga, S.; Unwin, N.; Colagiuri, S.; Guariguata, L.; Motala, A.A.; Ogurtsova, K.; et al. Global and regional diabetes prevalence estimates for 2019 and projections for 2030 and 2045: Results from the International Diabetes Federation Diabetes Atlas, 9(th) edition. Diabetes Res. Clin. Pract. 2019, 157, 107843. [Google Scholar] [CrossRef] [PubMed]
- Huang, B.K.; Monu, J.U.; Doumanian, J. Diabetic myopathy: MRI patterns and current trends. AJR Am. J. Roentgenol. 2010, 195, 198–204. [Google Scholar] [CrossRef] [PubMed]
- Jun, L.; Robinson, M.; Geetha, T.; Broderick, T.L.; Babu, J.R. Prevalence and Mechanisms of Skeletal Muscle Atrophy in Metabolic Conditions. Int. J. Mol. Sci. 2023, 24, 2973. [Google Scholar] [CrossRef] [PubMed]
- Huang, L.; Li, M.; Deng, C.; Qiu, J.; Wang, K.; Chang, M.; Zhou, S.; Gu, Y.; Shen, Y.; Wang, W.; et al. Potential Therapeutic Strategies for Skeletal Muscle Atrophy. Antioxidants 2022, 12, 44. [Google Scholar] [CrossRef] [PubMed]
- Tilg, H.; Zmora, N.; Adolph, T.E.; Elinav, E. The intestinal microbiota fuelling metabolic inflammation. Nat. Rev. Immunol. 2020, 20, 40–54. [Google Scholar] [CrossRef] [PubMed]
- Yin, L.; Li, N.; Jia, W.; Wang, N.; Liang, M.; Yang, X.; Du, G. Skeletal muscle atrophy: From mechanisms to treatments. Pharmacol. Res. 2021, 172, 105807. [Google Scholar] [CrossRef]
- Perry, B.D.; Caldow, M.K.; Brennan-Speranza, T.C.; Sbaraglia, M.; Jerums, G.; Garnham, A.; Wong, C.; Levinger, P.; Asrar Ul Haq, M.; Hare, D.L.; et al. Muscle atrophy in patients with Type 2 Diabetes Mellitus: Roles of inflammatory pathways, physical activity and exercise. Exerc. Immunol. Rev. 2016, 22, 94–109. [Google Scholar]
- Cani, P.D.; Bibiloni, R.; Knauf, C.; Waget, A.; Neyrinck, A.M.; Delzenne, N.M.; Burcelin, R. Changes in gut microbiota control metabolic endotoxemia-induced inflammation in high-fat diet-induced obesity and diabetes in mice. Diabetes 2008, 57, 1470–1481. [Google Scholar] [CrossRef] [PubMed]
- Charitos, I.A.; Aliani, M.; Tondo, P.; Venneri, M.; Castellana, G.; Scioscia, G.; Castellaneta, F.; Lacedonia, D.; Carone, M. Biomolecular Actions by Intestinal Endotoxemia in Metabolic Syndrome. Int. J. Mol. Sci. 2024, 25, 2841. [Google Scholar] [CrossRef] [PubMed]
- Lahiri, S.; Kim, H.; Garcia-Perez, I.; Reza, M.M.; Martin, K.A.; Kundu, P.; Cox, L.M.; Selkrig, J.; Posma, J.M.; Zhang, H.; et al. The gut microbiota influences skeletal muscle mass and function in mice. Sci. Transl. Med. 2019, 11, 107843. [Google Scholar] [CrossRef] [PubMed]
- Shan, Z.; Cheng, N.; Zhu, J.; Chen, F.; Ji, J.; Meilibana. Analysis of intestinal flora in elderly Uygur patients with sarcopenia. Immun. Inflamm. Dis. 2024, 12, e1097. [Google Scholar] [CrossRef] [PubMed]
- Bindels, L.B.; Beck, R.; Schakman, O.; Martin, J.C.; De Backer, F.; Sohet, F.M.; Dewulf, E.M.; Pachikian, B.D.; Neyrinck, A.M.; Thissen, J.P.; et al. Restoring specific lactobacilli levels decreases inflammation and muscle atrophy markers in an acute leukemia mouse model. PLoS ONE 2012, 7, e37971. [Google Scholar] [CrossRef] [PubMed]
- Baek, J.S.; Shin, Y.J.; Ma, X.; Park, H.S.; Hwang, Y.H.; Kim, D.H. Bifidobacterium bifidum and Lactobacillus paracasei alleviate sarcopenia and cognitive impairment in aged mice by regulating gut microbiota-mediated AKT, NF-κB, and FOXO3a signaling pathways. Immun. Ageing 2023, 20, 56. [Google Scholar] [CrossRef] [PubMed]
- Lee, M.C.; Tu, Y.T.; Lee, C.C.; Tsai, S.C.; Hsu, H.Y.; Tsai, T.Y.; Liu, T.H.; Young, S.L.; Lin, J.S.; Huang, C.C. Lactobacillus plantarum TWK10 Improves Muscle Mass and Functional Performance in Frail Older Adults: A Randomized, Double-Blind Clinical Trial. Microorganisms 2021, 9, 1466. [Google Scholar] [CrossRef]
- van Krimpen, S.J.; Jansen, F.A.C.; Ottenheim, V.L.; Belzer, C.; van der Ende, M.; van Norren, K. The Effects of Pro-, Pre-, and Synbiotics on Muscle Wasting, a Systematic Review-Gut Permeability as Potential Treatment Target. Nutrients 2021, 13, 1115. [Google Scholar] [CrossRef]
- Huo, J.; Wu, Z.; Sun, W.; Wang, Z.; Wu, J.; Huang, M.; Wang, B.; Sun, B. Protective Effects of Natural Polysaccharides on Intestinal Barrier Injury: A Review. J. Agric. Food Chem. 2022, 70, 711–735. [Google Scholar] [CrossRef]
- Zhang, T.; Yang, Y.; Liang, Y.; Jiao, X.; Zhao, C. Beneficial Effect of Intestinal Fermentation of Natural Polysaccharides. Nutrients 2018, 10, 1055. [Google Scholar] [CrossRef]
- Chen, X.; Chen, C.; Fu, X. Dendrobium officinale Polysaccharide Alleviates Type 2 Diabetes Mellitus by Restoring Gut Microbiota and Repairing Intestinal Barrier via the LPS/TLR4/TRIF/NF-kB Axis. J. Agric. Food Chem. 2023, 71, 11929–11940. [Google Scholar] [CrossRef]
- Chen, X.; Wu, J.; Fu, X.; Wang, P.; Chen, C. Fructus mori polysaccharide alleviates diabetic symptoms by regulating intestinal microbiota and intestinal barrier against TLR4/NF-κB pathway. Int. J. Biol. Macromol. 2023, 249, 126038. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Guo, W.L.; Zhang, W.; Xu, J.X.; Qian, M.; Bai, W.D.; Zhang, Y.Y.; Rao, P.F.; Ni, L.; Lv, X.C. Grifola frondosa polysaccharides ameliorate lipid metabolic disorders and gut microbiota dysbiosis in high-fat diet fed rats. Food Funct. 2019, 10, 2560–2572. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Liu, D.; Wang, D.; Lai, S.; Zhong, R.; Liu, Y.; Yang, C.; Liu, B.; Sarker, M.R.; Zhao, C. Hypoglycemic activity and gut microbiota regulation of a novel polysaccharide from Grifola frondosa in type 2 diabetic mice. Food Chem. Toxicol. Int. J. Publ. Br. Ind. Biol. Res. Assoc. 2019, 126, 295–302. [Google Scholar] [CrossRef] [PubMed]
- Jiang, T.; Shen, S.; Wang, L.; Zhao, M.; Li, Y.; Huang, S. Grifola frondosa Polysaccharide Ameliorates Early Diabetic Nephropathy by Suppressing the TLR4/NF-κB Pathway. Appl. Biochem. Biotechnol. 2022, 194, 4093–4104. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Chen, S.; Liu, H.; Xie, J.; Hasan, K.M.F.; Zeng, Q.; Wei, S.; Luo, P. Structural properties and anti-inflammatory activity of purified polysaccharides from Hen-of-the-woods mushrooms (Grifola frondosa). Front. Nutr. 2023, 10, 1078868. [Google Scholar] [CrossRef]
- Li, W.; Chen, W.; Ma, H.; Wang, J.; Li, Z.; Wang, Q.; Zhang, Z.; Wu, D.; Zhang, J.; Yang, Y. Study on the relationship between structure and taste activity of the umami peptide of Stropharia rugosoannulata prepared by ultrasound. Ultrason. Sonochem. 2022, 90, 106206. [Google Scholar] [CrossRef] [PubMed]
- Giron, M.; Thomas, M.; Dardevet, D.; Chassard, C.; Savary-Auzeloux, I. Gut microbes and muscle function: Can probiotics make our muscles stronger? J. Cachexia Sarcopenia Muscle 2022, 13, 1460–1476. [Google Scholar] [CrossRef] [PubMed]
- Ji, Y.; Li, M.; Chang, M.; Liu, R.; Qiu, J.; Wang, K.; Deng, C.; Shen, Y.; Zhu, J.; Wang, W.; et al. Inflammation: Roles in Skeletal Muscle Atrophy. Antioxidants 2022, 11, 1686. [Google Scholar] [CrossRef]
- Riedel, S.; Pheiffer, C.; Johnson, R.; Louw, J.; Muller, C.J.F. Intestinal Barrier Function and Immune Homeostasis Are Missing Links in Obesity and Type 2 Diabetes Development. Front. Endocrinol. 2021, 12, 833544. [Google Scholar] [CrossRef]
- Shen, L.; Ao, L.; Xu, H.; Shi, J.; You, D.; Yu, X.; Xu, W.; Sun, J.; Wang, F. Poor short-term glycemic control in patients with type 2 diabetes impairs the intestinal mucosal barrier: A prospective, single-center, observational study. BMC Endocr. Disord. 2019, 19, 29. [Google Scholar] [CrossRef]
- Pussinen, P.J.; Havulinna, A.S.; Lehto, M.; Sundvall, J.; Salomaa, V. Endotoxemia is associated with an increased risk of incident diabetes. Diabetes Care 2011, 34, 392–397. [Google Scholar] [CrossRef]
- Zheng, Y.; Gou, X.; Zhang, L.; Gao, H.; Wei, Y.; Yu, X.; Pang, B.; Tian, J.; Tong, X.; Li, M. Interactions between Gut Microbiota, Host, and Herbal Medicines: A Review of New Insights into the Pathogenesis and Treatment of Type 2 Diabetes. Front. Cell. Infect. Microbiol. 2020, 10, 360. [Google Scholar] [CrossRef]
- Rohm, T.V.; Meier, D.T.; Olefsky, J.M.; Donath, M.Y. Inflammation in obesity, diabetes, and related disorders. Immunity 2022, 55, 31–55. [Google Scholar] [CrossRef] [PubMed]
- Okdahl, T.; Wegeberg, A.M.; Pociot, F.; Brock, B.; Størling, J.; Brock, C. Low-grade inflammation in type 2 diabetes: A cross-sectional study from a Danish diabetes outpatient clinic. BMJ Open 2022, 12, e062188. [Google Scholar] [CrossRef] [PubMed]
- Lopez-Pedrosa, J.M.; Camprubi-Robles, M.; Guzman-Rolo, G.; Lopez-Gonzalez, A.; Garcia-Almeida, J.M.; Sanz-Paris, A.; Rueda, R. The Vicious Cycle of Type 2 Diabetes Mellitus and Skeletal Muscle Atrophy: Clinical, Biochemical, and Nutritional Bases. Nutrients 2024, 16, 172. [Google Scholar] [CrossRef] [PubMed]
- Cohen, S.; Nathan, J.A.; Goldberg, A.L. Muscle wasting in disease: Molecular mechanisms and promising therapies. Nat. Rev. Drug Discov. 2015, 14, 58–74. [Google Scholar] [CrossRef]
- Di Vincenzo, F.; Del Gaudio, A.; Petito, V.; Lopetuso, L.R.; Scaldaferri, F. Gut microbiota, intestinal permeability, and systemic inflammation: A narrative review. Intern. Emerg. Med. 2024, 19, 275–293. [Google Scholar] [CrossRef]
- Dai, Y.J.; Liu, W.B.; Abasubong, K.P.; Zhang, D.D.; Li, X.F.; Xiao, K.; Wang, X.; Jiang, G.Z. The Mechanism of Lipopolysaccharide Escaping the Intestinal Barrier in Megalobrama amblycephala Fed a High-Fat Diet. Front. Nutr. 2022, 9, 853409. [Google Scholar] [CrossRef]
- An, L.; Wirth, U.; Koch, D.; Schirren, M.; Drefs, M.; Koliogiannis, D.; Nieß, H.; Andrassy, J.; Guba, M.; Bazhin, A.V.; et al. The Role of Gut-Derived Lipopolysaccharides and the Intestinal Barrier in Fatty Liver Diseases. J. Gastrointest. Surg. Off. J. Soc. Surg. Aliment. Tract. 2022, 26, 671–683. [Google Scholar] [CrossRef]
- Violi, F.; Cammisotto, V.; Bartimoccia, S.; Pignatelli, P.; Carnevale, R.; Nocella, C. Gut-derived low-grade endotoxaemia, atherothrombosis and cardiovascular disease. Nat. Rev. Cardiol. 2023, 20, 24–37. [Google Scholar] [CrossRef] [PubMed]
- Liang, H.; Hussey, S.E.; Sanchez-Avila, A.; Tantiwong, P.; Musi, N. Effect of lipopolysaccharide on inflammation and insulin action in human muscle. PLoS ONE 2013, 8, e63983. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J.; Huang, Y.; Yu, X. A Narrative Review of Gut-Muscle Axis and Sarcopenia: The Potential Role of Gut Microbiota. Int. J. Gen. Med. 2021, 14, 1263–1273. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.P.; Chen, Y.; John, J.; Moylan, J.; Jin, B.; Mann, D.L.; Reid, M.B. TNF-alpha acts via p38 MAPK to stimulate expression of the ubiquitin ligase atrogin1/MAFbx in skeletal muscle. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 2005, 19, 362–370. [Google Scholar] [CrossRef] [PubMed]
- Ono, Y.; Sakamoto, K. Lipopolysaccharide inhibits myogenic differentiation of C2C12 myoblasts through the Toll-like receptor 4-nuclear factor-κB signaling pathway and myoblast-derived tumor necrosis factor-α. PLoS ONE 2017, 12, e0182040. [Google Scholar] [CrossRef] [PubMed]
- Scheele, C.; Nielsen, S.; Kelly, M.; Broholm, C.; Nielsen, A.R.; Taudorf, S.; Pedersen, M.; Fischer, C.P.; Pedersen, B.K. Satellite cells derived from obese humans with type 2 diabetes and differentiated into myocytes in vitro exhibit abnormal response to IL-6. PLoS ONE 2012, 7, e39657. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Pan, J.; Dong, Y.; Tweardy, D.J.; Dong, Y.; Garibotto, G.; Mitch, W.E. Stat3 activation links a C/EBPδ to myostatin pathway to stimulate loss of muscle mass. Cell Metab. 2013, 18, 368–379. [Google Scholar] [CrossRef] [PubMed]
- Huang, X.; Nie, S.; Xie, M. Interaction between gut immunity and polysaccharides. Crit. Rev. Food Sci. Nutr. 2017, 57, 2943–2955. [Google Scholar] [CrossRef] [PubMed]
- Kang, Y.; Kang, X.; Yang, H.; Liu, H.; Yang, X.; Liu, Q.; Tian, H.; Xue, Y.; Ren, P.; Kuang, X.; et al. Lactobacillus acidophilus ameliorates obesity in mice through modulation of gut microbiota dysbiosis and intestinal permeability. Pharmacol. Res. 2022, 175, 106020. [Google Scholar] [CrossRef]
- Zhao, C.; Bao, L.; Qiu, M.; Wu, K.; Zhao, Y.; Feng, L.; Xiang, K.; Zhang, N.; Hu, X.; Fu, Y. Commensal cow Roseburia reduces gut-dysbiosis-induced mastitis through inhibiting bacterial translocation by producing butyrate in mice. Cell Rep. 2022, 41, 111681. [Google Scholar] [CrossRef]
- Vinolo, M.A.; Rodrigues, H.G.; Hatanaka, E.; Sato, F.T.; Sampaio, S.C.; Curi, R. Suppressive effect of short-chain fatty acids on production of proinflammatory mediators by neutrophils. J. Nutr. Biochem. 2011, 22, 849–855. [Google Scholar] [CrossRef] [PubMed]
Gene | Primer | Sequence |
---|---|---|
ZO-1 | Forward: | GGACGTTTATCGCCGCATTG |
Reverse: | TCCACGACCCGGAACACCT | |
Occludin | Forward: | AAAGCAGGGAAGGCGAAG |
Reverse: | TGTTGATCTGAAGTGATAGGTGG | |
TNF-α | Forward: | CTTCTCATTCCTGCTCGTGG |
Reverse: | TGATCTGAGTGTGAGGGTCTG | |
NF-κB p65 | Forward: | CTACGAGACCTTCAAGAGCATC |
Reverse: | GATGTTGAAAAGGCATAGGGC | |
FBXO32 | Forward: | CAACAGACTGGACTTCTCGAC |
Reverse: | GAAGTTCTTTTGGGCGATGC | |
TRIM63 | Forward: | CCCCTTACAAAGCATCTTCCA |
Reverse: | TGTTTTCCTTGGTCACTCGG | |
β-actin | Forward: | CACTTTCTACAATGAGCTGCG |
Reverse: | CTGGATGGCTACGTACATGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
She, Y.; Ma, Y.; Zou, P.; Peng, Y.; An, Y.; Chen, H.; Luo, P.; Wei, S. The Role of Grifola frondosa Polysaccharide in Preventing Skeletal Muscle Atrophy in Type 2 Diabetes Mellitus. Life 2024, 14, 784. https://0-doi-org.brum.beds.ac.uk/10.3390/life14070784
She Y, Ma Y, Zou P, Peng Y, An Y, Chen H, Luo P, Wei S. The Role of Grifola frondosa Polysaccharide in Preventing Skeletal Muscle Atrophy in Type 2 Diabetes Mellitus. Life. 2024; 14(7):784. https://0-doi-org.brum.beds.ac.uk/10.3390/life14070784
Chicago/Turabian StyleShe, Ying, Yun Ma, Pei Zou, Yang Peng, Yong An, Hang Chen, Peng Luo, and Shaofeng Wei. 2024. "The Role of Grifola frondosa Polysaccharide in Preventing Skeletal Muscle Atrophy in Type 2 Diabetes Mellitus" Life 14, no. 7: 784. https://0-doi-org.brum.beds.ac.uk/10.3390/life14070784