Improving the Knowledge on Distribution, Food Preferences and DNA Barcoding of Natura 2000 Protected Species Paracossulus thrips (Lepidoptera, Cossidae) in Romania
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Field Survey
2.2. The Identification of the Larval Host Plant
2.3. The Study of Adult Moths
2.4. Vegetation Analysis
2.5. Molecular Analysis
2.5.1. Sampling and Collection of Data
2.5.2. Sequence Analysis
3. Results
3.1. Biology
3.2. Vegetation Description
3.3. New Populations Identified in Romania
- Protected area ROSCI0238 Suatu–Cojocna–Crairât. Near Ploscoș (Valea Florilor) on Dealul Gorgan, four males of P. thrips were observed in 7 July 2015 by Sitar C. and Crișan A.
- Protected area ROSCI0238 Suatu–Cojocna–Crairât. In Cojocna, the larvae were present in the stems of P. tuberosa in the cemetery near the village on 18 September 2021. There is a high density of Phlomis plants at the edge of the cemetery. (Iacob G., Sitar C., Beldean M.) (Figure 5C,D).
- Protected area ROSCI0210 Râpa Lechința, near Lechința (Mureș County). On 14 August 2021, a light trap deployed by Iacob G. and Sitar C attracted a female P. thrips (Figure 5E,F).
- Protected area ROSCI0272 Vulcanii Noroioși of Pâclele Mari and Pâclele Mici. On 5 August 2015 a light trap deployed by Aurelian V.M. attracted a male P. thrips (Figure 5G,H).
3.4. Sequence Analysis
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
BOLD_ID | NCBI_ID | Species | Country | Reference Title | Authors | Collection Date |
---|---|---|---|---|---|---|
LON5690-17 | \ | Acossus terebra | Norway | iBOL Data Release | iBOL | 20 July 2010 |
LEFIF227-10 | HM874920 | Acossus terebra | Finland | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | \ |
GBMNC49256-20 | MF052579 | Catopta albonubilus | China | Using full-length metabarcoding and DNA barcoding to infer community assembly for speciose taxonomic groups: a case study. | Hao, M.-D. et al., 2020 | \ |
GBMNC49263-20 | MF051783 | Catopta albonubilus | China | Using full-length metabarcoding and DNA barcoding to infer community assembly for speciose taxonomic groups: a case study. | Hao, M.-D. et al., 2020 | \ |
GBMNC49258-20 | MF051921 | Catopta albonubilus | China | Using full-length metabarcoding and DNA barcoding to infer community assembly for speciose taxonomic groups: a case study. | Hao, M.-D. et al., 2020 | \ |
GBMNC49259-20 | MF051897 | Catopta albonubilus | China | Using full-length metabarcoding and DNA barcoding to infer community assembly for speciose taxonomic groups: a case study. | Hao, M.-D. et al., 2020 | \ |
GBMNC49260-20 | MF051847 | Catopta albonubilus | China | Using full-length metabarcoding and DNA barcoding to infer community assembly for speciose taxonomic groups: a case study. | Hao, M.-D. et al., 2020 | \ |
GBMNC49261-20 | MF051833 | Catopta albonubilus | China | Using full-length metabarcoding and DNA barcoding to infer community assembly for speciose taxonomic groups: a case study. | Hao, M.-D. et al., 2020 | \ |
GBMNC49262-20 | MF051788 | Catopta albonubilus | China | Using full-length metabarcoding and DNA barcoding to infer community assembly for speciose taxonomic groups: a case study. | Hao, M.-D. et al., 2020 | \ |
QUNOE344-12 | KC860946 | Catopta griseotincta | China | A brief review of genus Catopta Staudinger, 1899 (Lepidoptera: Cossidae) with description of a new species from China | Yakovlev, R.V. et al., 2013 | 30 July 2011 |
QUNOE345-12 | KC860945 | Catopta griseotincta | China | A brief review of genus Catopta Staudinger, 1899 (Lepidoptera: Cossidae) with description of a new species from China | Yakovlev, R.V. et al., 2013 | 30 July 2011 |
KC860946 | QUNOE344 | Catopta griseotincta | China | A brief review of genus Catopta Staudinger, 1899 (Lepidoptera: Cossidae) with description of a new species from China | Yakovlev, R.V. et al., 2013 | 30 July 2011 |
FBLMX240-11 | KX040722 | Cossus cossus | Germany | iBOL Data Release | iBOL | 14 July 2010 |
GWORZ171-10 | HM914074 | Cossus cossus | Italy | iBOL Data Release | iBOL | 20 July 1996 |
LON5692-17 | \ | Cossus cossus | Norway | iBOL Data Release | iBOL | 15 June 2013 |
PHLAH054-12 | KX045460 | Cossus cossus | Romania | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 26 July 1999 |
PHLAH357-12 | \ | Cossus cossus | Spain | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 1 September 2005 |
GBMNA30579-19 | MK440671 | Cossus cossus | Azerbaijan | A DNA-based description of a new carpenter moth species (Lepidoptera: Cossidae) from Morocco | Yakovlev, R.V. et al., 2019 | 1 July 2008 |
GBMNA30580-19 | MK440678 | Cossus cossus | Azerbaijan | A DNA-based description of a new carpenter moth species (Lepidoptera: Cossidae) from Morocco | Yakovlev, R.V. et al., 2019 | 1 July 2008 |
GBMNA30582-19 | MK440673 | Cossus cossus | Russia | A DNA-based description of a new carpenter moth species (Lepidoptera: Cossidae) from Morocco | Yakovlev, R.V. et al., 2019 | 3 June 2006 |
GBMNA30583-19 | MK440674 | Cossus cossus | Russia | A DNA-based description of a new carpenter moth species (Lepidoptera: Cossidae) from Morocco | Yakovlev, R.V. et al., 2019 | 3 June 2006 |
GBMNA30587-19 | MK440667 | Cossus cossus | Lebanon | A DNA-based description of a new carpenter moth species (Lepidoptera: Cossidae) from Morocco | Yakovlev, R.V. et al., 2019 | 1 May 2006 |
GBMNA30588-19 | MK440668 | Cossus cossus | Turkey | A DNA-based description of a new carpenter moth species (Lepidoptera: Cossidae) from Morocco | Yakovlev, R.V. et al., 2019 | 1 June 2002 |
GBMNA30589-19 | MK440669 | Cossus cossus | Turkey | A DNA-based description of a new carpenter moth species (Lepidoptera: Cossidae) from Morocco | Yakovlev, R.V. et al., 2019 | 1 June 2002 |
GBMNA30595-19 | MK440679 | Cossus cossus | Turkey | A DNA-based description of a new carpenter moth species (Lepidoptera: Cossidae) from Morocco | Yakovlev, R.V. et al., 2019 | 3 August 2005 |
LEATD168-13 | \ | Cossus cossus | Austria | DNA barcode library for Lepidoptera from South Tyrol and Tyrol (Italy, Austria)—Impetus for integrative species discrimination in the 21st Century | Huemer, P. & Heber, P.D.N., 2016 | 7 June 2013 |
PHLAI332-13 | \ | Cossus cossus | Austria | DNA barcode library for Lepidoptera from South Tyrol and Tyrol (Italy, Austria)—Impetus for integrative species discrimination in the 21st Century | Huemer, P. & Heber, P.D.N., 2016 | 2 June 2012 |
PHLAI333-13 | \ | Cossus cossus | Austria | DNA barcode library for Lepidoptera from South Tyrol and Tyrol (Italy, Austria)—Impetus for integrative species discrimination in the 21st Century | Huemer, P. & Heber, P.D.N., 2016 | 19 June 2012 |
PHLAC470-10 | JF860045 | Cossus cossus | Italy | DNA-barcoding von schmetterlingen (Lepidoptera) in Waldstandorten Südtirols (IT01 ritten und IT02 montiggl) | Huemer, P. & Hebert, P.D.N., 2012 | 4 June 2010 |
GBGL13644-14 | KC791441 | Cossus cossus | China | Forest Resource Conservation Department, Key Laboratory for Silviculture and Conservation of Ministry of Education | Li, J. & Chen, M. | 10 August 2012 |
GBGL13645-14 | KC791442 | Cossus cossus | China | Forest Resource Conservation Department, Key Laboratory for Silviculture and Conservation of Ministry of Education | Li, J. & Chen, M. | 10 August 2012 |
GWOR4165-09 | KX070766 | Cossus cossus | Germany | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 23 June 2008 |
ODOPE724-11 | KX040920 | Cossus cossus | Germany | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 17 June 2005 |
ODOPE725-11 | KX040085 | Cossus cossus | Germany | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 28 June 2008 |
PHLAG857-12 | \ | Cossus cossus | Germany | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 7 June 1991 |
PHLAG861-12 | \ | Cossus cossus | Italy | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 22 August 1993 |
PHLAG862-12 | \ | Cossus cossus | Italy | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 10 July 1994 |
PHLAG864-12 | \ | Cossus cossus | Austria | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 24 June 1994 |
PHLAG865-12 | \ | Cossus cossus | Austria | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 14 March 2002 |
PHLAG866-12 | \ | Cossus cossus | Austria | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 5 July 1989 |
LEFIB066-10 | HM870975 | Cossus cossus | Finlad | Testing DNA Barcode Performance in 1000 Species of European Lepidoptera: Large Geographic Distances Have Small Genetic Impacts | Huemer, P. et al., 2014 | / |
PHLAG872-12 | KM572562 | Cossus cossus | Austria | Testing DNA Barcode Performance in 1000 Species of European Lepidoptera: Large Geographic Distances Have Small Genetic Impacts | Huemer, P. et al., 2014 | 28 June 2011 |
LEFID742-10 | HM873499 | Cossus cossus | Finland | Testing DNA Barcode Performance in 1000 Species of European Lepidoptera: Large Geographic Distances Have Small Genetic Impacts | Huemer, P. et al., 2014 | 14 July 2007 |
GBMNA30593-19 | MK440665 | Cossus cossus albescens | Spain | A DNA-based description of a new carpenter moth species (Lepidoptera: Cossidae) from Morocco | Yakovlev, R.V. et al., 2019 | 29 June 1990 |
GBMNA30594-19 | MK440666 | Cossus cossus albescens | Spain | A DNA-based description of a new carpenter moth species (Lepidoptera: Cossidae) from Morocco | Yakovlev, R.V. et al., 2019 | 16 June 2007 |
GBGL26652-19 | MG279391 | Dervishiya cadambae | India | First report of occurrence of Dervishiya cadambae (Moore, 1865) on grapes, Vitis vinifera L. in India Unpublished | Yadav, D.S. et al. | \ |
PHLAE163-11 | JN307399 | Dyspessa psychidion | Greece | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 19 May 2009 |
PHLAE164-11 | JN307400 | Dyspessa psychidion | Greece | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 19 May 2009 |
PHLAG166-12 | \ | Dyspessa psychidion | Greece | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 16 May 2009 |
GBMND20662-21 | MW170375 | Dyspessa salicicola | Armenia | A new species of Carpenter-Moths (Lepidoptera, Cossidae) from Tarbagatai (NE Kazakhstan) and Altai (SW Siberia, Russia) Mountains | Yakovlev, R.V. et al., 2020 | \ |
GBMND20663-21 | MW170376 | Dyspessa salicicola | Armenia | A new species of Carpenter-Moths (Lepidoptera, Cossidae) from Tarbagatai (NE Kazakhstan) and Altai (SW Siberia, Russia) Mountains | Yakovlev, R.V. et al., 2020 | \ |
GBMND20665-21 | MW170379 | Dyspessa salicicola | Kazakhstan | A new species of Carpenter-Moths (Lepidoptera, Cossidae) from Tarbagatai (NE Kazakhstan) and Altai (SW Siberia, Russia) Mountains | Yakovlev, R.V. et al., 2020 | \ |
GBMND20666-21 | MW170380 | Dyspessa salicicola | Russia | A new species of Carpenter-Moths (Lepidoptera, Cossidae) from Tarbagatai (NE Kazakhstan) and Altai (SW Siberia, Russia) Mountains | Yakovlev, R.V. et al., 2020 | \ |
GBMND20667-21 | MW170381 | Dyspessa salicicola | Russia | A new species of Carpenter-Moths (Lepidoptera, Cossidae) from Tarbagatai (NE Kazakhstan) and Altai (SW Siberia, Russia) Mountains | Yakovlev, R.V. et al., 2020 | \ |
GBMND20668-21 | MW170377 | Dyspessa salicicola | Azerbaijan | A new species of Carpenter-Moths (Lepidoptera, Cossidae) from Tarbagatai (NE Kazakhstan) and Altai (SW Siberia, Russia) Mountains | Yakovlev, R.V. et al., 2020 | \ |
GBGL26653-19 | MF596152 | Dyspessa salicicola | Azerbaijan | The taxonomic status of Cossus cossus afghanistanus (Lepidoptera, Cossidae) from Afghanistan: insights from molecular and morphological data. | Shapoval, N.A. et al., 2017 | 1 July 2008 |
LON7224-18 | \ | Dyspessa ulula | Croatia | \ | \ | 1 June 2018 |
GBMND20671-21 | MW170384 | Dyspessa ulula | Croatia | A new species of Carpenter-Moths (Lepidoptera, Cossidae) from Tarbagatai (NE Kazakhstan) and Altai (SW Siberia, Russia) Mountains | Yakovlev, R.V. et al., 2020 | \ |
LEATH739-14 | \ | Dyspessa ulula | Italy | DNA barcode library for Lepidoptera from South Tyrol and Tyrol (Italy, Austria)–Impetus for integrative species discrimination in the 21st Century | Huemer, P. & Heber, P.D.N., 2016 | 6 June 2014 |
LEATJ785-15 | \ | Dyspessa ulula | Italy | DNA barcode library for Lepidoptera from South Tyrol and Tyrol (Italy, Austria)–Impetus for integrative species discrimination in the 21st Century | Huemer, P. & Heber, P.D.N., 2016 | 18 June 2015 |
PHLAA450-09 | HM425963 | Dyspessa ulula | France | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 6 June 2009 |
PHLAE165-11 | JN307401 | Dyspessa ulula | Greece | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 17 May 2009 |
PHLAF586-11 | \ | Dyspessa ulula | Italy | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 11 June 2009 |
PHLAG165-12 | \ | Dyspessa ulula | Greece | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 15 July 2009 |
PHLAG174-12 | \ | Dyspessa ulula | Italy | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 16 July 2010 |
PHLAG175-12 | \ | Dyspessa ulula | Italy | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 16 July 2010 |
PHLSA419-11 | \ | Dyspessa ulula | Croatia | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 25 May 1995 |
PHLSA420-11 | \ | Dyspessa ulula | Croatia | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 25 May 1995 |
PHLSA755-11 | \ | Dyspessa ulula | France | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 20 May 2010 |
PHLSA756-11 | \ | Dyspessa ulula | France | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 20 May 2010 |
GBGL13650-14 | KC791450 | Eogystia hippophaecolus | China | Forest Resource Conservation Department, Key Laboratory for Silviculture and Conservation of Ministry of Education | Li, J. & Chen, M. | 10 August 2012 |
GBGL13651-14 | KC791451 | Eogystia hippophaecolus | China | Forest Resource Conservation Department, Key Laboratory for Silviculture and Conservation of Ministry of Education | Li, J. & Chen, M. | 10 August 2012 |
GBGL13658-14 | KC791458 | Eogystia hippophaecolus | China | Forest Resource Conservation Department, Key Laboratory for Silviculture and Conservation of Ministry of Education | Li, J. & Chen, M. | 28 July 2012 |
GBGL13659-14 | KC791459 | Eogystia hippophaecolus | China | Forest Resource Conservation Department, Key Laboratory for Silviculture and Conservation of Ministry of Education | Li, J. & Chen, M. | 28 July 2012 |
GBGL13661-14 | KC791482 | Eogystia sibirica | China | Forest Resource Conservation Department, Key Laboratory for Silviculture and Conservation of Ministry of Education | Li, J. & Chen, M. | 28 July 2012 |
GBGL13662-14 | KC791483 | Eogystia sibirica | China | Forest Resource Conservation Department, Key Laboratory for Silviculture and Conservation of Ministry of Education | Li, J. & Chen, M. | 28 July 2012 |
GBGL13663-14 | KC791484 | Eogystia sibirica | China | Forest Resource Conservation Department, Key Laboratory for Silviculture and Conservation of Ministry of Education | Li, J. & Chen, M. | 28 July 2012 |
GBGL13664-14 | KC791443 | Holcocerus artemisiae | China | Forest Resource Conservation Department, Key Laboratory for Silviculture and Conservation of Ministry of Education | Li, J. & Chen, M. | 8 August 2012 |
GBGL13665-14 | KC791444 | Holcocerus artemisiae | China | Forest Resource Conservation Department, Key Laboratory for Silviculture and Conservation of Ministry of Education | Li, J. & Chen, M. | 8 August 2012 |
GBGL13666-14 | KC791445 | Holcocerus artemisiae | China | Forest Resource Conservation Department, Key Laboratory for Silviculture and Conservation of Ministry of Education | Li, J. & Chen, M. | 8 August 2012 |
MAMOT1708-12 | KX860954 | Holcocerus gloriosus | Pakistan | Mapping global biodiversity connections with DNA barcodes: Lepidoptera of Pakistan | Muhammad A. et al., 2017 | 9 May 2012 |
MAMOT1709-12 | KX863339 | Holcocerus gloriosus | Pakistan | Mapping global biodiversity connections with DNA barcodes: Lepidoptera of Pakistan | Muhammad A. et al., 2017 | 10 May 2012 |
MAMOT1710-12 | KX862572 | Holcocerus gloriosus | Pakistan | Mapping global biodiversity connections with DNA barcodes: Lepidoptera of Pakistan | Muhammad A. et al., 2017 | 8 May 2012 |
GBGL26655-19 | MF071456 | Kerzhnerocossus tannuolus | Russia | Review of the genus Kerzhnerocossus Yakovlev, 2011 (Lepidoptera: Cossidae) with descriptions of two new species from Russia and Mongolia | Saldaitis, A., 2011 | \ |
GBGL26656-19 | MF071457 | Kerzhnerocossus tannuolus | Russia | Review of the genus Kerzhnerocossus Yakovlev, 2011 (Lepidoptera: Cossidae) with descriptions of two new species from Russia and Mongolia | Saldaitis, A., 2011 | \ |
GBGL31256-19 | KT713822 | Meharia semilactea | \ | Elusive ditrysian phylogeny: an account of combining systematized morphology with molecular data (Lepidoptera) | Heikkilae, M. et al., 2015 | \ |
LEFIJ14982-20 | \ | Meharia sp. | Morocco | \ | \ | 13 May 2010 |
GBGL31258-19 | KT713823 | Meharia sp. | \ | Elusive ditrysian phylogeny: an account of combining systematized morphology with molecular data (Lepidoptera) | Heikkilae, M. et al., 2015 | \ |
BCMI261-11 | Mormogystia proleuca | Israel | iBOL Data Release | iBOL | 27 May 2009 | |
BCMI266-11 | Mormogystia proleuca | Israel | iBOL Data Release | iBOL | 31 May 2009 | |
GWORZ172-10 | Parahypopta caestrum | Italy | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 23 June 1998 | |
PHLAB331-10 | HQ968493 | Phragmataecia castaneae | Leichtenstein | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 17 June 2009 |
CGUKA294-09 | KX043172 | Phragmataecia castaneae | UnitedKingdom | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 17 July 2007 |
GWOR4145-09 | KX071724 | Phragmataecia castaneae | Germany | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 8 June 2008 |
LEFIF226-10 | HM874919 | Phragmataecia castaneae | Finland | Testing DNA Barcode Performance in 1000 Species of European Lepidoptera: Large Geographic Distances Have Small Genetic Impacts | Huemer, P. et al., 2014 | 10 June 2002 |
GBGL13668-14 | KC791461 | Streltzoviella insularis | China | Forest Resource Conservation Department, Key Laboratory for Silviculture and Conservation of Ministry of Education | Li, J. & Chen, M. | 28 July 2011 |
GBGL13669-14 | KC791462 | Streltzoviella insularis | China | Forest Resource Conservation Department, Key Laboratory for Silviculture and Conservation of Ministry of Education | Li, J. & Chen, M. | 28 July 2012 |
GBGL13670-14 | KC791463 | Streltzoviella insularis | China | Forest Resource Conservation Department, Key Laboratory for Silviculture and Conservation of Ministry of Education | Li, J. & Chen, M. | 28 July 2012 |
GBGL10959-12 | JN673375 | Streltzoviella insularis | Japan | RIKEN Plant Science Center, Advance NMR Metabomics Research Team | Vergara, F. et al. | \ |
GBMNC49243-20 | MT785457 | Yakudza vicarius | China | \ | \ | \ |
GBGL13671-14 | KC791464 | Yakudza vicarius | China | Forest Resource Conservation Department, Key Laboratory for Silviculture and Conservation of Ministry of Education | Li, J. & Chen, M. | 28 July 2012 |
GBGL13676-14 | KC791469 | Yakudza vicarius | China | Forest Resource Conservation Department, Key Laboratory for Silviculture and Conservation of Ministry of Education | Li, J. & Chen, M. | 28 July 2012 |
GBMNC49252-20 | MF052057 | Yakudza vicarius | China | Using full-length metabarcoding and DNA barcoding to infer community assembly for speciose taxonomic groups: a case study | Hao, M.D. et al., 2020 | \ |
FBLMT329-09 | HQ955163 | Zeuzera pyrina | Germany | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 24 July 1993 |
LEFIL178-10 | JF854515.1 | Zeuzera pyrina | Hungary | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 16 June 2007 |
CGUKD508-09 | KX043062.1 | Zeuzera pyrina | United Kingdom | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 18 July 2008 |
LON266-08 | KX047718.1 | Zeuzera pyrina | Norway | Species-Level Para- and Polyphyly in DNA Barcode Gene Trees: Strong Operational Bias in European Lepidoptera. | Mutanen, M. et al., 2016 | 26 July 2007 |
GU663065.1 | Noctua fimbriata | France | iBOL Data Release | iBOL | 13 July 1993 |
No. of Releve | 1 | 2 | 3 | 4 | 5 | 6 | |||
Exposition | W | W | W | W | S | S | |||
Total Area (sq. m.) | 25 | 25 | 25 | 25 | 25 | 25 | |||
Total Cover (%) | 99 | 98 | 99 | 99 | 98 | 80 | |||
U | T | R | Species | ||||||
1.5 | 4 | 4 | Festuca rupicola Heuffel | 20 | 35 | 20 | 10 | 10 | 5 |
1.5 | 3.5 | 4 | Bromus japonicus Thunb. | 15 | 0.5 | 25 | 0.5 | ||
15 | 10 | ||||||||
3 | 0 | 0 | Achillea milleifolium L. | 10 | 2 | 10 | 2 | 2 | |
1.5 | 3 | 3 | Xeranthemum cylindraceum Sibth. et Sm. | 10 | 0.5 | 15 | |||
2 | 4.5 | 4 | Elymus hispidus (Opiz) Melderis ssp. hispidus | 5 | 20 | 15 | |||
2 | 4 | 3 | Fragaria viridis Weston | 5 | 2 | 2 | 1 | ||
3 | 2 | 2 | Cruciata glabra (L.) Ehrend. | 5 | 0.5 | 0.5 | |||
2.5 | 2.5 | 0 | Galium verum L. | 3 | 3 | 3 | 0.5 | 2 | 2 |
3 | 3 | 0 | Glechoma hederacea L. | 3 | |||||
1.5 | 3.5 | 4 | Thymus pannonicus All. | 2 | 0.5 | 0.5 | 2 | ||
2.5 | 3 | 4 | Agrimonia eupatoria L. | 2 | 0.5 | 3 | 2 | 0.5 | |
3 | 3 | 0 | Inula britanica L. | 2 | 0.5 | 0.5 | |||
2 | 3 | 5 | Medicago falcata L. | 1 | 0.5 | 0.5 | 0.5 | 1 | |
1 | 0.5 | 0.5 | 0.5 | ||||||
2.5 | 3 | 3 | Clinopodium vulgare L. | 1 | 0.5 | 0.5 | 0.5 | 1 | |
Torilis japonica (Hoott.) DC. | 1 | 0.5 | 0.5 | ||||||
2.5 | 4 | 4 | Brachypodium pinnatum (L.) Beauv. | 0.5 | 5 | 15 | 0.5 | 2 | 2 |
2 | 3 | 4 | Euphorbia cyparissias L. | 0.5 | 5 | 5 | 0.5 | 0.5 | 3 |
2.5 | 3.5 | 3 | Crataegus monogyna Jacq. | 0.5 | 0.5 | 0.5 | 0.5 | ||
3 | 3 | 0 | Odontites vernus (Bellardi) Dumort. | 0.5 | 0.5 | 0.5 | 0.5 | ||
3 | 3 | 0 | Hypericum perforatum L. | 0.5 | 0.5 | 0.5 | 0.1 | ||
2 | 3 | 4 | Artemisia absinthium L. | 0.5 | 2 | 0.5 | |||
1 | 5 | 4 | Eryngium campestre L. | 0.5 | 0.5 | 1 | |||
Daucus carota L. ssp. carota | 0.5 | 0.5 | 1 | 1 | |||||
1.5 | 3 | 4 | Picris hieracioides L. | 0.5 | 0.5 | ||||
2.5 | 2.5 | 0 | Pimpinella saxifraga L. | 0.5 | 0.5 | 0.5 | 0.5 | ||
1.5 | 3.5 | 4 | Potentilla recta L. | 0.5 | 0.5 | ||||
4.5 | 3 | 4 | Mentha longifolia (L.) Hudson | 0.5 | |||||
2 | 4 | 3.5 | Stipa tirsa Steven | 5 | 10 | 3 | |||
1 | 5 | 4 | Stipa capillata L. | 15 | 5 | ||||
1 | 4.5 | 4.5 | Stipa lessingiana Trin. et Rupr. | 15 | 5 | ||||
1 | 5 | 5 | Salvia nutans L. | 10 | 1 | ||||
0 | 0 | 0 | Elymus repens (L.) Gould. | 5 | 2 | ||||
2 | 4 | 4 | Teucrium chamaedrys L. | 0.5 | 5 | 1 | |||
2.5 | 3 | 4.5 | Filipendula vulgaris Moench | 5 | 5 | 3 | 1 | ||
2 | 5 | 4 | Dorycnium pentaphyllum Scop. ssp. herbaceum (Vill.) Bonnier et Layens | 15 | 3 | ||||
3 | 3 | 0 | Carex tomentosa L. | 3 | 3 | ||||
2 | 3 | 4 | Phleum phleoides (L.) Karsten | 3 | |||||
1.5 | 3.5 | 4 | Inula ensifolia L. | 2 | |||||
2 | 4 | 4 | Thesium linophyllon L. | 0.5 | 2 | ||||
2 | 3.5 | 4 | Adonis vernalis L. | 3 | 0.5 | 0.5 | 1 | 1 | |
1.5 | 4 | 4.5 | Cephalaria uralensis (Murray) Roemer et Schultes | 1 | |||||
1 | 4 | 5 | Teucrium montanum L. | 1 | |||||
3 | 0 | 4 | Dactylis glomerata L. | 7 | 0.5 | 0.5 | 5 | ||
2 | 3.5 | 4 | Bupleurum falcatum L. | 0.5 | 0.5 | 0.5 | 1 | ||
2 | 3 | 4 | Coronilla varia L. | 0.5 | 0.5 | 0.5 | 1 | ||
0.5 | 0.5 | 0.5 | |||||||
2 | 3 | 3 | Prunus spinosa L. | 0.5 | 0.5 | 0.5 | 0.5 | ||
1.5 | 3.5 | 4 | Linum hirsutum L. | 0.5 | |||||
2 | 3.5 | 4.5 | Centaurea stoebe L. | 0.5 | |||||
0.5 | |||||||||
1 | 5 | 4 | Ajuga laxmannii (L.) Bentham | 0.5 | 0.5 | ||||
2 | 4 | 4 | Odontites luteus (L.) Clairv. | 0.5 | |||||
2 | 4 | 4.5 | Onobrychis viciifolia Scop. | 0.5 | 1 | ||||
2 | 4 | 4 | Echium maculatum L. | 0.5 | 1 | ||||
1.5 | 5 | 3 | Dichanthium ischaemum (L.) Roberty | 5 | 0.5 | 1 | |||
2 | 4 | 4 | Thalictrum minus L. | 1 | 0.5 | ||||
2.5 | 0 | 4.5 | Plantago media L. | 0.5 | 1 | ||||
2 | 4 | 4 | Galium glaucum L. | 0.5 | 1 | ||||
1.5 | 4 | 4 | Astragalus monspessulanus L. | 0.5 | |||||
2 | 4 | 5 | Koeleria macrantha (Ledeb.) Schultes ssp. macrantha | 0.5 | |||||
2 | 3.5 | 4.5 | Potentilla arenaria Borkh. | 0.5 | |||||
2.5 | 3 | 5 | Salvia pratensis L. | 0.5 | |||||
2 | 4 | 4.5 | Crambe tatarica Sebeok | 0.5 | 1 | ||||
2 | 3 | 5 | Asperula cynanchica L. | 0.5 | 0.5 | 0.5 | 0.1 | 1 | |
3 | 4 | 4 | Juglans regia L. | 0.1 | |||||
1.5 | 4.5 | 4 | Plantago argentea Chaix | 0.1 | |||||
2.5 | 3.5 | 0 | Tragopogon dubius Scop. | 0.1 | |||||
1 | 4 | 4 | Veronica spicata L. ssp. spicata | 0.5 | 0.1 | 1 | |||
3.5 | 0 | 0 | Trifolium repens L. | - | 2 | ||||
2 | 3 | 0 | Poa angustifolia L. | 3 | 2 | 1 | |||
2.5 | 3.5 | 4 | Phlomis tuberosa L. | 2 | 0.5 | 15 | |||
2 | 3 | 3 | Origanum vulgare L. | 2 | |||||
2.5 | 4 | 3 | Salvia nemorosa L. | 2 | 0.5 | 10 | |||
4.5 | 3.5 | 4.5 | Iris sibirica L. | 0.5 | |||||
2 | 5 | 5 | Stachys recta L. | 0.5 | 0.5 | 0.1 | 3 | ||
2.5 | 3 | 3 | Inula salicina L. | 0.5 | 0.5 | ||||
1.5 | 4 | 4 | Stipa pennata L. | 10 | |||||
2 | 4 | 4 | Rosa gallica L. | 3 | |||||
3 | 3 | 4.5 | Prunella grandiflora (L.) Scholler | 0.5 | |||||
2 | 3.5 | 4 | Jurinea mollis (L.) Reichenb. ssp. transsylvanica (Sprengel) Hayek | 1 | |||||
3 | 3 | 0 | Lolium perenne L. | 1 | |||||
3 | 0 | 0 | Sonchus oleraceus L. | 1 | |||||
1 | |||||||||
2 | 3 | 4.5 | Polygala major Jacq. | 0.5 | |||||
2 | 3.5 | 4 | Bromus pannonicus Kummer et Sendtner | 1 | |||||
2 | 3 | 4 | Carex michelii Host | 2 | |||||
3 | 3 | 0 | Cerinthe minor L. | 1 | |||||
2.5 | 3.5 | 3.5 | Convolvulus arvensis L. | 2 | |||||
2.5 | 0 | 0 | Lotus corniculatus L. | 0.5 | 1 | ||||
3 | 0 | 0 | Plantago lanceolata L. | 0.5 | |||||
2.5 | 4 | 0 | Robinia pseudoacacia L. | 1 | |||||
2 | 3.5 | 4 | Salvia austriaca Jacq. | 0.5 | 1 | ||||
2 | 4 | 0 | Salvia verticillata L. | 5 | |||||
2 | 3 | 3 | Seseli annuum L. | 0.5 | |||||
2.5 | 4 | 0 | Setaria pumila (Poiret) Schultes | 1 | |||||
3 | 0 | 0 | Taraxacum officinale Weber | 1 | |||||
3 | 2 | 3 | Tragopogon pratensis L. ssp. pratensis | 2 |
>RONOC164-18 Paracossulus thrips AACATTATATTTTATTTTTGGAATTTGATCTGGAATAGTGGGTACTTCATTAAGTCTTTTAATCCGAGCTGAATTAGGAAACCCCGGATCATTAATTGGAAATGATCAAATCTATAACACTATCGTTACAGCTCATGCTTTTATTATAATTTTCTTCATAGTAATACCCATTATAATTGGGGGATTTGGTAATTGACTGGTTCCATTAATATTAGGAGCCCCTGATATGGCTTTCCCACGAATAAACAATATAAGATTTTGATTACTCCCCCCCTCATTAACCCTTTTAATCTCTAGAAGTATTGTTGAAAATGGAGCTGGCACAGGATGAACAGTTTATCCCCCATTATCTTCTAATATCGCTCATGGGGGTACTTCTGTTGACTTAGCAATTTTTTCCTTACATTTAGCAGGAATTTCCTCAATCCTAGGAGCTATTAATTTCATTACAACTATTATTAATATACGACCATACAACATATCATTTGATCAAATACCCCTATTTGTATGAGCAGTTGGAATTACTGCCCTATTATTACTTTTATCATTACCAGTATTAGCAGGAGCTATTACTATATTACTAACAGATCGAAATTTAAATACCTCATTCTTCGACCCAGCTGGAGGGGGAGATCCTATTTTATATCAACATTTATTT |
>RONOC165-18 Paracossulus thrips AACATTATATTTTATTTTTGGAATTTGATCTGGAATAGTGGGTACTTCATTAAGTCTTTTAATCCGAGCTGAATTAGGAAACCCCGGATCATTAATTGGAAATGATCAAATCTATAACACTATCGTTACAGCTCATGCTTTTATTATAATTTTCTTCATAGTAATACCCATTATAATTGGAGGATTTGGTAATTGACTGGTTCCATTAATATTAGGAGCCCCTGATATGGCTTTCCCACGAATAAACAATATAAGATTTTGATTACTCCCCCCCTCATTAACCCTTTTAATCTCTAGAAGTATTGTTGAAAATGGAGCTGGCACAGGATGAACAGTTTATCCCCCATTATCTTCTAATATCGCTCATGGGGGTACTTCTGTTGACTTAGCAATTTTTTCCTTACATTTAGCAGGAATTTCCTCAATCCTAGGAGCTATTAATTTCATTACAACTATTATTAATATACGACCATACAACATATCATTTGATCAAATACCCCTATTTGTATGAGCAGTTGGAATTACTGCCCTATTATTACTTTTATCATTACCAGTATTAGCAGGAGCTATTACTATATTACTAACAGATCGAAATTTAAATACCTCATTCTTCGACCCAGCTGGAGGGGGAGATCCTATTTTATATCAACATTTATTT |
>RONOC166-18 Paracossulus thrips AACATTATATTTTATTTTTGGAATTTGATCTGGAATAGTGGGTACTTCATTAAGTCTTTTAATCCGAGCTGAATTAGGAAACCCCGGATCATTAATTGGAAATGATCAAATCTATAACACTATCGTTACAGCTCATGCTTTTATTATAATTTTCTTCATAGTAATACCCATTATAATTGGAGGATTTGGTAATTGACTGGTTCCATTAATATTAGGAGCCCCTGATATGGCTTTCCCACGAATAAACAATATAAGATTTTGATTACTCCCCCCCTCATTAACCCTTTTAATCTCTAGAAGTATTGTTGAAAATGGAGCTGGCACAGGATGAACAGTTTATCCCCCATTATCTTCTAATATCGCTCATGGGGGTACTTCTGTTGACTTAGCAATTTTTTCCTTACATTTAGCAGGAATTTCCTCAATCCTAGGAGCTATTAATTTCATTACAACTATTATTAATATACGACCATACAACATATCATTTGATCAAATACCCCTATTTGTATGAGCAGTTGGAATTACTGCCCTATTATTACTTTTATCATTACCAGTATTAGCAGGAGCTATTACTATATTACTAACAGATCGAAATTTAAATACCTCATTCTTCGACCCAGCTGGAGGGGGAGATCCTATTTTATATCAACATTTATTT |
>RONOC167-18 Paracossulus thrips AGCTCATGCTTTTATTATAATTTTCTTCATAGTAATACCNATTATAATTGGAGGATTTGGTAATTGACTGGTTCCATTAATATTAGGAGCNCCTGATATGGCTTTCCCACGAATAAACAATATAAGATTTTGATTACTNCCCCCCTCATTAACCCTTTTAATCTCTAGAAGTATTGTTGAAAATGGAGCNGGCACAGGATGAACAGTTTATCCCCCATTATCNTCTAATATCGCTCATGGGGGTACTTCTGTTGACTTNGCAATTTTTTCCTTACATTTAGCAGGAATTTCCTCAATCCTAGGAGCTATTAATTTCATTACAACTATTATTAATATACGACCNTACAACATATCATTTGATCAAATACCCCTATTTGTATGAGCAGTTGGAATTACTGCCCTATTATTACTTTTATCATTACCAGTATTAGCAGGAGCTATTACTATATTACTAACAGATCGAAATTTAAATACCTCATTCTTCGACCCAGCTGGAGGGGGAGATCCTATTTTATANCAACATTTATTT |
References
- Iorgu, I.Ș.; Surugiu, V.; Gheoca, V.; Popa, O.P. Ghid Sintetic Pentru Monitorizarea Speciilor de Nevertebrate de Interes Comunitar din România; Asocierea SC Compania de Consultanță și Asistență Tehnică SRL și SC Integra Trading SRL: Bucuresti, Romania, 2015; p. 63. ISSN 9786069246238. [Google Scholar]
- Hristova, H.; Beshkov, S. Checklist of the Superfamilies Cossoidea, Thyridoidea, Drepanoidea, Lasiocampoidea, Bombycoidea and Noctuoidea: Notodontidae (Insecta: Lepidoptera) of Bulgaria, with Application of the IUCN Red List Criteria at the National Level. Acta Zool. Bulg. 2016, 68, 569–576. [Google Scholar]
- Rákosy, L.; Corduneanu, C.; Crișan, A.; Dincă, V.; Kovács, S.; Stănescu, M.; Székely, L. Lista Roșie a Fluturilor din România/Romanian Red List of Lepidoptera; Presa Universitară Clujeană: Cluj-Napoca, Romania, 2021. [Google Scholar]
- Sum, S. Gerinctelenek. In Natura 2000 Fajok és ÉLŐHELYEK Magyarországon; Haraszthy, L., Ed.; Pro Vértes Közalapítvány: Csákvár, Hungary, 2014; p. 145. [Google Scholar]
- Polumordvinov, O.A.; Monakhov, E.M. Rare and demanding of protection Lepidoptera (Insecta) of Penzenskaya Oblast’. Part 1 (Macrolepidoptera). Fauna Ecol. Anim. 2002, 3, 29–48. [Google Scholar]
- Leraut, P. Papillons de Nuit d’Europe: Bombyx, Sphinx, Ecailles; NAP EDITIONS: Paris, France, 2006; Volume 1, ISBN 9782913688063. [Google Scholar]
- Székely, L. Moths of Romania 1. Fluturi de Noapte din Romania. 1. Hepialidae, Limacodidae, Cossidae, Thyrididae, Lasiocampidae, Endromidae, Saturniidae, Lemoniidae, Sphingidae, Drepanidae, Thaumetopoeidae, Notodontidae, Pantheidae, Lymantriidae, Arctiidae; Disz Tipo: Sacele-Brasov, Romania, 2010; Volume 1, pp. 66–67. [Google Scholar]
- Székely, L. The Macrolepidoptera (Insecta) of The Razelm-Sinoe Lagoon Complex (Dobrogea, Romania). J. Wetl. Biodivers. 2018, 8, 113–148. [Google Scholar]
- Yakovlev, R.V. Catalogue of the family Cossidae of the Old World (Lepidoptera). Neue Entomol. Nachr. 2011, 66, 1–130. [Google Scholar]
- Beshkov, S.; Nahirnić-Beshkova, A. Paracossulus thrips (Hübner, 1818) (Lep. Cossidae) Re-discovered in Bulgaria with notes of some other surprising findings in the Dragoman Natura 2000 Protected Area. Entomol. Rec. J. Var. 2021, 133, 22–30. [Google Scholar]
- Didmanidze, E.A.; Yakovlev, R.V. Cossidae (Lepidoptera) of Georgia. Entomofauna 2007, 28, 1–16. [Google Scholar]
- Fazekas, I. Somogy megye molylepke faunája (Lepidoptera, Microlepidoptera). Nat. Som. 2001, 1, 303–327. [Google Scholar] [CrossRef]
- Fazekas, I. Systematisches und synonymisches Verzeichnis der Microlepidopteren Ungarns (Lepidoptera, Microlepidoptera). Folia Hist. Nat. Mus. Matra. 2002, 26, 289–327. [Google Scholar]
- Fazekas, I. Microlepidoptera Pannoniae meridionalis, IV. Baranya megye Microlepidoptera faunájának katalógusa (Lepidoptera). Folia Comloensis 2002, 11, 5–76. [Google Scholar]
- Buresch, I.; Tuleschkow, K. Schmetterlingsfauna Bulgariens. Die horizontale Verbreitung der Schmetterlinge (Lepidoptera) in Bulgarien; Macrolepidoptera: Sofia, Bulgaria, 1932; Volume 1–4, pp. 152–157. [Google Scholar]
- Ganev, J. Catalogue of the Bulgarian Bombyces and Sphinges (Lepidoptera: Notodontidae, Dilobidae, Thaumetopoeidae, Ctenuchidae, Saturniidae, Endromidae, Lasiocampidae, Sphingidae, Hepialidae, Cossidae, Thyrididae, Limacodidae, Drepa- nidae, Thyatiridae, Lymantriidae, Arctiidae, Nolidae). Entomofauna 1984, 5, 391–419. [Google Scholar]
- Bidzilya, A.V.; Budashkin, J.L.; Zhakov, A.V. New records of Lepidoptera (Insecta) in Ukraine. Kharkov Entomol. Soc. Gaz. 2003, 10, 59–73. (In Russian) [Google Scholar]
- Staudinger, O. Catalog der Lepidopteren des Europaeischen Faunengebiets. I. Lepidoptera; Staudinger, O., Ed.; Dresden University Press: Dresden, Germany, 1871; pp. 61–63. [Google Scholar]
- Uvarov, B.P. To the Fauna of Lepidoptera of Transural kirgiz steppe. Rus. Ent. Obozr. 1910, 10, 161–169. [Google Scholar]
- De Freina, J.J.; Witt, T.J. Die Bombyces und Sphinges der Westpalaearktis; Edition Forschung & Wissenschaft: München, Germany, 1990; ISBN 13-978-3926285027. [Google Scholar]
- Anikin, V.V.; Sachkov, S.A.; Zolotuhin, V.V. “Fauna lepidopterologica Volgo-Uralensis” 150 years later: Changes and additions. Part 2. Bombyces and Sphinges (Insecta, Lepidoptera). Atalanta 2000, 31, 265–292. [Google Scholar]
- Knyazev, S.A. Catalogue of Lepidoptera of Omsk Oblast (Russia). Macrolepidoptera. Families: Hepialidae, Brachodidae, Cossidae, Sesiidae, Limacodidae, Zygaenidae, Thyrididae, Drepanidae, Uraniidae, Geometridae, Lasiocampidae, Lemoniidae, Endromididae, Saturniidae, Sphingidae, Notodontidae, Lymantriidae, Arctiidae, Syntomidae, Erebidae, Nolidae, Noctuidae, Hesperiidae, Papilionidae, Pieridae, Lycaenidae, Nymphalidae, Satyridae. Acta Biol. Sib. 2020, 6, 139–226. [Google Scholar] [CrossRef]
- Anikin, V.V.; Baryshnikova, S.V.; Belyaev, E.A.; Budashkin, Y.I.; Nieukerken, E.J.V.; Gorbunov, O.G.; Dubatolov, V.V.; Efetov, K.A.; Zolotuhin, V.V.; Knyazev, S.A.; et al. Catalogue of the Lepidoptera of Russia, 2nd ed.; Sinev, S.Y., Ed.; Zoological Institute RAS: St. Petersburg, Russia, 2019; 448p, ISBN 978-5-98092-068-5. [Google Scholar]
- Eversmann, E. Fauna lepidopterologica Volgo-Uralensis. Exhibens. Lepidopterorum Species Quar per Quinque Annos in Provinciis Volgam Fluvium Inter et Montes Uralenses Sitis Observavit et Descripsit; Typis Universitatis: Cracovie, Poland, 1844; p. 633. [Google Scholar]
- Erschoff, N.; Fild, A. Catalogue of Lepidoptera of Russian. Horae Soc. Entomol. Ross. 1870, 4, 130–204. [Google Scholar]
- Alphéraky, S. Lepidoptera Caucasi septentrionalis. Horae Soc. Entomol. Ross. 1877, 10, 3–34. (In Russian) [Google Scholar]
- Romanoff, N.M. Les Lépidoptères de la Transcaucasie. Mém. Lépid. Rom. 1885, 2, 1–6. [Google Scholar]
- Yakovlev, R.V.; Poltavsky, A.N.; Ilyina, E.V.; Shchurov, V.I.; Witt, T. Cossidae (Lepidoptera) of the Russian Caucasus with the description of a new species. Zootaxa 2015, 4044, 270–288. [Google Scholar] [CrossRef] [Green Version]
- De Freina, J.J. 4. Beitrag zur systematischen Erfassung der Bombyces- und Sphinges-Fauna Kleinasiens. Neue Kenntnisse über Artenspektrum, Systematik und Nomeklatur sowie Beschreibungen neuer Taxa. Mitt. Münch. Ent. Ges. 1983, 72, 57–127. [Google Scholar]
- Didmanidze, E.A. New species of Lepidoptera for fauna of Georgia from Vashlovanskii State Reserve. Bull. Acad. Sci. Georgian SSR 1976, 84, 717–719. (In Russian) [Google Scholar]
- Didmanidze, E.A. Lepidoptera of Arid Landscapes of Georgia (Heterocera); Metzniereba: Tbilisi, Georgia, 1978. (In Russian) [Google Scholar]
- Didmanidze, E.A. Materials on fauna of Macrolepidoptera of Tusheti. Vestn. Gos. Museya Gruz. 1980, 30, 126–166. [Google Scholar]
- Didmanidze, E.A.; Zurashvili, T.M. Materials on study of Macrolepidoptera of Vashlovanskii Reserve. Zapov. Gruz. 1981, 5, 76–118. (In Russian) [Google Scholar]
- Kirby, W.F. Catalogue of Lepidoptera Heterocera (Moths) 1 (Sphinges and Bombyces); Gurney & Jackson: London, UK, 1892; Volume 1, pp. 860–878, 938. [Google Scholar]
- Zhuravlev, S.M. Materials on the fauna Lepidoptera Uralsk Sity and different places of Ural’skaya oblast’. Horae Soc. Entomol. Russ. 1910, 50, 463. (In Russian) [Google Scholar]
- Dubatolov, V.V.; Vasilenko, S.V. Some new and little known Lepidoptera (Macrolepidoptera) of Yakutia. Nasek. Lugovo-taezhnyh Biozenozov 1988, 60–61. (In Russian) [Google Scholar]
- Lastuhin, A.A.; Ivanov, A.Y.; Losmanov, Y.P. On the fauna and fenology of Moths (Lepidoptera, Bombyces et Sphinges) of Chuvashskaya Republik. Entomol. Investig. Chuvashiya 1998, 71–77. (In Russian) [Google Scholar]
- Yakovlev, R.V. Carpenter-moths (Lepidoptera, Cossidae) of Siberia. Euroasian Entomol. J. 2004, 3, 155–163. (In Russian) [Google Scholar]
- Yakovlev, R.V. Carpenter-moths (Lepidoptera: Cossidae) of Russia. Eversmannia 2007, 9, 11–33. (In Russian) [Google Scholar]
- Didmanidze, E.A.; Yakovlev, R.V. New distribution records of Isoceras huberi Eitschberger & Ströhle, 1987 and Semagystia cuhensis de Freina, 1994 (Lepidoptera, Cossidae). Atalanta 2005, 36, 575–576. [Google Scholar]
- Yakovlev, R.V. System and Zoogeography of Carpenter-Moths (Lepidoptera: Cossidae) of Old World; Altai State University Publishing: Barnaul, Russia, 2014; p. 394. (In Russian) [Google Scholar]
- Daniel, F. Monographie der palaearktischen Cossidae. V. Die Genera Parahypopta g.n., Sinicossus Clench und Catopta Stgr. Mitt. Münch. Entomol. Ges. 1961, 51, 160–212. [Google Scholar]
- Schrool, J.W. A phylogenetic study on Cossidae (Lepidoptera: Ditrysia) based on external adult morphology. Zool. Verh. 1990, 263, 1–295. [Google Scholar]
- Rebel, H. Beitrag zur Lepidopterenfauna Bulgariens. versammlung der Sektion fur Lepidopterologie. Verhandlungen der k.k. Zool.-Bot. Ges. Wien 1916, LXVI, 36–46. [Google Scholar]
- Tschorbadjiev, P. Beitrag zur Schmetterlingsfauna der Stadt Sliven und ihrer Umgebung. Z. Bulg. Acad. Wiss. 1919, 17, 175–214. [Google Scholar]
- Beshkov, S.A. contribution to the knowledge of the Bulgarian Lepidoptera fauna (Lepidoptera: Macrolepidoptera). Phegea 1995, 23, 201–218. [Google Scholar]
- Abadjiev, S.; Beshkov, S. Prime Butterfly Areas in Bulgaria; Pensoft: Sofia, Bulgaria, 2007; Volume 69, p. 222. ISBN 9789546423047. [Google Scholar]
- Beshkov, S. An Identification Guide for Natura 2000 Species in Bulgaria. 1. Lepidoptera (Butterflies and Moths); Library, Directorate of the Natural Park “Vitosha”: Sofia, Bulgaria, 2011; 151p. [Google Scholar]
- Sheshurak, P.N.; Voblenko, A.S.; Kavurka, V.V.; Nazarov, N.V. Finds of insects included in the annexes of the Convention on the Protection of Wild Fauna and Flora and Natural Habitats in Europe (Berne Convention), on the territory of Ukraine. Zustrichi species recorded before the Chervona Book of Ukraine and international lands/Series: “Conservation Biology in Ukraine”. Vip 2020, 19, 613–626. [Google Scholar]
- Abafi-Aigner, L. Zur Lepidopteren-fauna Rumäniens. Bull. Soc. Sci. Impr. l’Etat Bucureşti 1901, 9, 1–21. [Google Scholar]
- Czekelius, D. Beiträge zur Schmetterlingsfauna Siebenbürgens. Verhandlungen und Mitteilungen des Siebenbürgischen Vereins für Naturwissenschaften zu Hermannstadt. Fortgesetzt Mitt. Arb. Gem. 1917, 67, 1–56. [Google Scholar]
- Rákosy, L.; Laszlóffy, Z. Fauna de macrolepidoptere de la Fânaţele Clujului (Lepidoptera) (Cluj, România). Bul. Inf. Entomol. 1997, 8, 165–186. [Google Scholar]
- Kovacs, S.; Rakosy, L.; Kovacs, Z.; Craioveanu, C.; Goia, M. Lepidoptere din Rezervația Naturală “Dealul cu fluturi” de la Viișoara (jud. Cluj). Bul. Inf. Soc. Lepid. Rom. 2001, 12, 47–85. [Google Scholar]
- Alexinschi, A.; Peiu, M. Contribuţii la cunoaşterea faunei lepidopterelor regiunii Iaşi. (III). Stud. şi cerc şt., Acad. R.P.R. fil. Iaşi 1955, 6, 245–259. [Google Scholar]
- Nemeş, I.; Dănilă, I. Catalogul colecţiei de lepidoptere “Alexei Alexinschi” de la Muzeul Judeţean Suceava. Partea I-a. Fam. Micropterigidae—Fam. Zygaenidae. Muz. Jud. Suceava. Stud. Com. Şt. Nat 1970, 131–265. [Google Scholar]
- Corduneanu, C.; Balan, C.D.; Popovici, O.A.; Surugiu, I. New records or rare species of Lepidoptera (Insecta: Lepidoptera) from the NorthEast part of Romania (poster presentation). In Proceedigns of the Annual Zoological Congress of “Grigore Antipa” Museum, Bucharest, Romania, 20–23 November 2013; Murariu, D., Adam, C., Chisamera, G., Iorgu, E., Popa, L.O., Popa, O.P., Eds.; Medialux: Bucharest, Romania, 2013; p. 147. [Google Scholar]
- Corduneanu, C.; Balan, C.D.; Popovici, O.A.; Moglan, I. Preliminary faunistical considerations regarding Lepidoptera (Insecta: Lepidoptera) from protected area: “Sărăturile din Valea Ilenei” (Iaşi, Romania) (poster presentation). In Proceedngs of the Annual Zoological Congress of “Grigore Antipa” Museum, Bucharest, Romania, 23–25 November 2012; Murariu, D., Adam, C., Chisamera, G., Iorgu, E., Popa, L.O., Popa, O.P., Eds.; Medialux: Bucharest, Romania, 2012; p. 207. [Google Scholar]
- Manci, C.O.; Sitar, C.; Corduneanu, C.; Balan, C. First contribution to the study of lepidopteran fauna (Insecta: Lepidoptera) from Stânca, Iași, Moldova region (Romania). Mnemosyne 2015, 6, 31–47. [Google Scholar]
- Ruşti, D. Noutăţi faunistice din Dobrogea (Insecta: Lepidoptera). Bul. Inf. Soc. Lepid. Rom. 1993, 4, 17–18. [Google Scholar]
- Székely, L. Noutăţi în fauna Macrolepidopterelor României. Mnemosyne 2013, 4, 61–67. [Google Scholar]
- Székely, L. New and rare macrolepidoptera (Insecta) from Romanian Dobrogea (south-east Romania). Trav. Mus. Natl. Hist. Nat. Grigore Antipa 2016, 5, 195–230. [Google Scholar] [CrossRef] [Green Version]
- Daniel, F. Neue Heteroceren. Mitt. Münch. Entomol. Ges. 1953, 43, 256–261. [Google Scholar]
- Cristea, V. Fitosociologie si Vegetatia României [Phytosociology and the Vegetation of Romania]; Babes-Bolyai University: Cluj Napoca, Romania, 1993. [Google Scholar]
- Gounot, M. Methodes d’Etude, Quantitative de la Vegetation; Masson: Paris, France, 1969. [Google Scholar]
- Gafta, D.; Mountford, O. Manual de Interpretare a Habitatelor Natura 2000 din România; Risoprint: Cluj-Napoca, Romania, 2008. [Google Scholar]
- Sanda, V.; Biţă-Nicolae, C.; Barabaş, N. Flora Cormofitelor Spontane din România; Ion Borcea: Bacău, Romania, 2003. [Google Scholar]
- Hebert, P.D.; Cywinska, A.; Ball, S.L.; DeWaard, J.R. Biological identifications through DNA barcodes. Proc. Biol. Sci. 2003, 270, 313–321. [Google Scholar] [CrossRef] [Green Version]
- DeWaard, J.R.; Ivanova, N.V.; Hajibabaei, M.; Hebert, P.D. Assembling DNA Barcodes. In Environmental Genomics; Martin, C.C., Ed.; Humana Press: Totowa, NJ, USA, 2008; pp. 275–294. [Google Scholar]
- Formularul Standard Natura 2000. Dealurile Clujului Est. Available online: https://biodiversitate.mmediu.ro/rio/natura2000/static/pdf/rosci0295.pdf (accessed on 20 September 2021).
- Formularul Standard Natura 2000. Suatu -Cojocna—Crairât. Available online: https://biodiversitate.mmediu.ro/rio/natura2000/static/pdf/rosci0238.pdf (accessed on 20 September 2021).
- Milvus Group. Available online: https://milvus.ro/rosci0210-rapa-lechinta/ (accessed on 20 September 2021).
- Available online: https://biodiversitate.mmediu.ro/rio/natura2000/static/pdf/rosci0210.pdf (accessed on 20 September 2021).
- Melinte-Dobrinescu, M.C.; Brustur, T.; Jipa, D.; Macaleţ, R.; Ion, G.; Ion, E.; Popa, A.; Stănescu, I.; Briceag, A. The Geological and Palaeontological Heritage of the Buzău Land Geopark (Carpathians, Romania). Geoheritage 2016, 9, 225–236. [Google Scholar] [CrossRef]
- ANMP. Available online: https://biodiversitate.mmediu.ro/rio/natura2000/view?doc_id=ROSCI0272 (accessed on 20 September 2021).
- Formularul Standard Natura 2000. Vulcanii Noroioşi de la Pâclele Mari și Pâclele Mici. Available online: https://biodiversitate.mmediu.ro/rio/natura2000/static/pdf/rosci0272.pdf (accessed on 20 September 2021).
- Săvulescu, T. Flora Republicii Populare Romane (RPR); Academiei R.P.R: București, Romania, 1952. [Google Scholar]
- Available online: www.biolflor.de (accessed on 20 September 2021).
- I Monteys, V.S. Control of leopard moth, Zeuzera pyrina L, in apple orchards in NE Spain: Mating disruption technique. In Proceedings of the 5th International Conference on Integrated Fruit Production, Lleida, Spain, 22–26 October 2020. [Google Scholar]
- Yakovlev, R.V. Catoptinae subfam. n., a new subfamily of carpenter-moths (Lepidoptera, Cossidae). Entomol. Rev. 2009, 89, 927–932. [Google Scholar] [CrossRef]
Species | Voucher | Locality | Natura 2000 Site | County | Sex | Age |
---|---|---|---|---|---|---|
Paracossulus thrips | LEP007309 | Jucu de Sus | ROSCI0295 | Cluj | female | imago |
LEP007310 | Jucu de Sus | ROSCI0295 | Cluj | male | imago | |
LEP007311 | Cojocna | ROSCI0238 | Cluj | - | larva | |
LEP007312 | Râpa Lechința, Iernut | ROSCI0238 | Mureș | female | imago | |
LEP007313 | Ploscoș, Gorgan Hill | ROSCI0210 | Cluj | male | imago | |
LEP007314 | Vulcanii Noroioși | ROSCI0272 | Buzău | male | imago |
Sequence_ID | Species | Collected By | Collection Date | Country | County | Locality |
---|---|---|---|---|---|---|
RONOC164-18 | Paracossulus thrips | Sitar C. | 21 July 2016 | Romania | Cluj | Jucu de Sus |
RONOC165-18 | Paracossulus thrips | Sitar C. | 5 August 2016 | Romania | Cluj | Jucu de Sus |
RONOC166-18 | Paracossulus thrips | Sitar C. | 21 July 2016 | Romania | Cluj | Jucu de Sus |
RONOC167-18 | Paracossulus thrips | Szekely L. | 26 August 2011 | Romania | Tulcea | Babadag Forest |
SEQUENCE_ID | SPECIES | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
RONOC164-18 | Paracossulus thrips | 1 | 0.0021 | 0.0021 | 0.0021 | 0.1037 | 0.1058 | 0.1058 | 0.1120 | 0.1328 | 0.1328 | 0.1120 | 0.1079 | 0.1079 | 0.6846 | |
RONOC165-18 | Paracossulus thrips | 2 | 0.0000 | 0.0000 | 0.1017 | 0.1037 | 0.1037 | 0.1100 | 0.1307 | 0.1307 | 0.1100 | 0.1058 | 0.1058 | 0.6867 | ||
RONOC166-18 | Paracossulus thrips | 3 | 0.0000 | 0.1017 | 0.1037 | 0.1037 | 0.1100 | 0.1307 | 0.1307 | 0.1100 | 0.1058 | 0.1058 | 0.6867 | |||
RONOC167-18 | Paracossulus thrips | 4 | 0.1017 | 0.1037 | 0.1037 | 0.1100 | 0.1307 | 0.1307 | 0.1100 | 0.1058 | 0.1058 | 0.6867 | ||||
GBGL13661-14 | Eogystia sibirica | 5 | 0.0021 | 0.0021 | 0.0705 | 0.1058 | 0.1058 | 0.0954 | 0.0954 | 0.0954 | 0.6888 | |||||
GBGL13662-14 | Eogystia sibirica | 6 | 0.0000 | 0.0726 | 0.1079 | 0.1079 | 0.0975 | 0.0975 | 0.0975 | 0.6909 | ||||||
GBGL13663-14 | Eogystia sibirica | 7 | 0.0726 | 0.1079 | 0.1079 | 0.0975 | 0.0975 | 0.0975 | 0.6909 | |||||||
GWORZ172-10 | Parahypopta caestrum | 8 | 0.1183 | 0.1183 | 0.1037 | 0.0996 | 0.0996 | 0.6846 | ||||||||
BCMI261-11 | Mormogystia proleuca | 9 | 0.0000 | 0.1100 | 0.1100 | 0.1100 | 0.6805 | |||||||||
BCMI266-11 | Mormogystia proleuca | 10 | 0.1100 | 0.1100 | 0.1100 | 0.6805 | ||||||||||
MAMOT1708-12 | Holcocerus gloriosus | 11 | 0.0041 | 0.0041 | 0.6888 | |||||||||||
MAMOT1709-12 | Holcocerus gloriosus | 12 | 0.0000 | 0.6929 | ||||||||||||
MAMOT1710-12 | Holcocerus gloriosus | 13 | 0.6929 | |||||||||||||
GU663065.1 | Noctua fimbriata | 14 |
SEQUENCE_ID | SPECIES | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
RONOC164-18 | Paracossulus thrips | 1 | 0.0021 | 0.0021 | 0.0021 | 0.1846 | 0.1846 | 0.1846 | 0.1826 | 0.1846 | 0.1846 | 0.1846 | 0.1846 | 0.1846 | |
RONOC165-18 | Paracossulus thrips | 2 | 0.0000 | 0.0000 | 0.1867 | 0.1867 | 0.1826 | 0.1805 | 0.1826 | 0.1826 | 0.1826 | 0.1826 | 0.1826 | ||
RONOC166-18 | Paracossulus thrips | 3 | 0.0000 | 0.1867 | 0.1867 | 0.1826 | 0.1805 | 0.1826 | 0.1826 | 0.1826 | 0.1826 | 0.1826 | |||
RONOC167-18 | Paracossulus thrips | 4 | 0.1867 | 0.1867 | 0.1826 | 0.1805 | 0.1826 | 0.1826 | 0.1826 | 0.1826 | 0.1826 | ||||
KC860946.1 | Catopta griseotincta | 5 | 0.0000 | 0.1079 | 0.1100 | 0.1079 | 0.1079 | 0.1079 | 0.1079 | 0.1079 | |||||
QUNOE344-12 | Catopta griseotincta | 6 | 0.1079 | 0.1100 | 0.1079 | 0.1079 | 0.1079 | 0.1079 | 0.1079 | ||||||
GBMNC49256-20 | Catopta albonubilus | 7 | 0.0021 | 0.0000 | 0.0000 | 0.0000 | 0.0000 | 0.0000 | |||||||
GBMNC49258-20 | Catopta albonubilus | 8 | 0.0021 | 0.0021 | 0.0021 | 0.0021 | 0.0021 | ||||||||
GBMNC49259-20 | Catopta albonubilus | 9 | 0.0000 | 0.0000 | 0.0000 | 0.0000 | |||||||||
GBMNC49260-20 | Catopta albonubilus | 10 | 0.0000 | 0.0000 | 0.0000 | ||||||||||
GBMNC49261-20 | Catopta albonubilus | 11 | 0.0000 | 0.0000 | |||||||||||
GBMNC49262-20 | Catopta albonubilus | 12 | 0.0000 | ||||||||||||
GBMNC49263-20 | Catopta albonubilus | 13 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Iacob, G.M.; Craioveanu, C.; Hula, V.; Aurelian, V.M.; Beldean, M.; Sitar, C. Improving the Knowledge on Distribution, Food Preferences and DNA Barcoding of Natura 2000 Protected Species Paracossulus thrips (Lepidoptera, Cossidae) in Romania. Insects 2021, 12, 1087. https://0-doi-org.brum.beds.ac.uk/10.3390/insects12121087
Iacob GM, Craioveanu C, Hula V, Aurelian VM, Beldean M, Sitar C. Improving the Knowledge on Distribution, Food Preferences and DNA Barcoding of Natura 2000 Protected Species Paracossulus thrips (Lepidoptera, Cossidae) in Romania. Insects. 2021; 12(12):1087. https://0-doi-org.brum.beds.ac.uk/10.3390/insects12121087
Chicago/Turabian StyleIacob, Geanina Magdalena, Cristina Craioveanu, Vladimír Hula, Virgiliu Marius Aurelian, Monica Beldean, and Cristian Sitar. 2021. "Improving the Knowledge on Distribution, Food Preferences and DNA Barcoding of Natura 2000 Protected Species Paracossulus thrips (Lepidoptera, Cossidae) in Romania" Insects 12, no. 12: 1087. https://0-doi-org.brum.beds.ac.uk/10.3390/insects12121087